CN105012969B - It is a kind of to protect and promote the drug of hair regeneration and its application at alopecia areata - Google Patents
It is a kind of to protect and promote the drug of hair regeneration and its application at alopecia areata Download PDFInfo
- Publication number
- CN105012969B CN105012969B CN201510423086.3A CN201510423086A CN105012969B CN 105012969 B CN105012969 B CN 105012969B CN 201510423086 A CN201510423086 A CN 201510423086A CN 105012969 B CN105012969 B CN 105012969B
- Authority
- CN
- China
- Prior art keywords
- jam
- utr
- carrier
- alopecia areata
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention relates to technique for gene engineering and field of biological medicine, and in particular to a kind of to protect and promote the drug of hair regeneration and its application at alopecia areata.The present invention provides a kind of drug of hair regeneration at protection and promotion alopecia areata, which includes but not limited to：1)LV11-JAM-A 3';The overexpression plasmid of UTR；2) contain LV11-JAM-A 3';The recombinant vector of UTR encoding genes；3) contain LV11-JAM-A3';The recombinant virus of UTR encoding genes；4) contain LV11-JAM-A 3';The recombinant viral vector of UTR encoding genes.The LV11-JAM-A 3' of the present invention;UTR lentiviral particles are the experiment proved that can promote hair follicle at alopecia areata to promote hair regeneration at alopecia areata by the transformation of resting stage to growth period.The present invention provides new thinking and mode for the formation of cutaneous appendages hair in hair regeneration at realization alopecia areata and organization engineering skin.
Description
Technical field
The present invention relates to hairs at technique for gene engineering and field of biological medicine more particularly to a kind of protection and promotion alopecia areata
Regenerated drug and its application.
Background technology
Hair has important physiology and social function, but huge social competition's pressure, spiritual constant tension are stayed up late for a long time
Etc. life styles, all can seriously damage hair follicle health so that cause alopecia.Epidemiological survey is found：Patient's alopecia is younger
Change, the young and the middle aged becomes " main force " in alopecia crowd.Although the understanding of alopecia and understanding are on the increase and are goed deep at present, branch
The remedy measures held or assisted also have progressed, clinical still to expect to find more effective, more fully therapy.
Alopecia areata (alopecia areata) is a kind of non-alopecia cicatrisata of autoimmune, often betides body hairiness
The position of hair, local skin is normal, no conscious sympton.Also known as round alopecia, bald, the alopecia areata of circle.Etiology unknown, hair follicle, ball top
And its papilla reduces, position also moves up, the visible lymphocytic infiltration of perifollicolar, and this disease merges other and itself exempts from sometimes
Epidemic disease disease (such as leucoderma, atopic dermatitis), therefore it is now recognized that the occurrence of this disease there may be the pathogenesis of autoimmunity.
Effective therapy, common treatment measures there is no to have oral Glucocorticoid, cyclosporine etc. alopecia areata at present.
Also have at present and alopecia areata is treated using hair transplantation, but there are problems that this from chaeta source deficiency and survival efficiency (referring to document 1：:
Thakur BK,Verma S.Is hair transplantation always successful in secondary
cicatricial alopeciaInt J Trichology.2015Jan-Mar；7(1):43-4).Therefore, alopecia areata is promoted to suffer from
The hair regeneration of person itself has become tissue repair field one of problem urgently to be resolved hurrily, and research hair regeneration has important reason
By and practical significance.
In the research of hair regeneration, hair papilla cell (dermal papilla cell, DPC) plays very important
Effect is (referring to document 2:Upton JH,Hannen RF,BahtaAW,et.al.Oxidative stress-associated
senescence in dermal papilla cells of men with and rogenetic alopecia.J
Invest Dermatol.2015May；135(5):1244-52).In patients with alopecia areata, DPC miopragias or loss cannot start
Hair follicle development and the periodical of hair substitute (referring to document 3：Norris DA,Duke R,Whang K,Middleton
M.Immunologic cytotoxicity in alopecia areata:apoptosis of dermal papilla
cells in alopecia areata.J Invest Dermatol.1995May；104(5Suppl):8S-9S.).
