CN104987420B - The full human monoclonal antibody of anti-CD20 and its application - Google Patents

Abstract

The invention belongs to the technical fields of antibody drug, full human monoclonal antibody and its application of anti-CD20 are provided, these antibody are derived from people's hybridoma and screen by cytotoxicity test screen and CD20 affinity, these antibody are excellent to the affinity and specificity of CD20, significant to the cytotoxic effects of lymphoma cell.It is invaded in the pharmacodynamics test of profit tumor model in treatment human B cell Lymphoma Raji Cells, the significant life cycle for extending experimental animal.In the inhibition test for the treatment of human B cell Lymphoma Raji Cells orthotopic transplantation tumor, the growth of Raji cell subcutaneous transplantation tumor is significantly inhibited.In life cycle and inhibit in tumour growth that display is not less than or curative effect more better than Mabthera.The diseases such as non Hodgkin lymphom, B cell lymphoma, rheumatic and atrophic diseases, systemic loupus erythematosus, immunologic thrombocytopenic purpura and multiple sclerosis are worth with potential diagnosing and treating.

Description

The full human monoclonal antibody of anti-CD20 and its application

The application is divisional application, original application application No. is 201210082298.6, the applying date is March 26 in 2012 Day, it is entitled " the full human monoclonal antibody of anti-CD20 and its application ".

Technical field

The present invention relates to the technical fields of antibody drug.Specifically, it is related to one group of full human monoclonal antibody recruit, Its diagnosing and treating that can be used for lymthoma.

Background technique

1.CD20

CD20 is a kind of non-glycosylated phosphoprotein that molecular weight is 33~37kDa, there is 4 transmembrane regions, aminoterminal and carboxyl End is all located on the inside of cytoplasma membrane, between third transmembrane region and the 4th transmembrane region, is made of by one 43 amino acid residues Ring region, constitute its main epitope.As bone-marrow-derived lymphocyte surface differentiation antigen, it originates and is expressed in pre-B cell rank Section terminates when to B cell terminal differentiation plasmablast, has always been considered as being the distinctive mark of B system cell surface.It is primarily involved in The proliferation and differentiation for adjusting bone-marrow-derived lymphocyte, play an important role in immune system.80%~85% non Hodgkin lymphom It (NHL) is B cell source, and about the 95% of these cells has surface C D20 expression^[1,2].The expression of CD20 is thin because of lymthoma The difference of born of the same parents and difference, follicular lymphoma cell surface express higher, smallcelllymphoma leukemia cell surface table It up to lower, is not expressed in stem cell and thick liquid cell, the expression in chronic B _ Lymphoid Leukemic Cells is far below normal B cell With other B lymphoma cells, the expression height of CD20 determines the journey of antibody and complement killing oncocyte to a certain extent Degree^[3].Monocyte, tranquillization and the T cell of activation, protoblast and non-lymphocyte do not express CD20 molecule.CD20 with Internalization phenomenon is unobvious after anti-CD 20 antibodies combine, and cell surface CD20 molecular amounts in conjunction with antibody because do not subtract largely Few, CD20 will not there is a phenomenon where obvious cell surfaces to fall off, and therefore, CD20 is the ideal of immunization therapy B cell lymphoma Action site especially has curative effect relatively certainly to treatment inertia, recurrent and refractory B cell lymphoma.

2. therapeutic anti-CD 20 antibodies

Anti- CD20 treatment can remove malignant B cell and part normal B cells, but due to stem cell and B cell precursor not table Up to CD20, because B cell long-term without caused by is lost.Its clinical application the principal indications are as follows: 1. apply merely anti-CD20 Dan Ke Grand Antybody therapy follicular B cell type non-Hodgkin lymphoma；2. anti-CD-20 monoclonal antibody and chemotherapy combined application for the treatment of are more Unrestrained large B cell type lymthoma and chronic bone-marrow-derived lymphocyte leukaemia (B-CLL).

2.1 Rituximab (Mabthera)

IDEC-C2B8 also known as Rituximab, trade name Mabthera are ratified to list, are first quilts for 1997 by FDA U.S. FDA ratifies the monoclonal antibody for treating tumour^[4].It is a human mouse chimeric antibody, includes the anti-CD20 Dan Ke of source of mouse The variable region of grand antibody 2B8 (Ibritumomab) and the constant region of 1 heavy chain of humanized IgG and κ chain, for controlling for B cell lymphoma It treats.Rituximab passes through in vivo inhibits cell Proliferation or triggering various kinds of cell failure mechanism, including antibody-dependent cytotoxicity It acts on (ADCC) and complement dependent cytotoxicity effect (CDC) and Apoptosis plays apparent antitumor efficacy^[5].In recent years Clinical research confirmation, the medicine treatment spectrum it is wider, preferable curative effect can be obtained to bone-marrow-derived lymphocyte disease.

2.2 ZEVALIN

2 months 2002, FDA had approved first radioimmunotherapy treatment drug Zevalin.The medicine is by IDEC drugmaker Production, common name Ibritumomab Tiuxetan.FDA ratifies this medicine for treating recurrent or intractable low grade of malignancy/filter Bubble property or the B cell NHL of conversion, including the intractable follicularis NHL of Rituximab.The product is mono- by mouse IgG 1- κ Clonal antibody 2B8 (Ibritumomab) connection isotope⁹⁰Y is used for oncotherapy.Its monoclonal antibody part has CD20 high special Compatibility^[6]。

2.3 BEXXAR

On June 27th, 2003, FDA ratify Bexxar (Tositumomab and¹³¹I Tositumomab) it is thin for treating cancer Transfer does not occur or, has the positive follicularis NHL of the CD20 recurred again after drug resistance, chemotherapy to Rituximab by born of the same parents.It is by mouse The anti-Bl monoclonal antibody of resource monoclonal antibody-(Tositumomab, IgG2a- λ) and radioactive isotope¹³¹I covalent coupling and At.

2.4 ARZERA

On October 26th, 2009, FDA approval ARZERA (Ofatumumab) is for treating chronic lymphocytic leukemia (CLL).It is by the immune human monoclonal antibodies generated by hybridoma technology of KM source of people trangenic mice.It is similar with Rituximab It passes through in vivo inhibits cell Proliferation or triggering various kinds of cell failure mechanism, including antibody-dependent cytotoxicity effect (ADCC) Apparent antitumor efficacy is played with complement dependent cytotoxicity effect (CDC) and Apoptosis.But it is in treatment Fei Huoqi The phase iii clinical trial of golden lymphomas (NHL) fails.It is mainly used for the chronic lymphatic being resistant to front-line chemotherapeutic agents at present Cell leukemia.

3.Rituximab is in clinical application

3.1 are used alone treatment non Hodgkin lymphom (NHL)

Rituximab can be used alone, and the dosage of recommendation is weekly 375 milli gram/m, intravenous injection, and totally 4 It is secondary, treatment recurrence or drug resistance low potential malignancy CD20 positive B-cells NHL；II clinical trial phase shows that overall efficiency is 48%, wherein 6% is fully effective, 42% for part effectively, the paracmasis is usually 1 year.For the low potential malignancy NHL just controlled, Single medicine effective percentage is 50%~70% or so, and maintenance therapy can further increase curative effect.Side effect is milder, can be defeated with antibody Enter the reduction of amount and mitigate, does not have in treatment or rare Infective morbidity.Thus Rituximab is as first-line drug application Treatment NHL has had irreplaceable effect.

2004, European Union permitted Rituximab combination with standard chemotherapy to treat aggressive NHL.Some clinical tests are used to Assessment Rituximab treats inertia, invasion NHL and some other B cell Lymphoproliferative disorders alone or in combination. Rituximab is to rheumatoid arthritis, immunologic thrombocytopenic purpura, immune hemolytic anemia, systemic erythema The effect of the autoimmune disorders disease such as lupus and multiple sclerosis is also under study for action^[7]。

3.2 combination chemotherapy B cell lymphomas

Xu Zhi is skilful etc.^[8]Using the perspective study method of concurrent control, 22 B cell NHL patients are divided into study group (Rituximab group) and control group, study group 11 CHOP scheme (cyclophosphamide, Doxorubicin, vincristine and Po Ni Pine) joint Rituximab treatment；Control group 11 are applied alone CHOP scheme.As a result Rituximab group complete remission rate (CR) reaches 72.7% (8/11), total effective rate 90.9% (10/11)；Control group CR is 36.4% (4/11), and total effective rate is 54.6% (6/ 11), two groups of Different therapeutical effects are statistically significant.Preliminary Results prompt, Rituximab combine CHOP Regimen Chemotherapy CD20 sun The B cell NHL's of property is significant in efficacy, and adverse reaction is similar to chemotherapy, can be used as the current preferred option of the disease.

