CN105039557A - Cattle PPARG gene transcriptional level fluorescent quantization PCR detection kit - Google Patents
Cattle PPARG gene transcriptional level fluorescent quantization PCR detection kit Download PDFInfo
- Publication number
- CN105039557A CN105039557A CN201510489075.5A CN201510489075A CN105039557A CN 105039557 A CN105039557 A CN 105039557A CN 201510489075 A CN201510489075 A CN 201510489075A CN 105039557 A CN105039557 A CN 105039557A
- Authority
- CN
- China
- Prior art keywords
- primer
- pparg
- detecting
- fluorescent
- standard
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a cattle PPARG gene transcriptional level fluorescent quantization PCR detection kit, and provides a specific detection method. The kit comprises the following reagents: 2*SYBR GREEN MIX, a standard PPARG genetic template, ultrapure water and a primer pair consisting of a primer I and a primer II, wherein the primer I is shown as the sequence 1 in a sequence list, and the primer II is shown as a sequence 2 in the sequence list. The kit has the beneficial effects that an mRNA expression state and an expression quantity of PPARG genes of different cattle species, different tissues and different periods can be effectively detected, and correlation of the gene to the metaboilic level of sugar and grease of animals can be identified, so that the detection requirements of life science, animal medicine and animal science researchers can be met. Compared with the prior art, the kit has the following advantages: 1, a purpose of conveniently and rapidly detecting a transcriptional level of the PPARG genes is realized; 2, advantages of high sensitivity, good stability and low experimental cost in the aspect of detecting the transcriptional level of genes can be realized.
Description
Technical field
The present invention relates to biological technical field, be specifically related to ox PPARG gene transcription level fluorescent quantificationally PCR detecting kit.
Background technology
Polymerase chain reaction (PolymeraseChainReaction, PCR) is technology the most frequently used in DNA manipulation in vitro technology.Template DNA, special primer, dNTPs substrate, hot resistant DNA polymerase, magnesium ion etc. are placed in same buffering reaction system by round pcr, carry out repeatedly high-temperature denatured, low-temperature annealing, middle temperature chain extension thermal cycling, realize target dna fragment in reaction solution in 2
ndoubly amplification (wherein n is times of thermal cycle).
Fluorescent quantitative PCR technique is on the basis of common PCR reaction, in conjunction with the gene quantifying method that real-time fluorescence detection technique and Computer Analysis technology grow up.Quantitative fluorescent PCR adds specific fluorescent mark material in common PCR reaction system, the quantitative change situation of real time monitoring of DNA is carried out by the changing conditions of the fluorescent value in PCR reaction system after detecting each thermal cycling, and obtain the fluorescent quantitation change curve of each sample, and then obtain the Ct value (change in fluorescence reaches cycle number during threshold value) of each reaction tubes; Simultaneously, the target DNA of the dose known amounts of 2-10 multiple dilutions is detected under identical reaction system and reaction conditions, obtain its Ct value, with the logarithm of starting template number for X-coordinate, with Ct value for ordinate zou preparation standard curve, the initiate dna template number of Ct value to each reaction of typical curve and each sample carries out quantitative assay accordingly.
SYBRGreen is a kind of combination dye be incorporated in double-stranded DNA ditch, and after being combined with double-stranded DNA, its fluorescence strengthens greatly, and the detection that this character makes it be applied to amplified production is ideal.The maximum absorption wavelength of SYBRGreen is about 497nm, and emission wavelength is maximum is about 520nm.In PCR reaction system, add excessive SYBR fluorescence dye, after SYBR fluorescence dye mixes DNA double chain specifically, emitting fluorescence signal, and the SYBR dye molecule do not mixed in chain can not launch any fluorescent signal, thus ensure the increase of fluorescent signal and the increase Complete Synchronization of PCR primer.
The transcriptional level of Northernblot technology detectable gene, but whole experimentation operation more complicated.In Northernblot experiment, a main problem is that RNA easily degrades, so experimental articles all in NorthernBlot all needs the process through removing RNA enzyme, as high bake, DEPC process etc., this makes experimentation become more loaded down with trivial details.In addition, in NorthernBlot, a lot of experimental article such as formaldehyde, EB, DEPC, ultraviolet lamp etc. have certain injury to human body.