It is a transmembrane molecule, contactin to link adhesion molecule JAM-A (NM_016946).This hair
Person of good sense's previous experiments confirm that 3 ' UTR of JAM-A can protect the function of DPC, protect the growth of hair, during this achievement in research has been applied
State's patent, number of patent application CN201410830811.4 are entitled：It is a kind of maintenance and recovery human hair papilla cell it is original
The method and its application of property.
At present there is no literature reported in relation to JAM-A genes hair regeneration application.
Invention content
The purpose of the present invention is to provide a kind of drug of hair regeneration at protection and promotion alopecia areata, another mesh of the invention
Be provide JAM-A3 ' UTR genes promote hair regeneration method and JAM-A3 ' UTR genes promote local skin hair
Application in hair regeneration.
The present inventor confirms the primitiveness enhancing of DPC after JAM-A 3 ' UTR up-regulations in trial test, is passed in vitro culture
Number increases, and enhances the ability of DPC induction hair regenerations.
And the increase of the external primitiveness of DPC and the increase of passage number do not ensure that and may this after JAM-A3 ' UTR up-regulations
Treated a bit, and DPC can effectively induce the hair regeneration at alopecia areata.This is because at alopecia areata position, skin and perifollicolar it is aobvious
Micro-structure and microenvironment have change, hair follicle, ball top and its papilla to reduce, and position also moves up.Surrounding substrate is obviously reduced,
Surrounding connective tissue medium vessels structure also changes (referring to aforementioned documents 3).
So can JAM-A3 ' UTR directly facilitate hair regeneration actually
In order to answer these puzzlements, the present invention constructs the overexpression slow virus of JAM-A3 ' UTR with more efficiently and stably
The expression of JAM-A3 ' UTR in skin histology at alopecia areata is adjusted, substantially animal experimental observation JAM-A3 ' UTR exclusive uses whether can
Promote hair regeneration.
The present invention select slow virus carry out vector construction starting point be slow virus efficiency of infection it is higher and with higher
Safety (referring to document 4：Madry H,Cucchiarini M.Clinical potential and challenges of
using genetically modified cells for articular cartilage repair.Croat Med
J.2011Jun；52(3):245-61).Lentiviral gene carrier is carried by the new virus that I type human immunodeficiency virus is transformed
Its transduction efficiency and safety is transformed through multi-time modification as a kind of efficient Gene transfer vector using more and more extensive in body
It is obtained for guarantee.
The main technical schemes of the present invention are as follows：
First, according to JAM-A 3'The gene structure of UTR, design primer pass through using human epidermal cell total DNA as template
PCR transfers target fragment, then builds recombined human pcDNA3.1-JAM-A3'UTR carrier for expression of eukaryon, one in the present invention are excellent
Select LV11-JAM-A3&apos in embodiment;The lentiviral particle of UTR is built by Shanghai JiMa pharmacy Technology Co., Ltd and is prepared.
Then, by LV11-JAM-A3'Skin at the lentiviral particle calibrated shot to alopecia areata of UTR obtains JAM-A3 ' UTR
High expression group mouse.It is by 5 × 10 in a preferred embodiment of the invention5LV11-JAM-A 3'UTR lentiviral particles
The C3H/HeJ mouse of alopecia areata is transplanted to using hypodermic mode at alopecia areata.Hair regeneration situation is observed after injection daily.
The first aspect of the present invention, provides a kind of drug protected and promote hair regeneration at alopecia areata, which is to carry
High JAM-A 3'The reagent of UTR expression quantity.
The raising JAM-A 3'The reagent of UTR expression quantity, including but not limited to：
1)JAM-A 3'The overexpression plasmid of UTR；
2) contain JAM-A 3'The recombinant vector of UTR encoding genes；
3) contain JAM-A 3'The recombinant virus of UTR encoding genes；
4) contain JAM-A 3'The recombinant viral vector of UTR encoding genes.
The second aspect of the present invention provides a kind of LV11-JAM-A 3'UTR carrier for expression of eukaryon (lentiviral particle).