3.3 application in rheumatic disease treatment

Rheumatoid arthritis (rheumatoid arthritis, RA) be it is a kind of with synovitis be main pathological change it is complete Body autoimmunity disease, characterized by chronic destructive arthropathy.B cell is rheumatoid factor (RF), anti-citrulling antibody The main source cell of autoantibodies such as (anti-CCP), while research shows that T cell activation depends on B cell in RA synovial membrane Antigen presentation effect^[9], it is one of autoimmunity diseases pathogenesis core link such as RA.

Edwards etc.^[10]The double-blind, randomized controlled clinical study research of 161 large samples is reported, test is divided into oral methotrexate Group (>=10mg/ weeks), Rituximab group (1g dl, d15), Rituximab combination cyclophosphamide group (750mg d3, d17), Rituximab is combined methotrexate (MTX) group, the results show that Rituximab treatment group reaches ACR2065%~76% after 24 weeks, it is single It is 38% with methotrexate for treatment group, the two, which compares, significant difference (P < 0.025)；Continuous observation 48 weeks, Rituximab was controlled Treatment group curative effect (ACR2033%~65%) still have compared with methotrexate group (ACR2020%) is applied alone significant difference (P≤ 0.01).In the 24th week patient alleviated up to ACR50 for the treatment of, Rituximab group (33%), combination methotrexate (MTX) group is applied alone (43%), combination cyclophosphamide group (41%) is above methotrexate (MTX) group (13%).In addition, Rituximab treatment group patient The horizontal decline rapidly of RF.And reduced levels are maintained in 24 weeks.And the only transient slight decline of methopterin group RF level is applied alone.It should Test Rituximab curative effect and B cell removing situation related, it was demonstrated that therapeutic effect and B cell of the Rituximab in RA Important function in RA morbidity.Also indicate that Rituximab is controlled for a series of researchs of the Rituximab to the therapeutic effect of RA It treats RA curative effect to stablize, is the new way of biological therapy.

The therapeutic effect of 3.4 pairs of systemic loupus erythematosus

Systemic loupus erythematosus (systemic lupus erythematosus, SLE) be multisystem involvement, with it is a variety of from The autoimmune disease of body antibody expression.B cell has played key effect in SLE pathogenesis: secretion is a large amount of to cause a disease The property cytokine profiles such as autoantibody and IL-10 (IL-10), interleukin 6 (IL-6), tumor necrosis factor (TNF- γ)； Highly selective antigen presentation effect, by antigen presentation to T cell, while stimulating regulatory T-cell, activated dendritic cell^[11]。

Looney etc.^[12]The I/II phase for reporting 17 Rituximab treatment SLE expands clinical test, is activity Lupus.Most of patient receives immunosuppressant treatment simultaneously.It is divided into three groups of basic, normal, high various doses of receiving Rituximab, respectively 100mg/m²、275mg/m²、375mg/m²1 times a week, totally 4 weeks.The result shows that disease control is thin with B It is related that born of the same parents remove situation.11 B cells remove the clinical symptoms such as (CD19 positive cell < 5/ul) patient's fash, fever, arthralgia It can be relieved.Systemic Lupus Activity scoring (SLAM) was mostly alleviated at medication 2~3 months, continued 12 months.

Concept clinical research has shown that Rituximab treatment SLE is feasible, efficacy and saferry expectation large sample clinic Research.

3.5 Rituximab treat children's immunologic thrombocytopenic purpura

Immunologic thrombocytopenic purpura (immunologic thrombocytopenic purpura, ITP) is one Kind autoimmune hemolytic disease.Research has shown that at present, and ITP patient's T lymphocyte adjusts disorder, leads to bone-marrow-derived lymphocyte function Energy disorder, generates the IgG antibody for being directed to itself blood platelet, and then increase platelet destruction.Document report Rituximab can be fast Speed enduringly removes the bone-marrow-derived lymphocyte in circulation, the generation of autoantibody is reduced, to reduce the destruction of blood platelet.Taube Deng^[13]22 chronic ITP infants are treated using Rituximab, 1~2 week peripheral blood CD20 after Rituximab use is positive Bone-marrow-derived lymphocyte is gradually recovered normal in being decreased obviously after 2~3 months.As a result 7 complete incidence graphs, 6 parts are alleviated, and 5 multiple Hair, reactivity are 59% (13/22), and recurrence rate is 38% (5/13), and the time of lasting remission is 2~16 months.Shi Shuwen Deng^[14]3 children's chronics/intractable ITP is treated with Rituximab, 3 are drug combination, 1 joint A Saisong treatment Part is alleviated, and the level that infant blood platelet persistently remains relatively high after treatment needs IVIG to rush for 18 months, and no longer Hit treatment, A Saisong is gradually reduced to deactivating, remaining two combined large dosage of IVIG, succinic acid hydrogenation cortisone and Changchun respectively New alkali, blood platelet has of short duration rise (being 21 days and 11 days respectively) after treatment, but is down to again with the low-level before being admitted to hospital quickly And persistently lose rise, it is believed that of short duration blood platelet rise may be that large dosage of IVIG, succinic acid hydrogenation cortisone or Changchun are new The effect of alkali, not alleviate case.The above results show that Rituximab has preferable therapeutic effect to ITP, can be quick and durable The bone-marrow-derived lymphocyte in circulation is removed on ground, is reduced the generation of autoantibody, to reduce the destruction of blood platelet, be can be used as clinical use Medicine.But some cases it is this removing be it is temporary, deactivate Rituximab after circulation in bone-marrow-derived lymphocyte can restore again, this possibility It is recurred again with some patients related.About Rituximab treat chronic/intractable ITP overall reaction rate adult be 23~ 75%^[15], children 66%, essentially identical.

4. the preparation of human antibody

Mid-term hybridoma technology the 1970s comes out, and the monoclonal antibody (MAb) thus prepared is to resist single resist The antibody of former determinant, specificity and homogeneity with height, and can largely prepare, this becomes the primary of antibody research field Great revolution.1986, listing, quilt were approved by the FDA in the United States using first monoclonal antibody drug OKT3 prepared by this technology For the immunological rejection after treating organs transplanting.But since antibody is source of mouse, cause serious immune response in patient, This just hinders the development and utilization of antibody drug significantly.

As antibody is used to exploitation into drug, its some features also will be considered strictly, as immunogenicity, affine Power, stability, effector function, half-life period, tissue permeability and its distribution etc.^[21].When source of mouse MAb production becomes maturation, grind The person of studying carefully, which just envisions, produces source of people MAb by conventional hybridoma technology, but due to people's hybridoma cell line cannot be stable production The antibody of high yield, and for many antigens, the vivo immunization of people is infeasible.In this way, genetic engineering antibody by However it is raw, 1994, first chimeric antibody ReoPro was approved to list, and it is anti-that clinical application shows that its immunogenicity is much better than source of mouse Body, this has just started the revolution again of the antibody engineering research field after authentic monoclonal antibody.The especially nineties Since mid-term, for the generation for further decreasing immune response, a variety of humanization modified technologies are successfully developed and are applied, respectively The genetic engineering antibody and antibody library of kind various kinds continuously emerge^[23][24], so that be mass produced medical humanized antibody become can Energy.Since 1997, large quantities of monoclonal antibody medicines was ratified to list by FDA.

The bottleneck of antibody drug industrialization has been broken in the application of the humanization modified technology of monoclonal antibody.So far, according to humanization journey The height of degree can substantially be divided into three kinds of technologies: chimeric, humanization and full source of people, and source of people sequence accounting is respectively in gene 75%, 95% and 100%^[22].Wherein chimeric antibody is by the constant of the variable region of murine hybridoma monoclonal antibody gene and people Area links together, and then carries out expression generation in mammalian cells；And humanized antibody is then in addition to by the perseverance of antibody Determine area to change into except source of people, the area FR of variable region is further converted into source of people^[20], to reduce immunogenicity； And human antibody preparation is then to construct the library Fab ScFv in a kind of patient's blood sample from acquisition there are four types of approach, and lead to Phage display screening antibodies library is crossed, to generate source of people MAb^[18].2002, first full source of people MAb, Humira, be exactly logical Cross what phage display developed.The strategy of second of production human antibody is with containing human immunoglobulin gene site Transgenic mice is immunized, and can produce the immune response of human antibody, in this way can be with next life by traditional hybridoma technology Produce source of people MAb^[17], the source of people MAb being derived from transgenic mice is just in clinical test.The third approach is to pass through separation Human peripheral lymphocyte or lymphocytes in tonsil are cultivated, then carries out immunostimulation with antigen, generates immune response, then It is merged again with human myeloma cell and generates hybridoma, obtain human monoclonal antibody through screening, and carry out molecule immediately Cloning Human Immunoglobulin Genes, purpose antibody is expressed using the mammalian cell that other can be expressed steadily in the long term, and this antibody is complete It is to be generated in people's cell environment.4th classpath is cultivated outside people by separation and low-density (every 96 hole of about 500B cell) All blood lymphocytes or lymphocytes in tonsil carry out antigentic specificity screening to culture supernatant, divide positive hole B cell Son clone obtains human immunoglobulin gene, reuses the mammalian cell that other can be expressed steadily in the long term to express purpose antibody.