Although biochip technology experiment reduces the workload of experimenter, and in once testing, can detect several thousand gene expression amounts changes, its sensitivity is lower simultaneously.
SYBRGreen has many good qualities in the real-time context of detection of nucleic acid, and because it combines with all double-stranded DNAs, need not customize especially because template is different, the program versatility therefore designed is good, and price is relatively low.In addition, because a PCR primer can be combined with polymolecular dyestuff, therefore the sensitivity of SRYBGreen is very high.But because SYRBGreen combines with all double-stranded DNAs, the false positive therefore caused by the amplified production of primer dimer, strand secondary structure and mistake can affect quantitative accuracy.Can help to reduce non-specific product to the impact of quantitative result by the change of fluorescent value after measurement raised temperature.The homogeneity being carried out assay products by melting curve contributes to analyzing the quantitative result obtained by SYBRGreen.
Peroxisome proliferators activated receptor γ (PeroxisomeProliferator-ActivatedReceptorGamma, PPARG) also known as lattice row ketone acceptor, be present in the scavenger cell of animal, colon and fatty tissue, major function stores and glucose metabolism for regulating lipid acid, participates in the Adipocyte Differentiation of animal, lipid metabolism, carbohydrate metabolism and inflammatory reaction.PPARG stimulates lipid picked-up and the lipogenesis of adipocyte by regulation and control genes involved.Therefore, the transcriptional level of animal PPARG gene is detected and contributes to the monitoring carbohydrate of animal and the metaboilic level of lipid, further the state of growing of animal is had gained some understanding.
Summary of the invention
Object of the present invention is exactly for above-mentioned defect of the prior art, provide a kind of easy and simple to handle, quick, and can the fluorescent quantificationally PCR detecting kit of different ox kind (comprising milk cow, ox and yak) peroxisome proliferators activated receptor γ (PeroxisomeProliferator-ActivatedReceptorGamma, the PPARG) gene transcription level of detection by quantitative.
To achieve these goals, technical scheme provided by the invention is: for detecting the primer pair of ox PPARG gene transcription level, be made up of primer one and primer two, described primer is just like shown in sequence in sequence table 1, and described primer two is as shown in sequence in sequence table 2.
Second object of the present invention is to provide the test kit for detecting ox PPARG gene transcription level, includes following reagent: 2 × SYBRGREENMIX, standard P PARG gene template, above-mentioned primer pair and ultrapure water.
Further, the above-mentioned test kit for detecting ox PPARG gene transcription level, in described test kit, the proportioning of 2 × SYBRGREENMIX, standard P PARG gene template, above-mentioned primer pair and ultrapure water is 5mL:500 μ L:500 μ L:5mL.
Further, the above-mentioned test kit for detecting ox PPARG gene transcription level, described 2 × SYBRGREENMIX is made up of following reagent: Taq DNA polymerase 0.1U/ μ L, dNTPs substrate 0.4mmol/L, Mg
2+5.0mmol/L, KCl100mmol/L, Tris.HCl20mmol/L, gelatin 0.02%, SYBRGreen dyestuff.
Further, the above-mentioned test kit for detecting ox PPARG gene transcription level, described standard P PARG gene template is as shown in sequence in sequence table 3, and the concentration of standard P PARG gene template is 0.8 μm of ol/L.
Further, the above-mentioned test kit for detecting ox PPARG gene transcription level, in the primer mixed solution of above-mentioned primer pair composition, the concentration of primer one is 8 μm of ol/L, and the concentration of primer two is 8 μm of ol/L.
Further, the above-mentioned test kit for detecting ox PPARG gene transcription level, the purity of described ultrapure water is greater than 18.25M Ω .cm.