A kind of LV11-JAM-A 3'The construction method of UTR carrier for expression of eukaryon is as follows：
It is as follows to design and synthesize primer：
Sense primer：
CCGCTCGAGGCCTGGTCGGCTCACCGCCTATC(SEQ ID NO:1)
Downstream primer：
ATAAGAATGCGGCCGCTAAAGAATTGGATATTTTTTAATGCAAATTG(SEQ ID NO:2)；
Using human epidermal cell total DNA as template, PCR amplification target fragment such as SEQ ID NO:Shown in 3；
Build LV11-JAM-A 3'UTR carrier for expression of eukaryon, it is carrier to select LV11 (CMV/Neo).
The construction method of carrier for expression of eukaryon therein is conventional method, reference can be made to reference book (writes [Mei ]J. Sha Mubulu
Gram, Huang Peitang is translated,《Molecular Cloning:A Laboratory guide》, Science Press).
The LV11-JAM-A 3&apos that will be built;UTR carrier for expression of eukaryon, the mode that the mode of subcutaneous injection is transplanted transfect
The skin histology at alopecia areata.
The present invention provides one kind containing LV11-JAM-A 3'UTR lentiviral particles are preparing prevention or treatment alopecia areata medicine
Application in object；
Present invention provides one kind containing LV11-JAM-A 3'UTR lentiviral particles are preparing hair at promotion alopecia areata
Application in regenerated product.
The present invention also provides one kind containing LV11-JAM-A 3'The recombinant viral vector of UTR is preparing composite skin
Application in the organization engineering skin of appendicle.
The third aspect of the present invention provides following 1) -4) in any substance promote hair regeneration work(preparing to have
Application in the product of energy：
1)LV11-JAM-A 3'UTR；
2) contain LV11-JAM-A 3'The recombinant vector of UTR encoding genes；
3) contain LV11-JAM-A 3'The recombinant virus of UTR encoding genes；
4) contain LV11-JAM-A 3'The recombinant viral vector of UTR encoding genes；
The rush biological function is to promote hair regeneration；
The position is skin at alopecia areata；
The product is drug；
The LV11-JAM-A 3'The nucleotide sequence of UTR such as SEQ ID NO:Shown in 3.
Beneficial effects of the present invention are as follows：
The present invention is by LV11-JAM-A3'UTR lentiviral particles are injected to skin histology at alopecia areata.LV-NC is compareed.Note
3,5,7,9,14 days after penetrating, after observation injection at alopecia areata the case where hair regeneration, and the density of hair, diameter are recorded, at injection
The structure change of skin materials, HE dyeing observation hair follicles.Experiment in triplicate, can find LV11-JAM-A3'UTR can succeed
Induce hair regeneration at alopecia areata.By experimental studies have found that, LV11-JAM-A3'UTR injections group is compared with LV11-NC injection groups, hair
Reproduction speed dramatically increases.The visible LV11-JAM-A3&apos of HE coloration results;UTR transplantation groups increase compared with LV-NC group hair follicles, long
Degree increases, and grows to subcutaneous tissue (Fig. 2) downwards.
The present invention provides for the formation of cutaneous appendages hair in hair regeneration at realization alopecia areata and organization engineering skin
New thinking and mode.
Description of the drawings
Fig. 1 is alopecia areata model.
Fig. 2 is LV11-JAM-A3'Hair regeneration speed LV-NC injection groups are dramatically speeded up at alopecia areata after UTR injections；Wherein A
For LV11-JAM-A3'UTR injection groups, B are LV-NC injection groups；Arrow meaning is the regeneration situation of skin and hair at alopecia areata.
Fig. 3 hematoxylin-eosins (HE) dyeing shows LV11-JAM-A3'Hair follicle increases in skin histology after UTR injections
More, hair follicle structure is complete, it is seen that growth period hair follicle, hair follicle length increase, and extend to subcutaneous tissue；Wherein A1 and A 2 is LV11-
JAM-A3'UTR injection groups, B 1 and B 2 are LV-NC injection groups, and arrow meaning is the cutaneous appendages hair follicle of new life.
Specific implementation mode
In conjunction with embodiment and attached drawing, the invention will be further described, but the implementation of the present invention is not limited to that.