Full human monoclonal antibody of the invention is namely based on the third above-mentioned approach and is subject to random mutation screening and gets 's.Using the monoclonal antibody that people-people's hybridoma generates be considered as will be better than on amino acid sequence and glycosylation spectrum it is embedding Close the human antibody of antibody and humanized antibody.But-stable fusion the companion passed on of people's hybridoma is made one due to being difficult to find that Companion's cell, and due to the problems such as fusion efficiencies are low, cell culture is difficult and production capacity is low, it prepares and stablizes passage and can continue to produce People-people's hybridoma cell line of raw monoclonal antibody always exists larger difficulty, and successfully example is very few.The present invention is to expression The people of human antibody-people's hybridoma quickly carries out the screening including specificity and function assessment, and the hybridoma filtered out is thin Born of the same parents carry out molecular cloning to save antibody gene, to overcome above-mentioned difficulties.

With the maturation of humanization and human antibody technology, the affinity of antibody how is improved into current all genes Engineered antibody drug needs the critical issue solved.This is because the affinity for increasing an antibody will reduce the agent of antibody drug It measures and plays better bioactivity, it is also possible to so that it is treated more diseases and reduce dose-dependent toxicity^[18][22].This Outside, expense will also substantially reduce.It is multinomial independent studies have shown that affinity of antibody and biological activity are before reaching the limit values It is linear.Research is expanded from different directions around this problem people, improves the way of affinity of antibody Diameter has two approach substantially, and one of approach is then largely dashed forward from this by random mutation CDR or entire VR The antibody of more high-affinity is screened in variant library^[19]；Another approach is affine in mutation or modeling Simulation body by concentrating A small mutant library is established in the hot spot region of power maturation^[18][19].Integrate, when carry out external affinity of antibody at When ripe, it is considered as 4 main aspects: 1. leading people's mutation in the where of antibody gene；2. how to import mutation；3. how from lower Rare more high-affinity antibody is selected in the antibody of affinity.4. how to identify more high-affinity antibody.

Three kinds of antibody for CD20 of approved listing at present is the initiative of Biogen-Idec company.Wherein Zevalin It is source of mouse monoclonal antibody with Bexxar, and it is thin is mainly played by antibody-mediated radioactive isotope to tumor section for radioactivity Born of the same parents' poison direct killing tumour cell.The factors such as the generation due to radiotoxicity and human anti-mouse antibody cause clinical efficacy bad, fit Answer disease narrow.Rituxan (i.e. Rituximab) is people's mouse mosaic type anti-CD-20 monoclonal antibody, can by CDC, ADCC, lure It leads CD20 apoptosis or inhibits the proliferation of malignant B cell directly to play its therapeutic effect and all obtain good treatment Effect.But due to its 25% source of mouse part, it is easier to generate mouse immunogenicity, i.e. human anti-mouse antibody is reacted.This will draw More infusion reaction is played, while also can not long-term administration.Because the human anti-mouse antibody recycled in patients serum will in and Rituxan and make its curative effect decline even fail.Furthermore Rituxan itself kill tumor curative effect there is also improve space, such as Its current clinical effective rate (CR+PR) is about 50%, is unable to continuous use, and the paracmasis is one year, it is therefore necessary to send out Bright new antibody molecule promotes the curative effect of such drug^[29].The present invention is exactly directed to Rituximab shortcoming and carries out Recruit's initiative: (1) becoming mouse people's chimeric antibody is human antibody (2) by the promotion of novel drugs, keeps it thin for other tumors The CDC of born of the same parents, ADCC and apoptosis capacity, which enhance, kills tumor curative effect to improve.

Summary of the invention

The present invention provides one group of new antibodies of anti-CD20, these antibody are human antibody, and as a kind of novel drugs, The cytotoxic effects of the multinomial CD20 specificity of these antibody are stronger than U.S.'s similar drugs Mabthera, have it is more identical than Mabthera or Better drug effect.Can be used for treating and diagnosing non Hodgkin lymphom, B cell lymphoma, rheumatic and atrophic diseases, The diseases such as systemic loupus erythematosus, immunologic thrombocytopenic purpura and/or multiple sclerosis.

The heavy chain constant region of antibody of the invention be human IgG1's heavy chain constant region, constant region of light chain behaviour κ chain it is constant Area, the amino acid sequence of heavy chain variable region are Seq ID NO:1, in Seq ID NO:2, Seq ID NO:3 and Seq ID NO:4 One, the amino acid sequence of light chain variable region is Seq ID NO:5, Seq ID NO:6, Seq ID NO:7 and Seq ID One in NO:8.

The amino acid sequence of wherein preferably 10 kinds of antibody, heavy chain variable region and light chain variable region is respectively as follows:

Those skilled in the art will know, the conservative amino acid replacement in above-mentioned antibody can't substantially shadow The affinity and structure of antibody are rung, the especially described conservative replacement occurs in constant region.Those skilled in the art also know, It can be designed that the nucleotide sequence for encoding it according to the amino acid sequence of above-mentioned antibody, and be directed to different expressive hosts pair The nucleotide sequence optimizes.In order to treat, detect, test or other purposes, antibody of the invention can with isotope, exempt from Epidemic disease toxin and/or chemicals are covalently attached, and can also be coupled with solid dielectric, semi-solid medium, can also be used the present invention Antibody functional fragment, this is well known in the art.

The present invention provides a kind of method, this method manufacture human antibody is used and as a kind of novel drugs.At present There has been no the reports that antibody drug system uses technical method of the invention successfully to formulate.The most important technology that this method is overcome Difficult point is (1) human lymphocyte effective immunological technique in vitro；(2) people's hybridoma mrna instability is fixed, it is necessary to quickly carry out including special Screening including anisotropic and function assessment, and the hybridoma filtered out is subjected to molecular cloning to save antibody gene；(3) It is further excellent by the progress of molecular biology antibody engineering technology to the human antibody with certain pharmacological effect has been filtered out Change transformation.

The manufacture of the antibody and related detecting method are as follows: by extracting the peripheral blood lymphocytes of different people either Human tonsil lymphocytes after external mixing, are co-cultured with the molecule with adjuvant function with antigen, generate it for antigen Antibody generate people's hybridoma of interim stabilization, the source of people containing its secretion in culture supernatant by merging with myeloma cell Antibody.CD20 positive hybridoma cell is filtered out by cell ELISA (CD20 positive cell and the double screenings of CD20 negative cells) Hole is grown, then with opposite antigen affinity, cytotoxicity test (ADCC, CDC and apoptosis experiment) comprehensive assessment screening is best 10 cells grow hole, and be subcloned immediately, filter out the monoclonal cell strain for keeping antigentic specificity.It carries out immediately Sequencing and molecular cloning antibody gene are purified into expression vector appropriate, and by plasmid DNA amplification in -80 DEG C of persistences. According to opposite antigen affinity, 3 best lists are screened in cytotoxicity test (ADCC, CDC and apoptosis experiment) comprehensive assessment The antibody gene of clonal cell line carries out external affinity matured antibody engineering to it in this, as template.We with to CDR1, The area CDR2, CDR3 carries out the mode that random mutation and rite-directed mutagenesis combine and establishes affinity matured antibody mutated library.With anti- Library is screened in former specificity and relative affinity sequence.By the heavy chain variable region (V of 5~10 best antibody of every wheel_H) With light chain variable region (V_L) carry out fully intermeshing combine to form full length antibody.Use wink turn, culture and micro affinity purification (Protein A) prepares a small amount of antibody purification, carries out screening and identification with cytotoxicity test (ADCC, CDC and apoptosis experiment). There is the antibody molecule of good cytotoxic effects in one group screened through this, then to these antibody variable regions especially CDR region Sequence retrieval, the antibody for determining that this group has the cytotoxic effects of CD20 specificity is the recruit found for the first time.It is organized at this new There are the cytotoxic effects of one or more new antibodies molecule its (1) multinomial CD20 specificity stronger than Mabthera in molecule； (2) subcutaneous transplantation tumor and the test result of life cycle show that it has medicine more identical and better than U.S.'s similar drugs Mabthera Effect.

After the amino acid sequence for determining antibody of the invention, the artificial synthesized polynucleotides for encoding the antibody can be passed through And choose suitable host and effectively express to prepare the antibody, this is well known in the present art.

Unless stated otherwise, " Rituxan ", " Rituximab " and " Mabthera " may be used interchangeably herein.