3rd object of the present invention there is provided the fluorescent quantitative PCR detection method for detecting ox PPARG gene transcription level, comprises the following steps:
1) prepare quantitative fluorescent PCR reaction premixed liquid: get 2 × SYBRGREENMIX1000 μ L, above-mentioned primer pair composition primer mixed solution 100 μ L, ultrapure water 800 μ L fully mix, preparation obtain 1900 μ L quantitative fluorescent PCR reaction premixed liquid;
2) quantitative fluorescent PCR reaction premixed liquid step 1) obtained is distributed into 100 tubules by 19 μ L/ pipes, adds in the special PCR reaction tubes of fluorescent quantitation or Sptting plate;
3) the standard P PARG gene template of 10E-1,10E-2,10E-3,10E-4,10E-5 dilution series is prepared, and undiluted standard P PARG gene template, totally 6 kinds, often kind of 10 μ L, for detecting the amplification efficiency of gene;
4) quantitative fluorescent PCR reaction amplification: each being equipped with in the 19 μ L quantitative fluorescent PCRs reaction reaction tubess of premixed liquids or Sptting plate adds 1 μ L cDNA to be measured, respectively as the ultrapure water of negative control or as positive control and the PPARG gene template calculating amplification efficiency standard, concussion mixing, after brief centrifugation, upper machine is in quantitative real time PCR Instrument, sex change 30 seconds at 95 DEG C, then by 95 DEG C 5 seconds, 55.2 DEG C of thermal cyclings in 20 seconds 40 times, and 55.2 DEG C time detection record fluorescent signal;
5), after PCR reaction terminates, the Ct value of each reaction is read in order to quantitative analysis; Carry out PCR primer electrophoresis in 3% sepharose, ethidium bromide staining simultaneously, observe under gel imaging system, the result of each PCR reaction of gray scale scanning analytic record.
Further, the above-mentioned fluorescent quantitative PCR detection method for detecting ox PPARG gene transcription level, in described step 4), be equipped with in 100 tubules of 19 μ L quantitative fluorescent PCR reaction premixed liquids, wherein 1 pipe adds and adds as positive control and the PPARG gene template calculating amplification efficiency standard as the ultrapure water of negative control, 6 pipes, and all the other tubules add cDNA to be measured.
Beneficial effect of the present invention is: test kit provided by the invention, effectively can detect different ox kind, different tissues, the mrna expression state of PPARG gene of different times and expression amount, the dependency of the carbohydrate of this gene and animal and the metaboilic level of lipid can be identified, to meet the detection needs of life science, animal medicine and animal science investigator simultaneously.Compared with prior art, the invention has the advantages that: 1, present invention achieves the object conveniently detecting PPARG gene transcription level; 2, the present invention has highly sensitive, that good stability, experimental cost are low advantage in detection gene transcription level.
Accompanying drawing explanation
Fig. 1 is the amplification curve of PPARG gene transcription level fluoroscopic examination result.
Wherein, X-coordinate is PCR cycle index, and ordinate zou is relative fluorescence value (RelativeFluorescenceUnits, RFU), and amplification curve result shows PPARG gene by fluorescence signal value standard compliant " S " type curve.
Fig. 2 is the melting curve of PPARG gene transcription level fluoroscopic examination result.
Wherein, X-coordinate is temperature, and ordinate zou is the variable quantity of relative fluorescence at unit temperature, and melting curve shows that this fluorescent quantitation has the detection specificity of height.
Embodiment
embodiment 1:
Ox PPARG gene transcription level fluorescent quantificationally PCR detecting kit:
This test kit is primarily of 2 × SYBRGREENMIX, standard P PARG gene template, primer mixed solution and ultrapure water composition, and in test kit, the composition of each composition is as shown in table 1:
Table 1
In test kit, each moiety is as follows:
2 × SYBRGreenMIX:TaqDNA polysaccharase 0.1U/ μ L, dNTPs substrate 0.4mmol/L, Mg
2+5.0mmol/L, 100mmol/LKCl, 20mmol/LTris.HCl, 0.02% gelatin and SYBRGreen dyestuff.
Primer mixed solution: primer A8 μm ol/L, primer B8 μm ol/L, primer 1 sequence is 5 '-TCTCCAGCATTTCCACTC-3 ', and primer 2 sequence is 5 '-GGATACAGGCTCCACTTT-3 '.
Standard P PARG gene template: concentration is 0.8 μm of ol/L, PPARG gene template sequence is 5 '-TCTCCAGCATTTCCACTCCGCACTATGAGGACATTCCGTTCCCAAGAGCTGACCCG ATGGTTGCAGATTATAAGTATGACCTGAAGCTCCAAGAGTACCAAAGTGCAACCAA AGTGGAGCCTGTATCC-3 '.
Ultrapure water: purity is more than 18.25M Ω .CM.
Mix appropriate 2 × SYBRGREENMIX, standard P PARG gene template/cDNA template, primer mixed solution and ultrapure water, thermal cycler carries out the thermal cycling repeatedly of high temperature, low temperature, middle temperature; And detect when middle temperature and record fluorescent value.This PPARG quantitative fluorescent PCR, due to primer complete homology in milk cow, ox, yak, derives from the PPARG gene of these species so can effectively increase, thus detects the transcriptional level of PPARG gene.
For detecting the fluorescent quantitative PCR detection method of ox PPARG gene transcription level, comprise the following steps:
1) prepare PPARG fluorescence quantitative PCR reaction solution in proportion, 20 μ L reaction systems are as shown in table 2.
Table 2
Negative control and positive control should be provided with in a quantitative reaction simultaneously;
2) get 2 × SYBRGREENMIX1000 μ L, primer mixed solution 100 μ L, ultrapure water 800 μ L fully mixes, the FQ-PCR preparing 1900 μ L reacts premixed liquid;
3) fully mix above various liquid, premixed liquid is become to be distributed into 100 tubules by 19 μ L/ pipes, adds in the special PCR reaction tubes of fluorescent quantitation or Sptting plate;
4) preparation is with the standard P PARG gene template of 10E-1,10E-2,10E-3,10E-4,10E-5 dilution series, adds undiluted standard HIF-1A gene template, totally 6 pipes, often pipe 10 μ L;
5) each being equipped with in the reaction tubes of 19 μ LPCR reaction premixed liquids of FQ-PCR amplification adds 1 μ L cDNA to be measured, water or standard P PARG gene template respectively, concussion mixing, after brief centrifugation, upper machine is in quantitative real time PCR Instrument (Bio-RadCFX96TM), sex change 30 seconds at 95 DEG C, then by 95 DEG C 5 seconds, 55.2 DEG C of thermal cyclings in 20 seconds 40 times, and 55.2 DEG C time detection record fluorescent signal;
6), after PCR reaction terminates, the Ct value of each reaction is read in order to quantitative analysis; Simultaneously in 3% sepharose performing PCR product electrophoresis, ethidium bromide staining, observes under gel imaging system, the result of each PCR reaction of gray scale scanning analytic record.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
Sequence table
<110> Lanzhou Livestock and Animal Drug Inst., Chinese Academy of Agricultural Science
<120> ox PPARG gene transcription level fluorescent quantificationally PCR detecting kit
<210>1
<211>18
<212>DNA
<213> artificial sequence
<400>1
tctccagcatttccactc18
<210>1
<211>18
<212>DNA
<213> artificial sequence
<400>2
ggatacaggctccacttt18
<210>1
<211>128
<212>DNA
<213> ox standard P PARG gene template
<400>3
tctccagcatttccactccgcactatgaggacattccgttcccaagagctgacccgatgg60
ttgcagattataagtatgacctgaagctccaagagtaccaaagtgcaaccaaagtggagc120
ctgtatcc128
Sequence table
<110> Lanzhou Livestock and Animal Drug Inst., Chinese Academy of Agricultural Science
<120> ox PPARG gene transcription level fluorescent quantificationally PCR detecting kit
<210>1
<211>18
<212>DNA
<213> artificial sequence
<400>1
tctccagcatttccactc18
<210>1
<211>18
<212>DNA
<213> artificial sequence
<400>2
ggatacaggctccacttt18
<210>1
<211>128
<212>DNA
<213> ox standard P PARG gene template
<400>3
tctccagcatttccactccgcactatgaggacattccgttcccaagagctgacccgatgg60
ttgcagattataagtatgacctgaagctccaagagtaccaaagtgcaaccaaagtggagc120
ctgtatcc128
Claims (9)
1. for detecting the primer pair of ox PPARG gene transcription level, it is characterized in that, being made up of primer one and primer two, described primer is just like shown in sequence in sequence table 1, and described primer two is as shown in sequence in sequence table 2.
2. for detecting the test kit of ox PPARG gene transcription level, it is characterized in that, including following reagent: 2 × SYBRGREENMIX, standard P PARG gene template, primer pair according to claim 1 and ultrapure water.
3. the test kit for detecting ox PPARG gene transcription level according to claim 2, it is characterized in that, in described test kit, the proportioning of 2 × SYBRGREENMIX, standard P PARG gene template, primer pair according to claim 1 and ultrapure water is 5mL:500 μ L:500 μ L:5mL.
4. the test kit for detecting ox PPARG gene transcription level according to claim 3, is characterized in that, described 2 × SYBRGREENMIX is made up of following reagent: Taq DNA polymerase 0.1U/ μ L, dNTPs substrate 0.4mmol/L, Mg
2+5.0mmol/L, KCl100mmol/L, Tris.HCl20mmol/L, gelatin 0.02%, SYBRGreen dyestuff.
5. the test kit for detecting ox PPARG gene transcription level according to claim 4, is characterized in that, described standard P PARG gene template is as shown in sequence in sequence table 3, and the concentration of standard P PARG gene template is 0.8 μm of ol/L.
6. the test kit for detecting ox PPARG gene transcription level according to claim 5, is characterized in that, in the primer mixed solution of primer pair composition according to claim 1, the concentration of primer one is 8 μm of ol/L, and the concentration of primer two is 8 μm of ol/L.
7. the test kit for detecting ox PPARG gene transcription level according to claim 6, is characterized in that, the purity of described ultrapure water is greater than 18.25M Ω .cm.
8. for detecting the fluorescent quantitative PCR detection method of ox PPARG gene transcription level, it is characterized in that, comprising the following steps:
1) prepare quantitative fluorescent PCR reaction premixed liquid: the primer mixed solution 100 μ L, the ultrapure water 800 μ L that get the arbitrary described primer pair composition of 2 × SYBRGREENMIX1000 μ L, claim 1-7 fully mix, preparation obtains the quantitative fluorescent PCR reaction premixed liquid of 1900 μ L;
2) quantitative fluorescent PCR reaction premixed liquid step 1) obtained is distributed into 100 tubules by 19 μ L/ pipes, adds in the special PCR reaction tubes of fluorescent quantitation or Sptting plate;
3) the standard P PARG gene template of 10E-1,10E-2,10E-3,10E-4,10E-5 dilution series is prepared, and undiluted standard P PARG gene template, totally 6 kinds, often kind of 10 μ L, for detecting the amplification efficiency of gene;
4) quantitative fluorescent PCR reaction amplification: each being equipped with in the 19 μ L quantitative fluorescent PCRs reaction reaction tubess of premixed liquids or Sptting plate adds 1 μ L cDNA to be measured, respectively as the ultrapure water of negative control or as positive control and the PPARG gene template calculating amplification efficiency standard, concussion mixing, after brief centrifugation, upper machine is in quantitative real time PCR Instrument, sex change 30 seconds at 95 DEG C, then by 95 DEG C 5 seconds, 55.2 DEG C thermal cycling in 20 seconds 40 times, and 55.2 DEG C time detection record fluorescent signal;
5), after PCR reaction terminates, the Ct value of each reaction is read in order to quantitative analysis; Carry out PCR primer electrophoresis in 3% sepharose, ethidium bromide staining simultaneously, observe under gel imaging system, the result of each PCR reaction of gray scale scanning analytic record.
9. the fluorescent quantitative PCR detection method for detecting ox PPARG gene transcription level according to claim 8, it is characterized in that, in described step 4), be equipped with in 100 tubules of 19 μ L quantitative fluorescent PCR reaction premixed liquids, wherein 1 pipe adds and adds as positive control and the PPARG gene template calculating amplification efficiency standard as the ultrapure water of negative control, 6 pipes, and all the other tubules add cDNA to be measured.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510489075.5A CN105039557A (en) | 2015-08-11 | 2015-08-11 | Cattle PPARG gene transcriptional level fluorescent quantization PCR detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510489075.5A CN105039557A (en) | 2015-08-11 | 2015-08-11 | Cattle PPARG gene transcriptional level fluorescent quantization PCR detection kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105039557A true CN105039557A (en) | 2015-11-11 |
Family
ID=54446523
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510489075.5A Pending CN105039557A (en) | 2015-08-11 | 2015-08-11 | Cattle PPARG gene transcriptional level fluorescent quantization PCR detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039557A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110265192A1 (en) * | 2008-09-05 | 2011-10-27 | Syddansk Universitet | Nuclear receptor sensor system in transgenic animal |
| CN104313124A (en) * | 2014-06-10 | 2015-01-28 | 中国农业科学院兰州畜牧与兽药研究所 | Specific primer for detecting bovine IGF-1 genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit |
-
2015
- 2015-08-11 CN CN201510489075.5A patent/CN105039557A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110265192A1 (en) * | 2008-09-05 | 2011-10-27 | Syddansk Universitet | Nuclear receptor sensor system in transgenic animal |
| CN104313124A (en) * | 2014-06-10 | 2015-01-28 | 中国农业科学院兰州畜牧与兽药研究所 | Specific primer for detecting bovine IGF-1 genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit |
Non-Patent Citations (1)
| Title |
|---|
| 滑留帅: "牛SHH基因通过PPARg通路调控脂肪生成", 《中国博士学位论文全文数据库 农业科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Klein | Quantification using real-time PCR technology: applications and limitations | |
| US10683538B2 (en) | Quality assessment of circulating cell-free DNA using multiplexed droplet digital PCR | |
| CN101638687B (en) | Gene chip, kit and method for detecting common pathogenic bacteria of piglets | |
| CN104962630A (en) | Fluorescence-quantitative PCR detection kit for gene transcription level of agasicles hygrophila actin | |
| Venegas et al. | Quantification of mtDNA mutation heteroplasmy (ARMS qPCR) | |
| Lindner et al. | Reliable and robust droplet digital PCR (ddPCR) and RT-ddPCR protocols for mouse studies | |
| CN105734158A (en) | Fluorescent PCR (polymerase chain reaction) detection kit for babesia caballi disease | |
| CN104313124A (en) | Specific primer for detecting bovine IGF-1 genes, fluorescent quantitative PCR detection kit of bovine GHR genes, and detection method and application of kit | |
| CN110885900B (en) | Freeze-dried microchip, kit and method for identifying classical strain of porcine reproductive and respiratory syndrome virus and NADC30-Like strain | |
| CN100390300C (en) | Method and apparatus for analyzing nucleic acid amplification | |
| CN108796106A (en) | Giardia bovis, Cryptosporidium multiple PCR detection kit and its method | |
| CN107287352A (en) | The probe primer group and its method of duck enteritis virus and duck hepatitis virus quick detection | |
| CN103820543A (en) | HLA-B*15:02 allele detection method and kit | |
| CN105039559A (en) | Cattle FABP3 gene transcriptional level fluorescent quantization PCR detection kit | |
| CN105039557A (en) | Cattle PPARG gene transcriptional level fluorescent quantization PCR detection kit | |
| CN104894266B (en) | A kind of specific primer and fluorescence quantitative detection kit for detecting ox MSTN mrna expressions | |
| CN105177169A (en) | Quantitative PCR method adopting dye EvaGreen and dual HotStar polymerases | |
| Li et al. | Development of a novel reference plasmid for accurate quantification of genetically modified Kefeng6 rice DNA in food and feed samples | |
| CN109402249A (en) | A kind of method and kit detecting CYP2C19 gene pleiomorphism | |
| CN103290134B (en) | Fluorogenic quantitative PCR detection kit for bovine ACTB gene transcription level | |
| CN105039558A (en) | Cattle HIF-1A gene transcriptional level fluorescent quantization PCR detection kit | |
| CN103305608B (en) | Ox GAPDH gene transcription level fluorescent quantificationally PCR detecting kit | |
| CN103740822B (en) | Fluorescence quantitative PCR (polymerase chain reaction) combined rapid detection kit and method for SPF (specific pathogen free) mice pathogenic bacteria nucleic acid | |
| CN104894120A (en) | Specific primers for detecting mRNA expression level of bovine LPL (lipoprotein lipase) genes and fluorescent quantitative detecting kit | |
| CN104962629A (en) | Specific primer and fluorescent quantitative detection kit detecting cattle ADIPOQ gene mRNA expression level |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151111 |
|
| RJ01 | Rejection of invention patent application after publication |