Embodiment 1：It builds slow virus and is overexpressed plasmid LV11-JAM-A3'UTR
1, human epidermal cell total DNA is prepared
1) in the cell of collector to a clean 1.5ml EP pipes；
2) 600 μ L karyorhexis liquid are added, are put repeatedly with liquid-transfering gun to crack tissue, until visible tissue block disappears, 65 °
20min；
3) 3 μ L RNA enzyme are added, overturn 2-5 times, 37 ° of 30min are then cooled to room temperature.
4) 200 μ L albumen precipitation liquids are added and acutely vibrate 20sec using turbula shaker high speed, are transferred to cooled on ice
5min；
5) room temperature 12000rpm centrifuges 4min, forms the albumen precipitation of white dense；
6) it carefully pipettes in supernatant (containing DNA) to a clean 1.5mL EP pipes, 600 μ L isopropanols is added, pipette supernatant
When do not encounter precipitation；
7) gently turn upside down mixing solution, until white linear DNA forms lumpy precipitate；
8) room temperature 12000rpm centrifuges 5min, and visible white DNA is precipitated at this time, is carefully discarded supernatant；
9) 600 μ L, 70% ethyl alcohol is added, gently overturns EP pipes cleaning DNA precipitations for several times, room temperature 12000rpm centrifugations
2min；
10) it carefully discards supernatant, and EP pipes is inverted on clean blotting paper, spontaneously dry 10~15min；
11) 100 μ L ddH are added2O is incubated 1h in 60 DEG C of baking ovens with dissolving DNA；
12) DNA sample is stored in -20 DEG C of refrigerators.
2, synthetic primer and structure LV11-JAM-A3'UTR carrier for expression of eukaryon
[1]Design primer
Sense primer：CCGCTCGAGGCCTGGTCGGCTCACCGCCTATC(SEQ ID NO:1)XhoI
Downstream primer：
ATAAGAATGCGGCCGCTAAAGAATTGGATATTTTTTAATGCAAATTG(SEQ ID NO:2) NotI
Restriction enzyme site is XhoI and NotI, is separately added into 5 ' ends of primer, and the protection base of restriction enzyme site is added.
[2].PCR target fragment is expanded
[3]Following system is prepared in 0.2mL EP pipes, genomic DNA template stoste takes 0.5 μ L after diluting 20 times
Expand JAM-A3'UTR：
After mixing, it is placed in the amplification of 2400 type PCR amplification instruments of GeneAmp PCR System.
The amplification condition of 3 ' UTR genes of JAM-A：
[4].PCR product recycles
PCR product is after 1% gel electrophoresis, in the UV lamp, the gel strips containing target gene fragment is cut with scalpel
In band to clean 1.5mL EP pipes, after weighing, it is added into centrifuge tube in the ratio of 100 μ L solution Bs D of 100mg gels correspondence molten
Liquid BD.60 DEG C of water-bath 10min dissolve completely to gel, oscillation mixing 3 times during water-bath.
Solution is transferred in DNA purification columns, 2min is stood, room temperature 12000rpm centrifuges 1min, abandons filtrate.
500 μ L solution PE are added on column, room temperature 12000rpm centrifuges 1min, abandons filtrate.It is primary to repeat last action.
Room temperature void column 12000rpm centrifuges 1min thoroughly to remove residual liquid in purification column.Pillar is placed in new
On 1.5mL EP pipes, the sterile water of 30 μ L, 60 DEG C of preheatings is added to column center, 13400g centrifuges 1min to elute DNA.With
Target gene after digestion is connect by T4DNA ligases with LV11 carriers (being purchased from Shanghai JiMa pharmacy Technology Co., Ltd).By 5 μ L
Connection product is added separately in 50 μ L DH5 α competent cells, and digestion identification positive colony is simultaneously sent to Huada gene company survey
Sequence.JAM-A3'UTR gene orders such as SEQ ID NO:Shown in 3.
3,LV11-JAM-A3'UTR is overexpressed the preparation of slow virus
The recombinant virus plasmid and its three kinds auxiliary packaging original paper vector plasmids for preparing coding lentiviral particle (are recombinated and are shuttled
Plasmid and packaging plasmid pGag/Pol, pRev, pVSV-G plasmid are purchased from Cell Biolabs companies), three plasmid vectors difference
High-purity endotoxin-free extracting is carried out, cotransfection 293T cells are carried out with transfection reagent Fugene HD, after cultivating 72h, is collected rich
Cell supernatant containing lentiviral particle obtains the slow virus concentrate of high titre, is measured in 293T cells after being concentrated to it
And demarcate virus titer.