Detailed description of the invention

FIG. 1 to FIG. 3 is Raji cell CDC test result；Wherein Fig. 1 is the CDC function to different people doma supernatant Learn screening；Fig. 2 is to purify human antibody H2L3, H2L6, H2L10, H8L3 and H8L10 to expressing cho cell after affinity maturation The screening of CDC function assessment；Fig. 3 be to after affinity maturation expressing cho cell purifying human antibody H8L15, H11L6, H11L10, The CDC function assessment of H19L3 and H19L15 screens；

Fig. 4~Fig. 6 is Raji cell ADCC test result；Wherein Fig. 4 is the ADCC to different people's doma supernatants Function assessment screening；Fig. 5 be to after affinity maturation expressing cho cell purifying human antibody H2L3, H2L6, H2L10, H8L3 and The ADCC function assessment of H8L10 screens；Fig. 6 be to after affinity maturation expressing cho cell purifying human antibody H8L15, H11L6, The ADCC function assessment of H11L10, H19L3 and H19L15 screen；

Fig. 7 is originated from the mutated obtained H1~H20 of heavy chain of cell strain 1.105.3 according to the sequence of affinity；The source Fig. 8 From the mutated obtained L1~L20 of the light chain of cell strain 1.105.3 according to the sequence of affinity；Corresponding result data and K_DValue Referring to table 6；

The sequence according to affinity of heavy chain mutant gene and the light chain mutant assortment of genes of Fig. 9 through screening；Corresponding knot Fruit data and K_DValue is referring to table 7；

Figure 10 shows the pharmacodynamics of the mouse Raji cell invasion tumor model of antibody H2L10 treatment human B cell lymthoma Test result is the observation to mouse weight and health status.Intravenous injection 10⁷Raji lymphoma cell forms mouse lymph lymphoma Disease model.Points five groups are respectively 1. physiological saline groups, 2. Mabthera groups, 3.H2L10 (representative antibodies i.e. of the invention) low Dosage group, 4.H2L10 middle dose group and 5.H2L10 high dose group.Start to be administered within 7 days after cancer cell intravenous injection.Intraperitoneal injection Once a week.It is groups of animals changes of weight in figure.Physiological saline group animal since after the 16th day be decreased obviously and in tumour Dyscrasia.Mabthera group started weight occur at the 37th day to be decreased obviously, it is overall in sub-health state until the knot of test in the 50th day Beam.And the high, normal, basic three groups of animals of H2L10 are in health status, Normal-weight increases.This result clearly shows H2L10 and Mabthera There is the curative effect of affirmative to lymphoma animal, H2L10 each group includes that low dose group curative effect is superior to Mabthera.

Figure 11 shows the life cycle of the mouse Raji cell invasion tumor model of antibody H2L10 treatment human B cell lymthoma Test result.Intravenous injection 10⁷Raji lymphoma cell forms mouse and invades profit type lymphoma disease model.Dividing five groups is respectively 1. Physiological saline group, 2. Mabthera groups, 3.H2L10 low dose group, 4.H2L10 middle dose group and 5.H2L10 high dose group.Cancer cell Start to be administered within 7 days after intravenous injection.Intraperitoneal injection is once a week.The bright appearance since the 23rd day of physiological saline group animal is dead, It is all dead by the 34th day.Mabthera group and the high, normal, basic three groups of animals of H2L10 are without dead until off-test in the 50th day.But beauty Luo Hua group started weight occur at the 37th day to be decreased obviously, and totally in Subhealthy Status until off-test in 50 days.This result Clearly show that H2L10 and Mabthera affirmably extend the life span of lymphoma animal.

Figure 12 shows that antibody H2L10 treats human B cell Lymphoma Mice raji cell in-situ transplantable tumor inhibiting tumor assay knot Fruit.Tumour growth situation is observed after mouse inoculation, is 40-100mm to gross tumor volume³When left and right, sieved by knurl product size Choosing, the excessive and non-tumor formation person of knurl product are not selected.Be randomly divided into after screening 3 groups: 1. physiological saline groups, 2. Mabthera groups, 3.H2L10.Dosage 5mg/kg, intraperitoneal injection is once a week.Test result clearly shows that Mabthera and H2L10 can be bright The aobvious growth for inhibiting Raji cell subcutaneous transplantation tumor, H2L10 drug effect and Mabthera have same drug effect.

Specific embodiment

Hereafter the present invention will be illustrated by specific embodiment, it will be appreciated that, following embodiment is not intended to limit this The range of invention.

Embodiment

Embodiment 1: the preparation of hybridoma and carrier

1.The preparation of antigen and lymphocyte and immune

1.1 antigens prepare:

1.1.1 CD20 albumen

Purchaser CD20 (Novusbio) antigen after being diluted with PBS, is filtered with 0.22 μm of pin type sterile filters.

1.1.2 the preparation of the 293F cell of CD20 memebrane protein is expressed

The cDNA (Origene, SC101205) of CD20 is bought, and designs, synthesize PCR amplification primer:

CD20 forward primer: 5 '-TCAGGAGTTTTGAGAGCAAAATG-3 '

CD20 reverse primer: 5 '-AACAGAAGAAATCACTTAAGGAG-3 '

Then expanded, purified as template using the cDNA of CD20, and be cloned into pCR3.1 carrier (Invitrogen, K300001 in), after sequence verification, the plasmid is largely prepared, then transfects FreeStyle to specifications^TM293-F cell After 48 hours, G418 (Invitrogen, the 10131035) culture of 1mg/ml 2 weeks is added, surely in (Invitrogen, R790-07) Fixed G418 resistance clone is screened out, and freezes.

1.1.3 the CD20 memebrane protein extracted

Using epicyte protein and suppressor proteins extraction agent box (being purchased from green skies biological study institute) by CD20-293F Cell follows kit specification to extract CD20 memebrane protein.With being sub-packed in 1.5 milliliters of cell cryopreservations after 0.22 zut filter - 80 DEG C of preservations of pipe.

1.2 human lymphocyte prepares:

Sterile chronic tonsillitis flesh tissue sample of winning is (with the attached institute's ear-nose-throat department cooperation of Xuzhou Medical College, tonsillotome It is derived from the patient of Tonsillectomy operation, 10 patients, 5~10 years old age), it is isolated wherein with lymphocyte separation medium (GE) Lymphocyte, take 30 × 10⁶It is a；Aseptic aspiration people's fresh peripheral haemocyte isolates it with lymphocyte separation medium (GE) In lymphocyte, take 30 × 10⁶It is a.

1.3 lymphocytes in vitro are immune:

Lymphocytes culture medium formula are as follows: 200 mMs of left sides in 1 liter of DMEM containing 20% fetal calf serum (FBS), 1% Revolve glutamic acid (Sigma, cat.#G 2150), 1% 100 × nonessential amino acid (Sigma, cat.#M7145), 1% 100 × penicillin streptomycin mixed liquor (Sigma, cat.#P 7539), (10,000U/ml penicillin+10mg/ml Streptomycin), 10 units/every milliliter of interleukin 6 (Boehringer Mannheim, cat.#1299972), 20 units/ Every milliliter of people's recombinant interleukin2 (R&D system, cat.#202-IL-050), 20 micrograms/every milliliter of dyers' grapes mitosis The endotoxin-free CpG (customization synthesis) of former (PWM) (Sigma, cat.#L8777), 1 nanograms/milliliter and 1 OPI cell culture add Add agent (Sigma, cat.#O 5003).

In the RPMI-1640 culture medium containing 20%FBS after 16 of two kinds of sources in 1.2 individual lymphocytes are mixed In be mixed, lymphocyte final concentration of 5 × 10⁵A/ml, while the mouse abdomen obtained in following step 2.1 is added Chamber feeder cells (final concentration of 1 × 10⁵A/ml), nonessential amino acid (final concentration of 1ug/ml), CD20 antigen (exempt from by albumen Epidemic disease: cell membrane immune group: final concentration of 1ug/ml is derived from 10⁶Epicyte protein/ml of a CD20-293 cell), and it is put in two It is co-cultured in carbonoxide incubator 6-12 days (changes a fresh medium for 5-6 days).

2. the preparation of hybridoma

The preparation of 2.1 feeder cells:

On the day before fusion, the neck that breaks is put to death BALB/c mouse and (is purchased from Beijing Vital River Experimental Animals Technology Co., Ltd. Buy), it is soaked in 75% alcohol 5 minutes, in super-clean bench, scissors abdominal cut skin is used under sterile working, exposes peritonaeum, is used The intraperitoneal 10ml HAT culture medium of syringe injection (20%FBS, HAT 1 ×, remaining is DMEM), pressure-vaccum, is sucked out culture repeatedly Base is put into 50ml centrifuge tube, trypan blue cell count, and adjustment cell concentration is 2 × 10⁵96 orifice plates, 100ul/ is added in a/ml Hole is put into carbon dioxide incubator overnight.This operation be suitable for the experiment in need for using mouse peritoneal feeder cells.

2.2 myeloma cells prepare: myeloma cell P3X63Ag8.653 is purchased from Chinese Academy of Sciences Shanghai life science institute Cell resource center is cultivated to logarithmic growth phase, is centrifuged 5 minutes under 1000rpm, is suspended with the DMEM without FBS, It is centrifuged 5 minutes under 1000rpm, flicks bottom, suspended with the DMEM culture medium without FBS, trypan blue counts, and cell activity is 95%.

2.3 cell electro' asions and HAT screening:

The lymphocyte after co-culturing 6 days with CD20 antigen is collected, trypan blue living cell counting is centrifuged 5 points under 1300rpm Clock abandons supernatant, flicks bottom, is suspended with a small amount of DMEM culture medium without FBS；It is sufficiently mixed with same amount of myeloma cell It is even, DMEM culture medium is mended to 40ml, be centrifuged 5 minutes under 2000rpm, abandoning supernatant；

It is added the sterile pronase solution of 2ml (CalBiochem, 53702), after slight suspension cell group, acts on 2 minutes, 3-5ml FBS is added to terminate, adds electro' asion solution and is centrifuged 5 minutes to 40ml, 2000rpm, abandon supernatant；A small amount of electricity is added to melt Conjunction solution gently after suspension cell group, is added to 40ml, 2000rpm and is centrifuged 5 minutes, abandon supernatant；Bottom is flicked, electro' asion is added Solution, cell count adjust cell to 2 × 10⁶A/ml is divided into 2ml/ pipe；It is set, is started according to the number of seconds of 2ml volume Electro' asion device (BTX)；After fusion, 1000rpm is centrifuged 5 minutes, abandons supernatant；After a small amount of HAT culture medium suspension cell is added, add The HAT culture medium for entering appropriate volume, lymphocyte additional amount when according to fusion, 1 × 10⁶A/plate completes feeding before being added In 96 orifice plates for supporting cell, it is put into carbon dioxide incubator and is cultivated.

7 days after fusion, 1/2 is carried out to HAT culture medium and changes liquid, 10 days after fusion, HAT culture medium changes liquid entirely.

2.4 cell conditioned medium antigentic specificity ELISA detection:

Coating: 12 days after fusion, with double set ELISA method detection specific antibodies, a set of 293 cell membranes for expression CD20 Coating, it is a set of to be coated with for 293 cell membrane of untransfected；4 DEG C of overnight wrapper sheets, concentration are 500,000 cell membranes/hole 50ul/, coating buffer For the 1%BSA PBS of PH 8.3.Closing: with 10% skim milk powder PBS closing after using PBST board-washing 3 times, incubation at room temperature 1 is small When；Then it uses PBST board-washing 3 times.Sample-adding: being sucked out 50ul cell conditioned medium into hole, and negative control is 1:1000 human serum (health Adult contributes), positive control is 0.1ug/ml Mabthera injection；After incubation at room temperature 2 hours, with PBST board-washing 3 times.Secondary antibody: Then time goat anti-human igg 1 (Caltag) of peppery acid group peroxidase label is added, the hole 50ul/ is used after incubation at room temperature 1 hour PBST board-washing 3 times.Colour developing: TMB colour developing, 50ul/ml TMB, with the reaction of 2M hydrochloric acid color development stopping after 10~15 minutes；A_450nmIt reads Number.

Using the positive 293 coating plate negative holes simultaneously of CD20-293 coating plate as antigentic specificity.

2.5 expand culture

After detecting for the first time, selects positive hole to carry out being extended to 4 96 holes, spend 2 days, institute's reaming is detected, determine Positive hole is extended to 24 holes.It is long to bottom hole about 1/3 to 24 hole cells, then carry out ELISA detection.After the method is equally applicable to The detection of phase antibody.

2.6 cell conditioned medium human antibody quantitative detections

It is still positive cell hole culture supernatant after ELISA again is identified to step 2.5 generation, uses Bethyl People's Ig quantitative detection ELISA kit (article No. E88-104) of Laboratories, specific steps by kit specification into Row.

The sequence of 2.7 relative affinities

Preparation of samples: the antibody that will compare, the i.e. antibody purification of known concentration or by known after step 2.6 quantitative detection The cells and supernatant of contained antibody concentration is diluted to 4-8 same concentrations (120nM, 40nM, 13.1nM, 4.4nM).Then ELISA detection is carried out by step described in 2.4.Since all samples are adjusted to same antibody concentration, the difference of OD value in advance It will be caused by the affinity of antibody.OD value is higher, and relative affinity is higher.It maps and calculates using Prism software and is relatively every The affinity of one antibody.Integrated embodiment 3~5 and this inspection result, select antigen affinity and function assessment efficiency highest 10 A cell grows hole, i.e., 1.1,1.4,1.6,1.36,1.72,1.89,1.105,1.134,1.146,1.176.

2.8 limiting dilution assays subclone, cell expansion culture

In preceding 1 day of subclone either same day acquisition mouse peritoneal feeder cells (use HT culture medium), cell concentration for 1 × 10⁵96 orifice plates, the hole 100ul/ is added in a/ml.To through step 2.7 detection after screen 1.1,1.4,1.6,1.36,1.72, 1.89, after 1.105,1.134,1.146,1.176 positive hybridoma cell strains carry out Trypan Blue counting respectively, by cell point Be not taped against in plank by following concentration: density is 5/hole, spreads 1 piece；1/hole, spread 1 piece；0.5/hole, spread 2 pieces.It is put into two Carried out in carbonoxide incubator culture 5-7 days after, through inverted microscope from bottom hole cell, be confirmed as list under marking pen circle The hole of clone.Only shift the cells and supernatant in these monoclonal holes, 50 holes μ l/ carry out ELISA detection (see 2.4 methods).? In the hole for determining antigen positive through ELISA, according to cell state and OD value, from be subcloned every hybridoma cell strain (1.1, 1.4,1.6,1.36,1.72,1.89,1.105,1.134,1.146,1.176) in choose 3-5 best monoclonal cell hole Supernatant carry out lower step (2.9) identification.

The identification of 2.9 subclass

Wrapper sheet goat anti-human igg (Fc), 2ug/ml, 4 DEG C are overnight, and BSA closing is added cell conditioned medium to be measured, and 37 DEG C, 2 hours, It is added enzyme mark subclass secondary antibody IgG1, IgG2, IgG3, IgG4, κ, λ (Southern Biotechnology), colour developing, A450 is read Number, judge the subclass of surveyed cell strain as IgG1, κ.Every step is all washed 3 times with PBST before liquid feeding.From being subcloned per miscellaneous It hands in the 3-5 monoclonal cell hole filtered out in tumor cell strain by step 2.8, selectes the monoclonal for being determined as IgG1- κ Cell strain, be respectively as follows: 1.1.81,1.4.68,1.6.14,1.36.2,1.72.108,1.89.45,1.105.3, 1.134.42,1.146.78,1.176.109.This 10 monoclonal cell strains are extended to 24 holes (with the DMEM containing 20%FBS Culture medium), it is grown to cell, after detection, is extended to square vase.

2.10 cell cryopreservation

Frozen stock solution is prepared: 10%DMSO, 60%FBS, 30%DMEM are put in and are pre-chilled on ice, cell blow it is outstanding after, be put into centrifugation Guan Zhong, trypan blue count, and supernatant is abandoned in centrifugation, pre-cooling frozen stock solution are added, by 2~5 × 10⁶A/pipe, is frozen.Cell is put into Program temperature reduction box (Nalgene) is placed on -70 DEG C of refrigerator overnights, is transferred in liquid nitrogen within second day.

2.11 sequencings, clone's monoclonal human hybridize tumor gene

After hybridoma is subcloned, filter out keep antigentic specificity monoclonal cell strain 1.1.81,1.4.68, 1.6.14,1.36.2,1.72.108,1.89.45,1.105.3,1.134.42,1.146.78,1.176.109.It is surveyed immediately Sequence and molecular cloning, antibody gene enters expression vector appropriate, and plasmid DNA amplification is purified in -80 DEG C of persistences.

Embodiment 2: monoclonal antibody preparation and identification

1.Antibody is prepared using extracorporeal culture-ing

By the 1.1.81,1.4.68 grown in the DMEM culture medium containing 15% fetal calf serum, 1.6.14,1.36.2, 1.72.108,1.89.45,1.105.3,1.134.42,1.146.78,1.176.109 cell gradually decreases serum to serum-free It either contains only in the serum free medium of a small amount of serum (Invitrogen, 12338-026), is put into 225cm²Square vase is pressed Inoculation 1 × 10⁵The cell concentration of a/ml, is inoculated with 100ml, and every plant of cell is inoculated with 4 bottles.

2.Antibody purification

It takes out in 225cm²10 days or so cell conditioned mediums of flask culture, centrifugation, remove cell fragment, through rProtein A affinity chromatography carries out antibody purification.Loading: the cells and supernatant of pH7.4 direct loading after 0.22um considers film filtering；Stream Wash: pH7.4PBS stream is washed, 10 times of bed volume；Elution: pH3.0 glycine solution, every section of 0.5ml collect eluent；It reads every Section OD280, each section antibody-containing is mixed.OD280 is detected again, by 1.58OD=1mg calculating antibody concentration.By the anti-of collection Preservation in sterile condition after the filter of liquid solution filtering 0.22um.It runs SDS-PAGE glue and verifies antibody purification purity.It is LAL and tests determining nothing Contaminated with endotoxins (Genscript, Cat:L00350), by this antibody purification be used for cytotoxicity test (see below ADCC, CDC and apoptosis experiment).

Embodiment 3: the cellulotoxic experiment (CDC) of Complement Dependent

Ramos, Raji and Daudi cell are bought from ATCC, culture medium 10%FBS, 1% Sodium Pyruvate and 1%HEPES The DMEM of buffering.CellTiterGlo kit is purchased from Promega (Madison, WI).Normal human serum is complete by healthy blood donor Blood system is from acquisition.

By 1 × 10⁵A/hole spreads Ramos, Raji and Daudi cell into 96 orifice plates.In 37 DEG C, 5%CO₂Cell training It supports the antibody to be tested of cell and various concentration in case to be incubated for altogether 10 minutes, wherein antibody to be tested is obtained in embodiment 2 Affinity maturation antibody obtained in cell conditioned medium antibody or embodiment 6, positive control are Mabthera, and negative control is purifying Human IgG (is purified from the serum of Healthy People and is prepared).Then normal human serum, which is added, makes it final concentration of 10% in culture solution.? 37 DEG C, 5%CO₂Cell incubator in, by cell, the different antibodies of various concentration and human serum be incubated for altogether after sixty minutes, lead to Cross CellTiterGlo kit measurement cell cracking rate.Hybridoma culture supernatant is for example screened, then is needed according to quantitative ELISA Supernatant in containing antibody concentration as a result, the numerous supernatant antibody concentration tune that will be screened are released to 10 μ g/ml, then compare in phase With CDC effect of antibody each under concentration, to filter out the antibody hybridoma antibody strain of high CDC effect.It is mapped using Prism software With calculating EC₅₀.The result is shown in Figure 1, Fig. 2, Fig. 3 and table 1, table 2.

Table 1: the CDC function assessment of different people's hybridoma cell strain supernatants is screened

Corresponding cell strain	EC50	Sequence
			1.1.81	4.103	6
1.4.68	68.53	10
			1.6.14	56.89	9
1.36.2	0.452	2
			1.72.108	1.563	4
1.89.45	3.882	5
			1.105.3	0.446	1
1.134.42	7.442	7
			1.146.78	9.99	8
1.176.109	0.556	3
			Rituximab	0.346

Table 2: to the CDC function assessment screening of expressing cho cell purifying human antibody after affinity maturation, (sort antibody in table Example 6 is seen in source)

Antibody Designation	EC50	Sequence
			H2L3	0.496	3
H2L6	2.054	10
			H2L10	0.258	1
H8L3	0.742	8
			H8L10	0.554	4
H8L15	0.623	5
			H11L6	1.186	9
H11L10	0.646	6
			H19L3	0.740	7
H19L15	0.327	2
			Rituximab	0.455

Embodiment 4: the cellulotoxic experiment (ADCC) of antibody-dependant

Target cell prepares: with the DMEM culture medium for being free of serum, suspension Raji cell to concentration is 1 × 10⁵A/ml, adds Entering Calcein AM (Sigma) to ultimate density is 10UM, 37 DEG C, is incubated for 50 minutes.Supernatant is removed in centrifugation, the DMEM without serum Culture medium suspension cell is taped against in 96 orifice plate of black transparent bottom (Corning), the hole 75ul/ to 104/75ul.PBS dilution is to be measured At various concentration, the hole 25ul/ is added in plank for antibody and positive control, is incubated at room temperature 30 minutes.

Effector cell prepares: it is sterile to take fresh normal person's venous blood, make blood anticoagulant with anti-coagulants, is added Rosettesep Human NK cell Enrichment cocktail (1ml be added 50ul) is added isometric with whole blood PBS containing 2%FBS, is added lymphocyte separation medium, and 2150rpm is centrifuged 30 minutes；Turn intermediate layer cell into conical pipe, The PBS containing 2%FBS is added, 2150rpm is centrifuged 10 minutes, abandons supernatant；With a small amount of PBS suspension cell, counted with trypan blue, Cell concentration is adjusted to 10⁵A/75ul,

Reaction: taking the effector cell of 75ul into the mixed liquor of target cell and antibody, and 37 DEG C are incubated for 4 hours, is centrifuged plank, 1000rpm is centrifuged 5 minutes, shifts supernatant to being taped against in 96 orifice plate of black transparent bottom (Corning), the hole 100ul/, plank is put into Microplate reader (Luminescence Plate Reader) reading.As a result it enumerates and sees Fig. 4, Fig. 5, Fig. 6 and table 3, table 4.

Table 3: the ADCC function assessment of different people's hybridoma cell strain supernatants is screened

Corresponding cell strain	EC50	Sequence
			1.1.81	0.012	7
1.4.68	6.646	9
			1.6.14	8.201	10
1.36.2	0.007	2
			1.72.108	0.011	6
1.89.45	0.009	4
			1.105.3	0.005	1
1.134.42	0.011	5
			1.146.78	0.007	3
1.176.109	0.012	8
			Rituximab	0.004

Table 4: the ADCC function assessment screening of expressing cho cell purifying human antibody after affinity maturation is enumerated and (is sorted in table Example 6 is seen in the source of antibody)

Antibody	EC50	Sequence
			H2L3	0.00967	6
H2L6	0.00847	4
			H2L10	0.00235	1
H8L3	0.00907	5
			H8L10	0.02351	9
H8L15	0.16059	10
			H11L6	0.01034	7
H11L10	0.00401	3
			H19L3	0.01053	8
H19L15	0.00369	2
			Rituximab	0.00273

Embodiment 5: the apoptosis of tumor cells experiment of antibody induction

By 1 × 10⁵A/hole spreads Ramos, Raji and Daudi cell into 96 orifice plates.In 37 DEG C, 5%CO₂Cell training It supports the antibody H2L10 to be tested (coming from embodiment 6) of cell and various concentration in case to be incubated for 48 hours altogether, wherein positive control is Mabthera, negative control are the human IgG of purifying.After 48 hours are incubated for culture altogether, 96 plates are taken out, are washed 2 times with PBS, with every hole 1ul FITC-Annexin V (eBioscinece cat#:88-8005) is added in 100ul cell culture fluid suspension cell, every hole And be uniformly mixed, room temperature is protected from light dyeing 15 minutes, is washed 3 times with PBS.With 200ul PBS suspension cell, it is loaded into cell count Plate finds out apoptosis rate in the apoptosis cell that fluorescence microscope counts total number of cells and dyeing.It the results are shown in Table 5.As a result it shows Show: for H2L10 in apoptosis and CDC experiment, drug effect is about 2 times stronger than Mabthera, equivalent with Mabthera in ADCC test.

The apoptosis of table 5:H2L10 and Mabthera, the cell toxicant of complement-mediated, antibody directed cellular poison effect compare (H2L10 Example 6 is seen in source).Apoptosis, antibody directed cellular poison, complement-mediated cellulotoxic experiment be three main anticancer drugs Pharmacodynamics test.Half active drug concentration (EC₅₀) it is the standard index for comparing different pharmaceutical pharmacodynamics.The experiment shown in table It is the result with the control of Metro Huawei to the H2L10 back-to-back pharmacodynamic experiment carried out.

Embodiment 6: affinity maturation

The heavy chain and light chain of 6.1 sequencing Anti-CD20

After immune, fusion and monoclonal, it is mono- that anti-CD20 is chosen based on affinity and cell function experimental result Clonal antibody cell strain 1.105.3 is that template does affinity matured antibody experiment.

The analysis of the sequence of antibody gene heavy chain and light chain.The total serum IgE of anti-CD-20 monoclonal antibody cell 1.105.3 uses Invitrogen companyReagent kit (15596-026) extracts；Then using Takara company Random primer in 5 ' RACE FULL kits (D315), using total serum IgE as template, reverse transcription is the first chain cDNA, and according to examination The specification operating procedure of agent box adds connector at 5 ' ends；Then with kit carry adapter-primer, respectively with people's heavy chain base Because to be expanded to obtain anti-CD-20 monoclonal anti-for IgG1 constant region special primer and light chain gene κ chain constant region specific primers The heavy chain variable region and light chain variable region of body gene.Heavy chain and light chain special primer for PCR amplification are:

IgG1 reverse primer: GCGCCTGAGTTCCACGACAC

κ chain reverse primer: CACAACAGAGGCAGTTCCAG

Pcr amplification product is cloned into carrier T (Takara, D101A), and is sequenced, sequencing obtains consistent heavy Chain variable region and light chain variable region.

The building of 6.2 scFv and ELISA detection

In order to improve the affinity of the antibody, using the single-chain antibody scFv of building as template, random mutation is carried out, and will dash forward The single-chain antibody of change carries out phage display, then screens to obtain the antibody of more high-affinity by ELISA.It is surveyed according to previous step Sequence is as a result, design heavy chain variable region and light chain variable region specific primer, and add respectively at the end of heavy chain variable region 5 ' and 3 ' ends The site SfiI and the site XhoI, the end of light chain variable region 5 ' and 3 ' ends add the site NheI and the site NotI, heavy chain variable region (VH) It is as follows with light chain variable region (VL) amplimer:

VH forward primer: ACTCGCGGCCCAGCCGGCCATGGCC GAGGTGCAGCTGGTGCAGTC

VH reverse primer: CCACCACTCGAGGC GCTCGAGACGGTGACCAGGGT

VL forward primer: TGGCGGGTCGACG GATATTGTGATGACCCAGACT

VL reverse primer: TGTTCTGCGGCCGC TTTGATCTCCACCTTGGTC

Respectively with right-on V_HAnd V_LCloning is template, after PCR amplification heavy chain variable region and light chain variable region, digestion, Substep is cloned into Vector for Phage Display pFL249 (gene chemical synthesis building), carries out sequence verification.

Selection sequencing correctly clone A0026/pFL249-scFv be transformed into TG1 competent cell (Stratagene, 200123) in, picking monoclonal is cultivated, is induced, collects supernatant, carries out ELISA detection by antigen of Raji cell membrane.

Building, screening and the sequencing analysis in 6.3 random mutant libraries

Using the GeneMorph II Random Mutagenesis kit (200550) of Statgene company, with V_H Forward primer and V_LReverse primer carries out fallibility PCR amplification, and the PCR product expanded is purified, digestion, is connected to On pFL249 carrier, then electrotransformation is into TG1 competent cell, gradient dilution to concentration appropriate, spread plate, 37 DEG C of mistakes Night culture.

Culture and inducing expression are carried out from picking monoclonal on the plate of monoclonal appropriate density to 96 hole Bacteria Culture plates, It collects supernatant progress ELISA detection and 200 lists is selected according to OD value from high to low in the OD value monoclonal higher than wild type Clone is sequenced.

It analyzes sequencing result and, according to OD value, from high to low, selects 20 respectively after the non-source of people of removal FR region mutation is cloned The V of the clone of a mutation_HAnd V_LFor constructing full length antibody.

6.4 building full length antibodies and affinity sequence

6.4.1 before basis as a result, design heavy chain variable region and light chain variable region specific primer, and respectively in weight The end of chain variable region 5 ' and 3 ' ends add the site SfiI and the site SalI, the end of light chain variable region 5 ' and 3 ' ends plus the site SfiI and The site BsiwI, heavy chain variable region and light chain variable zone amplication primer are as follows:

V_HForward primer 1:TGGCAGCGGCCACAGGGGCCCACTCC GAGGTGCAGCTGGTGCAGTC

V_HReverse primer 1:GCCCTTGGTCGACGC GCTCGAGACGGTGACCAGGGT

V_LForward primer 1:TGGCAGCGGCCACAGGGGCCCACTCC GATATTGTGATGACCCAGACT

V_LReverse primer 1:AGCCACCGTACG TTTGATCTCCACCTTGGTC

Respectively with the V of wild type_HAnd V_L20 V after clone, and mutation_HWith 20 V_LClone is template, PCR amplification After heavy chain variable region and light chain variable region, digestion, the κ constant region pCI for being cloned into IgG1 constant region and people containing someone respectively is carried In body (Promega, E1731), and carry out sequence verification.

6.4.2 it respectively combines the full-length light chains (L) of 20 total length heavy chains (H1~H20) and wild type after mutation, it will The heavy chain (H) of 20 full-length light chains (L1~L20) and wild type after mutation combines, and totally 40 kinds of combinations will use FreeStyle MAX transfection system (Invitrogen, 16447-100) cotransfection is into CHO-S cell, and 37 DEG C, 8%CO₂After culture 6 days, from The heart collects supernatant.

Antibody concentration in 40 antibody supernatants is carried out by 2.6 step methods in previous embodiment 1 to quantify, and then presses aforementioned reality It applies 2.7 step methods in example 1 and carries out relative affinity sequence.As a result as shown in Fig. 7, Fig. 8 and table 6: the supernatant of 40 mutant Affinity have 10~20 times of different degrees of raisings compared to initial cell strain 1.105.3.5 affinity highests are selected respectively Heavy chain H2, H8, H11, H16, H19 and 5 affinity highest light chain L3, L6, L10, L15, L18.

Table 6: the affinity sequence (K of heavy chain and light chain after mutation_DIt is to pass through Prism for dissociation constant (unit: nM) Software is calculated with affinity sequence ELISA data)

6.4.3 5 heavy chain mutants and 5 light chain mutants previous step screened are combined with each other, and are made into 25 entirely Long mutant antibodies: H2L3, H2L6, H2L10, H2L15, H2L18, H8L3, H8L6, H8L10, H8L15, H8L18, H11L3, H11L6,H11L10,H11L15,H11L18,H16L3,H16L6,H16L10,H16L15,H16L18H19L3,H19L3,H19L6, H19L19,H19L15,H19L18.By their heavy and light chain cotransfections, culture collects supernatant, then carries out affinity sequence.

As a result as shown in Fig. 9 and table 7, in 25 supernatants, there is the affinity of 10 H/L group composition and division in a proportion Rituximab high.Choosing Affinity selective sort preceding 10 antibody, i.e., preceding 10 antibody H2L10, H11L6, H2L3, H8L3, H19L15, H8L10 in table 7, H11L10, H19L3, H2L6 and H8L15 carry out ADCC and CDC to this 10 antibody according to embodiment 3,4 and test, test result See Fig. 2, Fig. 3, Fig. 5, Fig. 6.

Table 7: the affinity sequence (K of the H/L combination after mutation_DIt is by Prism software for dissociation constant (unit: nM) It is calculated with affinity sequence ELISA data；Ritux indicates Mabthera)

Title	KD
		H2/L10	0.7848
H11/L6	1.761
		H2/L3	2.56
H8/L3	2.574
		H19/L15	2.677
H8/L10	3.322
		H11/L10	3.768
H19/L3	5.458
		H2/L6	5.634
H8/L15	8.723
		Ritux	9.272
H16/L3	10.05
		H8/L18	12.65
H2/L15	12.78
		H19/L18	13
H19/L6	13.18
		H11/L3	13.21
H19/L10	13.32
		H11/L15	13.62
H16/L15	13.76
		H8/L6	13.88
H16/L6	13.92
		H11/L18	14.01
H16/L10	14.66
		H16/L18	15.84
H2/L18	16.05

6.5 human antibody variable region sequences of the invention

Through final sequence verification, the heavy chain constant region of preceding 10 antibody shown in table 7 is the constant region of human IgG1's heavy chain, The amino acid sequence of the constant region of constant region of light chain behaviour κ chain, heavy chain variable region and light chain variable region is as follows

6.5.1 weight chain variabl area sequence

Seq ID NO:1 is the amino acid sequence of the variable region of H19

Seq ID NO:2 is the amino acid sequence of the variable region of H11

Seq ID NO:3 is the amino acid sequence of the variable region of H8

Seq ID NO:4 is the amino acid sequence of the variable region of H2

6.5.2 light-chain variable sequence

Seq ID NO:5 is the amino acid sequence of the variable region of L3

Seq ID NO:6 is the amino acid sequence of the variable region of L10

Seq ID NO:7 is the amino acid sequence of the variable region of L6

Seq ID NO:8 is the amino acid sequence of the variable region of L15

Embodiment 7: pharmacodynamic test in animal body

7.1 antibody H2L10 treatment human B cell Lymphoma Raji Cells of the invention invade the pharmacodynamics test of profit tumor model

7.1.1 the observation of mouse weight and health status

Intravenous injection 10⁷Raji lymphoma cell forms mouse lymph lymphoma disease model.Dividing five groups is respectively 1. physiology salts Water group (no antibody), 2. Mabthera groups (single dose is 3.5mg/kg mouse weight), 3.H2L10 low dose group (single dose For 1mg/kg), 4.H2L10 middle dose group (single dose 3.5mg/kg) and 5.H2L10 high dose group, (single dose is 10mg/kg).Start to be administered within 7 days after cancer cell intravenous injection.Intraperitoneal injection is once a week.The result is shown in Figure 10.

7.1.2 life cycle tests in Mice Body

Intravenous injection 10⁷Raji lymphoma cell forms mouse lymph lymphoma disease model.Dividing five groups is respectively 1. physiology salts Water group (no antibody), 2. Mabthera groups (single dose 3.5mg/kg), 3.H2L10 low dose group (single dose 1mg/ Kg), 4.H2L10 middle dose group (single dose 3.5mg/kg) and 5.H2L10 high dose group (single dose 10mg/kg). Start to be administered within 7 days after cancer cell intravenous injection.Intraperitoneal injection is once a week.The result is shown in Figure 11.

The inhibition test of 7.2 H2L10 treatment human B cell Lymphoma Raji Cells orthotopic transplantation tumor

Tumour growth situation is observed after mouse inoculation human B cell lymthoma, is 40-100mm to gross tumor volume³When left and right, It is screened by knurl product size, the excessive and non-tumor formation person of knurl product is not selected.3 groups: 1. physiology salts are randomly divided into after screening Water group, 2. Mabthera groups, 3.H2L10, wherein the dosage of Mabthera group and H2L10 group is 5mg/kg mouse weight.Abdomen Chamber is injected once a week.Experimental result is shown in Figure 12.

Bring beneficial effect of the present invention

The present invention be exactly be directed to Rituximab shortcoming and carry out recruit initiative: (1) become mouse people's chimeric antibody into Human antibody (2) makes it be directed to the CDC of other oncocytes, ADCC and apoptosis capacity enhancing are to mention by the promotion of novel drugs Height kills tumor curative effect.(3) treatment human B cell Lymphoma Raji Cells invade pharmacodynamics test and the treatment human B cell leaching of profit tumor model The pharmacodynamics in Mice test of bar tumor Raji cell in-situ transplantable tumor, life cycle and inhibit in tumour growth display be not less than or Curative effect more better than Mabthera.

Antibody molecule of the invention, which can be used as drug candidate molecule, to have more preferably lymthoma and autoimmune disease Curative effect, the treatment for the disease that is beneficial to man.

Bibliography

1 Reff ME, Carner K, Chambers KS etc., Depletion of B cells in vivo by a chimeric mouse human monoclonal antibody to CD20[J].Blood 1994,83:435–440.

2 Coiffier B,Pfreundschuh M,Stahel R,Vose J,Zinzani PL.Aggressive lymphoma:improving treatment outcome with rituximab[J].Anticancer Drugs 2002, 2:43–50.

3 Perz J,Topaly J,Fruehauf SDeng Level of CD 20-expression and efficacy of rituximab treatment in patients with resistant or relapsing B-cell prolymphocytic leukemia and B-cell chronic lymphocytic leukemia[J].Leuk Lymphoma, 2002,43 (1): 149-151.

4 Grillo-Lopez AJ.Monoclonal antibody therapy for B-cell lymphoma[J] .Int J Hematol2002；76:385–393.

5 Maloney DG.Immunotherapy for non-Hodgkin's lymphoma:monoclonal antibodies and vaccines[J].J Clin Oncol 2005,23:6421–6429.

6 Krasner C, Joyce RM.Zevalin:90yttrium labeled anti-CD20 (ibritumomab Tiuxetan), a new treatment for non-Hodgkin lymphoma [J] .Curr Pharm Biotechnol, 2001,2 (4): 341-349.

7 Rastetter W,Molina A,White CA.Rituximab:expanding role in therapy for lymphomas and autoimmune diseases[J].Annu Rev Med.2004,55:477-503.

8 Xu Zhi are skilful, Liu Peijie, kaolinite, Liu Jianmin, Li Ning, and it is non-suddenly that note knows quiet rituximab combining with CHOP treating B cell Clinical research [J] China treatment and prevention of tumour magazine .2007,4 (20): 1589-1590. of odd gold lymthoma

9 Takemura S, Klimiuk PA, Braun A etc., T cell activation in rheumatoid Arthritis synovium is B cell dependent [J] .J Immunology, 2001,167:4710-4718.

10 Edwards JC, Szczepanski L, Szechinski J etc., Efficacy of B-Cell- targeted therapy with rituximab in patients with rheumatoid arthritis[J].N Engl J Med, 2004,350:2572-2581.

11 Renaudineau Y, Pers JO, Bendaoud B etc., Dysfunctional B cells in Systemic lupus erythematosus [J] .Autoimmunity Reviews, 2004,3:516-523.

12 Looney R, Jennifer H, Anolik JH etc., B cell depletion as a novel Treatment for systemic lupus erythematosus:1phase I/II doseescalation trial Of rituximab [J] .Arthritis rheum, 2004,50:2580-2589.

13 Taube T, Sehmld H, Reinhard H etc., Effect of a single dose of rituximab In chronic immune thrombocytopenic purpura in children [J] .Haematologica, 2005, 90 (2): 281-283.

The refined text of 14 stones, Yang Shilong, soup people etc. forever, rituximab treatment children immunologic thrombocytopenic purpura-attached Literature Material [J] Chinese children blood and tumour magazine .2007,12 (2): 78-81.

15 Brandstrup P, Bjerrum OW, Nielsen OJ etc., Rittuximab chimeric anti- CD20monoclonal antibody treatment for adult refractory idiopathic Thmmbocytopenic purpura [J] .Am J Hematol, 2005,78 (4): 275-280.

16 Fernando SL,O'Connor KS.Treatment of severe pemphigus foliaceus with rituximab[J].Med J Aust.2008,189(5):289-290.

17 Manzurul A.Sikder and Jonathan W.Friedberg.Beyond rituximab:The future of monoclonal antibodies in B-cell non-Hodgkin lymphoma,Current Oncology Reports rolls up the 10, the 5th phase, 420-426

18 Bruggemann, M. and Taussig, M.J. (1997) Production of human antibody repertoires in transgenic mice.Curr.Opin.Biotechnol.8,455–458.

19 Griffiths, A.D. and Duncan, A.R. (1998) Strategies for selection of antibodies by phage display.Curr.Opin.Biotechnol.9,102–108.

20 Chowdhury,P.S.(2003)Engineering hot spots for affinity enhancement of antibodies.Methods Mol.Biol.2007,179–196.

21 Dall ' Acqua, W.F., Damschroder, M.M., Zhang, J., Woods, R.M., Widjaja, L. etc., (2005)Antibody humanization by framework shuffling.Methods.36,43-60.

22 Hwang, W.Y.K. and Foote, J. (2005) Immunogenicity of engineered antibodies.Methods 36,3-10.

23 Sang Jick Kim, Youngwoo Park, and Hyo Jeong Hong. (2005) Antibody Engineering for the Development of Therapeutic Antibodies.Mol.Cells,Vol.20, No.1,pp.17-29.

24 Hwang, W.Y.K., Almagro, J.C., Buss, T.N., Tan, P., and Foote, J. (2005) Use of human germline genes in a CDR homologybased approach to antibody humanization.Methods 36,35-42.

25 Kashmiri, S.V., De Pascalis, R., Gonzales, N.R., and Schlom, J. (2005) SDR grafting--a new approach to antibody humanization.Methods.36,25-34.

26 Tedder TF,McIntyre G,Schlossman SF.Heterogencity in the B1(CD20) cell surfacemolecule expressed by human B-lymphacytes.Mol Immunol.1988.25 (12):1321-1330.

27 Deans JP,Li H,Polyak MJ.CD20-mediated apoptosis:signaling through lipid rafts.Immunology.2002.107(2):176-182.

28 Wang Yu are rigid, and Shen is put forth energy again.CD20 antigen and treatment row anti-CD 20 antibodies.Chinese tumor biotherapy magazine, 2005.12 (1): 76-79.

29 Sikder,MA,Friedberg,JW.Beyond,Rituximab:The Future of Monoclonal Antibodies in B-Cell Non-Hodgkin Lymphoma.Current Oncology Reports 2008,10: 420-426. 。

Claims (8)

1. a kind of full human monoclonal antibody of anti-CD20, the heavy chain constant region of the antibody is the constant region of human IgG1's heavy chain, The constant region of the constant region of light chain behaviour κ chain of the antibody, and the amino of the heavy chain variable region of the antibody and light chain variable region Acid sequence are as follows:

The light chain variable that the heavy chain variable region and amino acid sequence that amino acid sequence is SEQ ID NO:2 are SEQ ID NO:7 Area.

2. a kind of polynucleotides, antibody described in the polynucleotide encoding claim 1.

It include polynucleotides as claimed in claim 2 in the carrier 3. a kind of carrier.

4. a kind of conjugate of anti-CD20, the conjugate includes to be covalently attached with isotope, immunotoxin and/or chemicals Antibody described in claim 1.

5. a kind of conjugate, the conjugate is antibody described in claim 1 or conjugate as claimed in claim 4 and solid Medium or semi-solid medium coupling and formed.

6. prepared by conjugate described in antibody described in claim 1, conjugate as claimed in claim 4 or claim 5 The application in drug for treating following diseases, the disease are as follows: non Hodgkin lymphom, B cell lymphoma, rheumatic With atrophic diseases, systemic loupus erythematosus, immunologic thrombocytopenic purpura and/or multiple sclerosis.

7. a kind of pharmaceutical composition, described pharmaceutical composition includes antibody described in claim 1, knot as claimed in claim 4 Close conjugate described in object and/or claim 5.

8. one kind is for diagnosing non Hodgkin lymphom, B cell lymphoma, rheumatic and atrophic diseases, systemic red The kit of yabbi sore, immunologic thrombocytopenic purpura and/or multiple sclerosis, the kit include claim Conjugate described in antibody described in 1, conjugate as claimed in claim 4 and/or claim 5.