Experimental procedure is as follows：
1) 293T cells are cultivated in 10cm culture dishes to 80-90% when merging, and are inoculated with 15cm culture dishes.
2) incline culture solution, and cell is washed twice with 1ml D-Hank ' s solution.
3) 1ml Trypsin-EDTA solution are added, after mixing, 37 DEG C are placed 2-3 minutes.
4) trypsin solution is carefully sucked, DMEM culture solutions of the 2ml containing 10%FBS is added, it is unicellular that piping and druming makes cell be formed
Suspension.
5) by cell suspension inoculation 15cm culture dishes, DMEM culture solutions of the 18ml containing 10%FBS is added, 37 DEG C after mixing
5%CO2 overnight incubations.
6) 1.5ml serum-free DMEM are added in a sterile 5ml centrifuge tube, are proportionally added into containing JAM-A3 ' UTR sequences
The shuttle plasmid and packaging plasmid (pGag/Pol, pRev, pVSV-G) of row, mixing take another sterile 5ml centrifuge tube, add
Enter 1.5ml serum-free DMEM, add 300ul Fugene HD, mixing is placed at room temperature for and after five minutes mixes two pipes, and room temperature is put
It sets 20~25 minutes.
7) culture solution in 15cm culture dishes is removed, the DMEM culture solutions of 8ml serum-frees are added.
8) transfection mixture is added dropwise in 15cm culture dishes, the culture dish that lightly rocks back and forth with mixing compound,
It is incubated 4-6 hours in 37 DEG C of 5%CO2 incubators.
9) it inhales and abandons transfection liquid, DMEM culture solutions of the 18ml containing 10%FBS is added.37 DEG C of 5%CO2 continue culture 72 hours.
10) cell supernatant in culture dish is drawn onto in 50ml centrifuge tubes, 4 DEG C, 4000rpm, 4min.
11) after low-speed centrifugal, centrifuge tube supernatant is poured into 50ml syringes, is filtered with 0.45um filters.
12) filtrate carries out ultracentrifugation in centrifuge, 4 DEG C, 20000rpm, 2h.
13) concentrate is collected in packing to memotron.
14) virus liquid dispensed is labelled, sequencing, and -80 DEG C of refrigerators preserve.
Embodiment 2：Slow virus is overexpressed plasmid LV11-JAM-A3'Skin at UTR alopecia areatas
1, the preparation of C3H/HeJ mouse alopecia areata model and virus injection
All zooperies are abided by NIH experimental animals and are required.
Experimental animal is 6 week old C3H/HeJ mouses, and male and female are unlimited, weigh about 30g, by The 2nd Army Medical College experimental animal
Center provides.
Imiquimod induction C3H/HeJ mouse is used to form alopecia areata model first.Method is as follows：It carefully takes out every time small
Mouse takes about 0.05 gram of imiquimod cream body with cleaning medical cotton writing paper meal with wine, is uniformly applied to napex skin, area is about
1.5x1.5cm, once every other day.Longest continuous use is no more than 10 weeks.Part is cleaned with physiological saline before administration every time, to go
Except previous left drug.It acts as possible softly, smears uniformly, avoiding rubbing repeatedly leads to skin tears or hair in operation
Mechanicalness falls off.It 5 weeks or so can be medicine-feeding part can Xing Cheng >1 × 1cm size alopecia areata areas prompt modeling success, such as Fig. 1 institutes
Show.
Stop administration, continues to observe.
The successful mouse of alopecia areata modeling is randomly divided into 2 groups, every group 6,1% Nembutal sodium solution, fiber crops are injected intraperitoneally
Carry out the injection of slow virus after liquor-saturated at alopecia areata with microsyringe.Daily observation 3 after transplanting, is drawn materials for 5,7,9,14 days.
2, hair regeneration situation is observed
1) hair regeneration is observed
After virus injection, to determine hair regeneration effect, digital camera is taken pictures skin at alopecia areata.
The results show that LV11-JAM-A3'UTR injection group hair regeneration situations are significantly higher than LV-NC injection groups, explanation
LV11-JAM-A3'UTR can remarkably promote and maintain hair regeneration at alopecia areata, as shown in Figure 2.
2) microstructure of skin at alopecia areata is observed in H-E dyeing
Virus is drawn materials for 7 days after transplanting, takes each group alopecia areata central diameter 1cm expanses of skin, it is small that 4% paraformaldehyde fixes 24
When, paraffin embedding, serial section, slice thickness is 5 μm.Skin biopsy row H-E at alopecia areata is dyed, microscopically observation hair
It is existing：LV11-JAM-A3'UTR injection group hair follicles increase, and hair follicle structure is complete, into growth period, grow downwards, such as Fig. 3 institutes
Show.
The basic principles, main features and advantages of the present invention have been shown and described above.The technology of the industry
Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the above embodiments and description only describe this
The principle of invention, various changes and improvements may be made to the invention without departing from the spirit and scope of the present invention, these changes
Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its
Equivalent defines.
Claims (4)
1. a kind of LV11-JAM-A 3'UTR carrier for expression of eukaryon is preparing the application in preventing or treating alopecia areata drug, is by structure
The LV11-JAM-A 3&apos built up;UTR carrier for expression of eukaryon, the mode of subcutaneous injection or the mode of transplanting are transfected into skin at alopecia areata
In skin tissue, the carrier for expression of eukaryon contains such as SEQ ID NO:Gene order shown in 3, and the carrier is
LV11。
2. LV11-JAM-A 3&apos according to claim 1;UTR carrier for expression of eukaryon is preparing prevention or treatment alopecia areata drug
In application, which is characterized in that the construction method of the carrier for expression of eukaryon is as follows：
Design and synthesize primer：
Sense primer such as SEQ ID NO:Shown in 1；
Downstream primer such as SEQ ID NO:Shown in 2；
Using human epidermal cell total DNA as template, PCR amplification target fragment such as SEQ ID NO:Shown in 3；Select LV11 for carrier,
Build LV11-JAM-A 3'UTR carrier for expression of eukaryon.
3. a kind of LV11-JAM-A 3'UTR carrier for expression of eukaryon is preparing the application promoted at alopecia areata in the product of hair regeneration,
It is the LV11-JAM-A 3&apos that will be built;UTR carrier for expression of eukaryon, the mode of subcutaneous injection or the mode of transplanting are transfected into spot
In bald place's skin histology, the carrier for expression of eukaryon contains such as SEQ ID NO:Gene order shown in 3, and the carrier
For LV11.
4. LV11-JAM-A 3&apos according to claim 3;UTR carrier for expression of eukaryon is preparing hair regeneration at promotion alopecia areata
Product in application, which is characterized in that the construction method of the carrier for expression of eukaryon is as follows：
Design and synthesize primer：
Sense primer such as SEQ ID NO:Shown in 1；
Downstream primer such as SEQ ID NO:Shown in 2；
Using human epidermal cell total DNA as template, PCR amplification target fragment such as SEQ ID NO:Shown in 3；Select LV11 for carrier,
Build LV11-JAM-A 3'UTR carrier for expression of eukaryon.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510423086.3A CN105012969B (en) | 2015-07-17 | 2015-07-17 | It is a kind of to protect and promote the drug of hair regeneration and its application at alopecia areata |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510423086.3A CN105012969B (en) | 2015-07-17 | 2015-07-17 | It is a kind of to protect and promote the drug of hair regeneration and its application at alopecia areata |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105012969A CN105012969A (en) | 2015-11-04 |
| CN105012969B true CN105012969B (en) | 2018-10-23 |
Family
ID=54403502
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510423086.3A Active CN105012969B (en) | 2015-07-17 | 2015-07-17 | It is a kind of to protect and promote the drug of hair regeneration and its application at alopecia areata |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105012969B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106497929A (en) * | 2016-09-30 | 2017-03-15 | 中国人民解放军第二军医大学 | A kind of method for promoting epidermis cell migration and its application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103031278A (en) * | 2012-12-11 | 2013-04-10 | 中国人民解放军第二军医大学 | Method of modifying mesenchymal stem cell by JAM1 gene and application thereof |
| CN104673831A (en) * | 2014-12-22 | 2015-06-03 | 中国人民解放军第二军医大学 | Method for maintaining and recovering primitiveness of human dermal papilla cell and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2013267422B2 (en) * | 2012-05-30 | 2018-07-26 | Cornell University | Generation of functional and durable endothelial cells from human amniotic fluid-derived cells |
-
2015
- 2015-07-17 CN CN201510423086.3A patent/CN105012969B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103031278A (en) * | 2012-12-11 | 2013-04-10 | 中国人民解放军第二军医大学 | Method of modifying mesenchymal stem cell by JAM1 gene and application thereof |
| CN104673831A (en) * | 2014-12-22 | 2015-06-03 | 中国人民解放军第二军医大学 | Method for maintaining and recovering primitiveness of human dermal papilla cell and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| JAM-A在肺癌中的表达及与临床病理特征的关系;陈瑜等;《现代肿瘤医学》;20140930;第22卷(第9期);第2068-2070页 * |
| miR-145-dependent targeting of Junctional Adhesion Molecule A and modulation of fascin expression are associated with reduced breast cancer cell motility and invasiveness;M Gotte1等;《Oncogene》;20100906;第29卷;第6569-6580页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105012969A (en) | 2015-11-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2553712T3 (en) | Adherent cells of the placenta and their use in the treatment of disease | |
| CN107949424A (en) | The gene editing based on CRISPR/ endonucleases of TAT inductions | |
| CN102268454A (en) | Prostate specific membrane antigen (PSMA) recombinant adeno-associated virus vector and its construction method and use | |
| CN101348786B (en) | Human beta-globin gene and recombinant adenovirus related virus vector thereof | |
| CN108588026A (en) | The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10 | |
| CN107916253A (en) | A kind of preparation method of mescenchymal stem cell for expressing people source immuno-stimulator LIGHT and obtained MSC L cells | |
| CN105012969B (en) | It is a kind of to protect and promote the drug of hair regeneration and its application at alopecia areata | |
| CN103215308A (en) | Integration plasmid and cell line expressing recombinant human FVIII, and construction method and application thereof | |
| BR112021002765A2 (en) | production methods for viral vectors | |
| CN107320726A (en) | Applications of the LncRNA TUG1 in the dryness for preparing regulation and control periodontal ligament stem cell maintains the medicine of ability | |
| CN108498794A (en) | A kind of inactivated vaccine and preparation method thereof of prevention novel duck reovirus | |
| CN109456948A (en) | MIF and TIPE2 double gene coexpression recombined adhenovirus and its preparation method and application | |
| CN104673831B (en) | A kind of method and its application of maintenance and recovery human hair papilla cell primitiveness | |
| CN104630221B (en) | Suppress shRNA and its recombinant vector and the application of growth of tumour cell | |
| CN101422608A (en) | Preparation method of PRRSV ORF5 gene nucleic acid vaccine containing CpG sequence | |
| CN106065401A (en) | Lentivirus mediated CXCR7 high expressed through engineering approaches endothelial progenitor cells treatment use in ischemic diseases | |
| CN101444629B (en) | Non-injection gene therapy medicine and medicine box thereof | |
| WO2020164167A1 (en) | Recombinant adeno-associated viral vector for use in preparation of general-purpose car-t, and construction method therefor and use thereof | |
| CN107418976A (en) | Telomerase catalytic subunit full genome is overexpressed adenovirus recombination vector and its application | |
| CN101219222B (en) | Application of PDCD4 recombined expression vector in preparing medicament for treating gonad cancer | |
| CN105420275A (en) | Method for preparing exogenous functional gene targeted integration human neural stem cells | |
| CN105085640B (en) | A kind of J subgroup avian leucosis virus immunosuppressive polypeptides based on PEG modifications | |
| CN104830905B (en) | Iba1 and the double gene coexpression recombinant adenoviral vectors of LAG 3 and its preparation method and application | |
| CN108795987A (en) | A kind of neural stem cell preparation method and application of FerritinH, Bcl2 and EGFP gene combined modification | |
| CN111840327B (en) | Mesenchymal stem cell preparation for treating diabetic foot and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |