CN104892760B - The full human monoclonal antibody of anti-TNF alpha and its application - Google Patents

Abstract

The invention belongs to the technical field of antibody drug, human monoclonal antibodies and its application of anti-TNF alpha are provided, these antibody are derived from people's hybridoma and carry out what affinity screening obtained by cytotoxicity test screen and by display technique of bacteriophage, have the excellent affinity and specificity to TNF α.In the pharmacodynamics test of cell model, these antibody can effectively neutralize TNF α and its caused cytological Effect.In zoopery, these antibody equally can effectively neutralize TNF α, and suppress phenotype caused by TNF α in animal model.Its effect, which is shown, to be not less than or more preferable than Humira.

Description

The full human monoclonal antibody of anti-TNF alpha and its application

Technical field

The present invention relates to the technical field of antibody drug.Specifically, it is related to one group of new full human monoclonal antibody point Son, it can be used for disease treatment caused by treatment TNF α.

Background technology

It is well known that tumor necrosis factor (tumornecrosis factor, TNF) family participates in various immune and inflammation The regulation and control of reaction, are the key cytokines of autoimmune disease (autoimmune disease).Autoimmune disease Disease refers to that body occurs immune response to autoantigen and causes the disease caused by damaged self tissue.Common systematicness is certainly Body immunological disease has：Rheumatoid arthritis, ankylosing spondylitis, systemic loupus erythematosus, mouth xerophthalmia scheorma syndrome, chorionitis, Nodular polyarteritis, Wegener granulomatosis.TNF participates in the cellular network reaction of rheumatoid arthritis (RA) complexity, adjusts Inflammatory reaction, thus it is effective in theory to treat RA and other autoimmune diseases for TNF.In fact, large sample is more Center clinical trial proves^[1], anti-TNF treatment can be obviously improved the symptom of RA, mitigate disease activity.

(1) TNF protein structures

HumanTNF-α's assignment of genes gene mapping is in Chromosome 6q21 .3 regions, with major histocompatibility antigen complex Group III gene (MHC-III) close linkage.Full-length genome 3kb (containing 4 extrons and 3 intrones), maturation products are by 157 amino acid Composition, 80% amino acid sequence is by the 4th exons coding.TNF-α is a polypeptide non-helical, rich in β-pleated sheet, Each monomer is made of antiparallel β-pleated sheet, is usually present in the form of dimer, tripolymer or pentamer in vivo, tool The TNF-α molecule for having biological activity is close-connected tripolymer.

Successfully rHu TNF-α cDNA is cloned within 1984 from the cells such as HL-60, U937, and height is obtained in Escherichia coli Expression.HumanTNF-α's precursor is made of 233 amino acid residues, the signal peptide containing 76 amino acid residues, cut off signal peptide after into Ripe type TNF-α is 157 amino acid residues, non-glycosylated, the 69th and 101 two cysteines formation intramolecular disulfide bonds. RHu TNF-α molecular weight is 17kDa.Mouse TNF-α precursor is 235 amino acid residues, and 79 amino acid residue of signal peptide is ripe Mouse TNF-α (rMuTNF- α) molecular weight is 17kDa, is made of 156 amino acid residues, the 69th and 100 two and half Guangs Propylhomoserin forms intramolecular disulfide bond, has a glycosylation point, but glycosylation does not influence its biological function.RHu TNF-α and rMu TNF-α forms homology by 79% amino acid, and the biological action of TNF-α is like without obvious species specificity.

TNF-α gene is an important candidate gene of RA incidence inheritance factors, TNF enhancers 238 for GG genotype in RA progressivity destruction of joint degree is related and independent of the presence of DR4.In addition studies have found that^[2], TNF regions polymorphism can Can there are reciprocation so as to influencing disease susceptibility in DR allele.

(2) function of TNF molecules

In inflammation disease, TNF-α is mainly derived from mononuclear macrophage, while lymphocyte, natural killer cells, neutrality Granulocyte, smooth muscle cell, fibroblast, mast cell, endothelial cell, epidermal cell and osteoblast etc. can also produce and Discharge TNF-α^[3]。

The TNF-α acceptor TNFR1 different from 2 kinds (p60, p55 and CD120a, are expressed in all karyocyte surfaces) and TNFR2 (p80, p75 and CD120b, are expressed in the cell surface of candidate stem cell system) is combined, and passes through multi-signal transduction pathway (see Fig. 6) is in different type cell, even same type cell plays a variety of different biology effects in different differential periods Should^[4]。

TNF-α is to maintain the important biomolecule medium of immunity of organism balance, it participates in the migration, activation, propagation of lymphocyte With differentiation and the regeneration of lymphoid tissue^[3,5], play a significant role in antitumor, immune defense and inflammatory reaction.But it is worth It is noted that TNF-α has double biological effect^[6], one side TNF and receptor system being capable of induction of programmed cellization death (i.e. Apoptosis), on the other hand it again cell Proliferation, differentiation and maturation can be promoted cell is survived and produced corresponding Various biological effect.Under normal circumstances, TNF and receptor system maintain the balance of these two aspects function, when this balance exists When being broken under some pathological conditions, immunity of organism environment and dysfunction can be caused, disease occurs.

Shen^[7]Show Deng research, anti-TNF-α antibody (such as Humira) can be in combination with free TNF-α and cell membrane The TNF-α on surface, so as to prevent the combination of TNF-α and receptor system, balances TNF-α and the relation of receptor system, plays and control Treat the purpose of disease.Fig. 7 shows that a series of biology that this antibody-like medicine produces after being combined with cell membrane surface TNF-α are anti- Should.

(3) therapeutic anti-TNF antibodies medicine

TNF is a critical cell factor of body immune system, and TNF mistakes are found in various autoimmune disease Expression.At present, rheumatoid arthritis, psoriatic arthritis, mandatory arthritis, silver can be treated using anti-TNF antibodies medicine Bits disease, Crohn disease and inflammatory enteritis etc..There are 5 kinds of TNF-α antagonists can be used for clinical, including Etanercept, Infliximab, Adalimumab, Golimumab and Certolizumab pegol.

Because tumor necrosis factor plays a crucial role in immunological regulation, the possibility clinical indication of TNF antibody medicines is up to More than 20 plant.America and Europe still has the indication of tens clinical trial extension TNF antibody medicines at present.These indications include：It is common Psoriasis (Psoriasis Vulgaris), acute graft versus host disease (Acute Graft Versus Host Disease), leukaemia, mucocutaneous lymph node syndrome (Mucocutaneous Lymph Node Syndrome), Kawasaki Sick (Kawasaki Disease), lupus erythematosus discoides (DLE), graft versus host disease(GVH disease), HIV infection, Moderate to Severe Active Axial arthritis vertebralises, lichen planus (Lichen Planus), pneumonia, idiopathic pneumonia syndrome (Idiopathic Pneumonia Syndrome), lung cancer, prostate cancer, metastases, Bone Cancer Stomatitis, inclusion body myositis (Inclusion Body Myositis), polymyalgia rheumatica (Polymyalgia Rheumatica), acute non-infectious pulmonary dysfunction (Acute Non-Infectious Pulmonary Dysfunction), type i diabetes, dermatomyositis (Dermatomyositis), metabolic syndrome, obesity, hypertension, high blood Fat, lupus nephritis (Lupus Nephritis), lumbosacral radiculopathy (Lumbosacral Radiculopathy), chronic stalk Resistive lung disease deteriorates (COPD Exacerbation), bronchitis, Crohn's disease, colitis.

1) anti-TNF alpha antibodies：Humira

Britain Cambridge Antibody Technology in 1993 and U.S. BASF Bioresearch The Joint Research Centre of Corporation is found that the potential of the anti-TNF monoclonal antibodies in full people source by display technique of bacteriophage Clinical value.Complete anti-TNF monoclonal antibodies medicine (Humira) early studies in man in people source in 1999 achieves preferable preliminary knot Fruit, lays a good foundation for comprehensively deep development clinical test.The clinical test results card of 271 rheumatoid arthritis in 2001 Bright, 50% patient is used in combination Humira and methotrexate (MTX) achieves at least more than 50% state of an illness and improves.2002 Abbott companies have built an advanced biological products Workshop Production Humira.On December 31st, 2002, U.S. FDA is formally criticized Quasi- Humira is used to treat rheumatoid arthritis.Humira list marketings in 2003, for treating rheumatoid arthritis, together The clinical test of other indications of Shi Kaizhan.U.S. FDA approval Humira is used to treat psoriatic arthritis within 2005, first then The secondary sales volume for achieving 1,000,000,000 dollars.On December 10th, 2005, the New Drug Certificate of rheumatoid arthritis in Japanese publication. The New Drug Certificate for having applied for Crohn's disease in 2006, and FDA approvals are used to treat ankylosing arthritis.Sale then is dashed forward It is 2,000,000,000 dollars broken.FDA approval Humira in 2007 are used to treat Crohn disease in the U.S., meanwhile, Abbott has applied for global model Interior curing psoriasis is enclosed, this is also the 5th indication of Humira.December 10 days then, Abbott are built in Puerto Rico An if brand-new biological products workshop, for producing Humira.Sales volume breaks through 3,000,000,000 dollars.On June 10th, 2009, The Abbott companies clinical data of continuous 5 years discloses, while uses Humira and methotrexate in treatment of patients with rheumatoid arthritis disease People, can prevent the bone marrow destruction of patient.Sales volume breaks through 5,600,000,000 dollars.2011, on the digestive disease week in the U.S., Abbott Disclose the positive achievement of III clinical trial phases of Humira treatment ulcerative colitis, and recent warp-wise USA and EU Applications of the Humira for ulcerative colitis is submitted by supervision department, it is contemplated that will be granted in 2011^[8]。

The clinical practice of Humira

Rheumatic arthritis --- HUMIRA is suitable for moderate to severe activity rheumatic arthritis adult patient, can subtract Light S＆S, produces notable clinical efficacy, suppresses the deterioration of structural damage, improves physical function.HUMIRA both can be single Solely use, and state of an illness antirheumatic drug (DMARD) can be changed with methotrexate (MTX) or other inanimates and be used in combination^[9]。

Juvenile idiopathic arthritis --- HUMIRA is suitable for the moderate of 4 years old and more than 4 years old to severe activity multi-joint Type juvenile idiopathic arthritis pediatric patients, can mitigate S＆S.HUMIRA not only can be used alone, but also can be with methotrexate (MTX) It is used in combination.

Psoriatic arthritis --- HUMIRA is suitable for activity rheumatic arthritis adult patient, can mitigate sign and disease Shape, suppresses the deterioration of structural damage, improves physical function.HUMIRA not only can be used alone, but also can join with inanimate DMARD Close and use.

Ankylosing spondylitis --- Humira is suitable for activity ankylosing spondylitis adult patient, can mitigate sign and disease Shape.

Crohn's disease (Crohn disease) --- Humira is suitable for the moderate of conventional therapies deficiency to severe activity Crohn Crohn disease disease adult patients, can mitigate S＆S, cause and keep clinical remission.For those Infliximab has lost it curative effect or has not tolerated the patient of infliximab, and Humira can mitigate their sign and disease Shape, and cause clinical remission.

Plaque psoriasis --- Humira can be used for treatment to be adapted to systemic treatment or lucotherapy and from medicine angle The not very suitable adult moderate of other Systemic therapies is to severe chronic psoriatic for degree^[10]。

2) other TNF α antagonists of

There are 5 kinds of TNF-α antagonists to list abroad at present, including Etanercept, Infliximab, Adalimumab (i.e. Humira), Golimumab and Certolizumab pegol, wherein preceding 3 kinds of medicines have been listed in China and extensive use. With Etanercept Etanercepts ratio, Humira better efficacy, dosage is low/low (Etanercept Etanercepts are every for production cost All 50mg, Humira 40mg every two weeks)；With Infliximab ratios, Humira better efficacy, dosage is low/production cost is low (Infliximab monthly 600mg, Humira every two weeks 40mg), Small side effects, Infliximab are human mouse chimeric antibodies, Yi Yin HAMA immune responses and shock are played, and Humira is human antibody.

Etanercept is a kind of recombinant soluble TNF p75 receptor dimer fusion proteins of full-length human, is note Penetrate and use recombined human II type TNF receptor-antibody fusion proteins.It is combined with soluble TNF acceptor in blood circulation, is reduced and is organized The TNF that cell surface TNF receptors combine, so as to block Inflammatory Signal Transduction, reduces tissue damage.Multinomial clinical test shows, Have using the long-term RA patient of a variety of DMARD drug therapies failure, Etanercept single therapies or with methotrexate (MTX) combination Preferable tolerance, and can continue to improve the Disease Activity of patient.It is sexy that adverse reaction includes local reaction, opportunistic Dye, Toxicity in blood system, granuloma etc..Most common with local reaction, fash, discoid lupus, skin can occur for injection of skin position Skin vasculitis etc., also there is the report of skin infection and skin neoplasin^[11]。

Infliximab is a kind of human mouse chimeric anti-tnf-alpha -1gG1 κ homotype chain monoclonal antibodies, into after human body, with Joint tissue cell with TNF-α expression works, and destroys the cell and declines the cytoactive.Gao etc.^[12]Study table Bright, severe patient outcome is good in being treated in a short time with Infliximab, helps to alleviate the progress of RA iconographies, for middle severe This effect of patient is particularly evident.Infliximab treatments rheumatism is comparatively safe, it is possible that skin adverse reaction, infusion are instead Should, or cause infection risk increase and tuberculosis susceptibility etc..

Adalimumab (adalimumab) is the recombinant monoclonal TNF antibody of full-length human.In December, 2002 FDA batches Quasi- Adalimumab (trade name Humira) can be used for treating the middle severe work not good enough to one or more antirheumatic curative effects Dynamic property RA.With infection (such as upper respiratory tract, nasosinusitis), injection site reaction, headache drawn game after being treated using Adalimumab The adverse reactions such as portion's fash are most commonly seen, incidence>10%.

Above-mentioned 3 kinds of TNF α antagonists are expected to be used for gestational patients.Traditional DMARD belongs to C, D and X in FDA classification more Class medicine, it is larger to fetotoxicity, it should avoid using, the state of an illness needs to use with caution when using.And Etanercept, Infliximab and Adalimumab is classified as the B classes in FDA classification^[13].There is data to show, there is no evidence to show so far TNF-α picks up anti-agent with embryotoxicity, teratogenesis or causes abortion ratio to raise.Show that this conclusion is still needed substantial amounts of case money Material^[14]。

Golimumab and Certolizumab pegol are 2 kinds of New rhTNF-α antagonists.In April, 2009 FDA approvals Golimumab (trade name Simponi) is used to treat the moderate of adult to severe class RA.Golimumab is a kind of complete people The TNF-α monoclonal antibody in source.Major advantage includes shot to shot turnaround length (monthly injecting 1 time), short of money to using TNF-α The RA patient of anti-agent treatment is equally effective.Using the most common adverse reactions of Golimumab include injection site erythema, headache and Nausea, but generation severe infections or malignant tumour person's quantity are few.Due to lacking with other TNF-α antagonists in efficacy and saferry The long-term experiment data of contrast in terms of evaluation, Golimumab should be used after other medicines treatment is invalid^[15]。

A kind of TNF-α list that Certolizumab pegol are made of Fab fragments and the 40kDPEG fusion of human antibody Clonal antibody, wherein PEG molecules can increase the plasma half-life of medicine.Compared with other TNF-α antagonists, due to without IgG Fc areas, Certolizumab pegol do not cause Antibody -dependent cell cytotoxicity effect (ADCC) and Complement Dependent it is thin Cytotoxicity (CDC)^[16].In May, 2009, FDA ratified the polyethylene glycol anti-tumor necrosis factor of UCB. S.A.'s production Certolizumab pegol (trade name Cimzia) arrive the treatment of severe RA patient in being used for.III phase clinical trials show, Certolizumab pegol are alone or are combined the equal well-tolerated of patient with MTX, and adverse reaction is slight or moderate.It is most common not Good reaction has the infection of the upper respiratory tract, dermexanthesis, urinary tract infection.Injection site pain incidence is low.

(4) human antibody technology of preparing

The preparation mid-term the 1970s hybridoma technology of human antibody comes out, the monoclonal antibody thus prepared (MAb) be anti-single antigenic determinat antibody, there is the specificity and homogeneity of height, and can largely prepare, this becomes anti- The once great revolution of body research field.1986, the first monoclonal antibody drug OKT3 prepared using this technology was beautiful State FDA approval listings, the immunological rejection being used for after treating organs transplanting.But since antibody is mouse source, trigger in patient Serious immune response, this just hinders the development and utilization of antibody drug significantly.

Also will strictly it be considered into medicine, its some features as antibody is used to exploitation, as immunogenicity, affine Power, stability, effector function, half-life period, tissue permeability and its distribution etc.^[17].When in mouse source, MAb productions become maturation, grind The person of studying carefully just envisions produces people source MAb by conventional hybridoma technology, but the production that cannot stablize due to people's hybridoma cell line The antibody of high yield, and for many antigens, the vivo immunization of people is infeasible.In this way, genetic engineering antibody by But it is raw, 1994, first chimeric antibody ReoPro was approved to list, and clinical practice shows that its immunogenicity is much better than mouse source and resists Body, this has just started the revolution again of the antibody engineering research field after authentic monoclonal antibody.The particularly nineties Since mid-term, further to reduce the generation of immune response, a variety of humanization modified technologies are successfully developed and applied, respectively The genetic engineering antibody and antibody library of kind various kinds continuously emerge^[18][19]So that mass produce medical humanized antibody become can Energy.Since 1997, large quantities of monoclonal antibody medicines was ratified to list by FDA.

The bottleneck of antibody drug industrialization has been broken in the application of the humanization modified technology of monoclonal antibody.So far, according to humanization journey The height of degree can substantially be divided into three kinds of technologies：Chimeric, humanization and Quan Renyuan, people's source sequence accounting is respectively in its gene 75%th, 95% and 100%^[20].Wherein chimeric antibody is by the constant of the variable region of murine hybridoma monoclonal antibody gene and people Area links together, and expression generation is then carried out in mammalian cell；And humanized antibody is then except by the perseverance of antibody Determine area to change into outside people source, further by the FR areas conversion adult source of variable region^[20], so as to reduce immunogenicity； And prepared by human antibody is then there are four kinds of approach, Fab or ScFv libraries are built in a kind of patient's blood sample from collection, and lead to Phage display screening antibodies storehouse is crossed, to produce people source MAb^[21][22].2002, first full people source MAb, Humira, were exactly Developed by phage display.The strategy of second of production human antibody is to use to contain human immunoglobulin gene site Transgenic mice, be immunized, the immune response of human antibody can be produced, so can be come by traditional hybridoma technology Produce people source MAb^[23], the people source MAb being derived from transgenic mice is just in clinical test.The third approach is by dividing From culture human peripheral lymphocyte or lymphocytes in tonsil, immunostimulation then is carried out with antigen, produces immune response, so Merged again with human myeloma cell afterwards and produce hybridoma, obtain human monoclonal antibody through screening, and divided immediately Sub- Cloning Human Immunoglobulin Genes, its affinity with medicine target antigen is improved as necessary by affinity maturation technology^[24], then clone entrance The mammalian cell that can be expressed steadily in the long term expresses purpose antibody, and this antibody is entirely to be generated in people's cell environment 's^[25].4th classpath is to cultivate human peripheral lymphocyte or flat by separation and low-density (every 96 hole of about 500B cells) Peach body lymphocyte, antigentic specificity screening is carried out to culture supernatant, and carrying out molecular cloning to positive hole B cell obtains human antibody Gene, reuses mammalian cell that other can express steadily in the long term to express purpose antibody^[26]。

At present in 5 kinds of TNF α antagonists of foreign countries' approved listing, three kinds are antibody：Infliximab (Infliximab, people mouse are fitted together to monoclonal antibody), adalimumab (Adalimumab/Humira, full Human monoclonal antibody) and Golimumab Full Human monoclonal antibody), two kinds are antibody-like fusion protein：Benefit match is general, and (Etanercept, tumor necrosis factor II type receptor-people resist Body Fc fusion proteins) and Certolizumab pegol (people FAb-PEG fusion proteins).Wherein infliximab, A Damu Monoclonal antibody and benefit match are general in China's approval listing.Zhong Xin states, which build, is prepared for the general imitation medicine of benefit match also in China's approval listing. Complete monoclonal antibody curative effect is preferably, big with adalimumab good effect and sale in monoclonal antibody in general.It is higher that this has benefited from it Affinity TNF α epitope in connection.More effective full people source TNF α monoclonal antibody in order to obtain, present inventor has performed a large amount of Research and development, and obtained the present invention.

The content of the invention

The present invention is exactly the recruit's initiative carried out on the basis of the best adalimumab of curative effect in existing TNF α monoclonal antibody, this The full Human monoclonal antibody of invention has the affinity and biological effectiveness of higher.

The present invention full human monoclonal antibody be based on the third above-mentioned approach (i.e. people's hybridoma technology) and be subject to Machine screen mutation is got.The monoclonal antibody produced using people's hybridoma is considered as on amino acid sequence and glycosylation spectrum It will be better than the human antibody of chimeric antibody and humanized antibody.But due to being difficult to find that making one hybridoma stablizes passage Fusion partner cells, and due to the problem such as fusion efficiencies are low, cell culture is difficult and production capacity is low, prepare and stablize passage and energy People's hybridoma cell line of monoclonal antibody is persistently produced always there are larger difficulty, and successfully example is very few.The present invention is right People's hybridoma of expression human antibody quickly carries out the screening including specificity and function assessment, and the hybridoma filtered out is thin Born of the same parents carry out molecular cloning to preserve antibody gene, so as to overcome above-mentioned difficulties.

With humanization and the maturation of human antibody technology, the affinity of antibody how is improved into current all genes Engineered antibody medicine needs the key issue solved.This is because the affinity of one antibody of increase will reduce the agent of antibody drug Measure and play more preferable bioactivity, it is also possible to it is treated more diseases and reduce dose-dependent toxicity^[18][22].This Outside, expense will also substantially reduce.Multinomial independent research shows that affinity of antibody and biological activity are before reaching the limit values It is linear.Research is expanded from different directions around this problem people, improves the way of affinity of antibody There are two approach in footpath substantially, and one of approach is by random mutation complementary determining region (CDR) or whole variable region, so The antibody of more high-affinity is screened in this substantial amounts of mutant library afterwards^[19]；Another approach be by concentrate mutation or The hot spot region of affinity maturation in modeling Simulation body, establishes a small mutant library^[18][19].Integrate, work as progress During external affinity matured antibody, 4 main aspects are considered as：1. people's mutation is led in the where of antibody gene；2. how to import Mutation；3. rare more high-affinity antibody how is selected from the antibody compared with low-affinity.4. how to differentiate more high-affinity Antibody.

The present invention provides one group of new antibodies of anti-TNF alpha, these antibody are human antibody, and is used as a kind of novel drugs, These antibody moiety efficacy measures it is identical with adalimumab or than it is more preferable.The antibody of the present invention can be used for treatment and diagnostics classes Rheumatic arthritis, juvenile idiopathic arthritis, psoriatic arthritis, Crohn's disease, ankylosing arthritis, psoriasis and/ Or ulcerative colitis, but not limited to this.

The present invention provides a kind of human antibody of anti-TNF alpha, it is characterised in that：The heavy chain variable region of the antibody The amino acid sequence of CDR1 is GFTFSSYDMH, and the amino acid sequence of CDR2 is VIWSDGSIKYYADSVKG, the amino acid of CDR3 Sequence is EVESAMGGFYYNGMDV；And CDR1, CDR2, CDR3 of the light chain variable region of the antibody be selected from it is following 1), 2) And/or 3)：

1) CDR1 is that RASQDIGFDLG, CDR2 AASSLQS, and CDR3 are LQHKSYPLT；

2) CDR1 is that RASQSIGFDLG, CDR2 AASSSQS, and CDR3 are LQHRSYPLT；

3) CDR1 is that RASQDIGFDLG, CDR2 AASTLPR, and CDR3 are LQHKSYPLT.

In the antibody of the present invention, the amino acid sequence of heavy chain variable region is preferably Seq ID NO：1.In the anti-of the present invention In body, the amino acid sequence of light chain variable region preferably selects white Seq ID NO：2、Seq ID NO：3 and/or Seq IDNO：4.

In addition to above-mentioned complementary determining region sequence, the amino acid sequence of the other parts of the heavy chain of antibody of the invention is preferred Corresponding to human IgG2's heavy chain, the amino acid sequence of the other parts of the light chain of the antibody preferably corresponds to people's κ chains.

Two heavy chains of the antibody of the present invention can be the same or different.The two light chains of the antibody of the present invention can also It is identical or different.

The invention further relates to a kind of antibody fragment of anti-TNF alpha, the antibody fragment includes at least the one of the antibody of the present invention Plant heavy chain variable region and at least one light chain variable region and can efficiently identify and combine TNF α.The antibody fragment can be Fab or F (ab') 2.

The invention further relates to a kind of scFv molecules of anti-TNF alpha, the scFv includes at least one weight of the antibody of the present invention Chain variable region and at least one light chain variable region, and can efficiently identify and combine TNF α.The scFv molecules further include Multivalence scFv, such as divalence scFv and trivalent scFv.

The invention further relates to a kind of polynucleotides, the heavy chain and/or light chain of the antibody of the polynucleotide encoding present invention, Antibody fragment or scFv molecules.

The invention further relates to a kind of carrier, the polynucleotides of the present invention are included in the carrier.

The invention further relates to a kind of anti-TNF alpha conjugate, the conjugate includes and isotope, immunotoxin and/or chemistry Antibody of the invention, antibody fragment or the scFv molecules that medicine is covalently attached.The conjugate may be used as such as targeted drug.

The invention further relates to a kind of conjugate, the conjugate is by the antibody of the present invention, antibody fragment, scFv molecules or anti- TNF α conjugate is coupled and is formed with solid dielectric or semi-solid medium.

According to the property of anti-TNF alpha antibodies, antibody of the invention, antibody fragment, scFv molecules, anti-TNF alpha conjugate or idol Join thing and can be used for treatment rheumatic arthritis, rheumatoid arthritis, juvenile idiopathic arthritis, psoriatic arthritis, Crow Engler's disease, ankylosing arthritis, psoriasis and/or ulcerative colitis.

Therefore, the invention further relates to a kind of pharmaceutical composition, described pharmaceutical composition to include the antibody of the present invention, antibody piece Section, scFv molecules, anti-TNF alpha conjugate and/or conjugate.

Those skilled in the art will know, the conservative amino acid in above-mentioned antibody is replaced can't substantially shadow The affinity and structure of antibody are rung, especially described conservative, which is replaced, to be occurred in constant region.Those skilled in the art also know, It can be designed that according to the amino acid sequence of above-mentioned antibody and encode its nucleotide sequence, and be directed to different expressive hosts pair The nucleotide sequence optimizes.In order to treat, detecting, test or other purposes, antibody of the invention can with isotope, exempt from Epidemic disease toxin and/or chemicals are covalently attached, and can also be coupled with solid dielectric, semi-solid medium, be can also use the present invention Antibody functional fragment, this is well known in the art.

The present invention provides a kind of method, manufactures human antibody using this method and is used as a kind of novel drugs.At present There has been no the report that antibody drug system is successfully formulated using the technical method of the present invention.The most important technology that this method is overcome Difficult point is (1) human lymphocyte effective immunological technique in vitro；(2) people's hybridoma mrna instability is determined, it is necessary to quickly carries out including spy Screening including the opposite sex and function assessment, and the hybridoma filtered out is subjected to molecular cloning to preserve antibody gene；(3) It is further excellent by the progress of molecular biology antibody engineering technology to having filtered out the human antibody with certain pharmacological effect Change transformation.

The manufacture of the antibody and related detecting method are as follows：By extracting the peripheral blood lymphocytes of different people either Human tonsil lymphocytes, after external mixing, are co-cultured with the molecule with adjuvant function with antigen, its generation is directed to antigen Antibody, by being merged with myeloma cell, produce people's hybridoma of interim stabilization, the people source containing its secretion in culture supernatant Antibody.Tumor necrosis factor α positive hybridoma cell is filtered out by cell ELISA and grows hole, then with opposite antigen affinity 10 best cell growth holes are screened in sequence and the detection experiment comprehensive assessment of cytology bioactivity, and carry out sub- gram immediately It is grand, filter out the monoclonal cell strain for keeping antigentic specificity.Carry out immediately sequencing and molecular cloning antibody gene to suitably In expression vector, and plasmid DNA amplification is purified in -80 DEG C of persistences.According to the sequence of antibody antigen affinity and cytology The antibody gene of 1 to 3 best monoclonal cell strains is screened in bioactivity detection experiment comprehensive assessment, in this, as template pair It carries out external affinity matured antibody engineering.We are with to CDR1, CDR2, CDR3 area progress random mutation and rite-directed mutagenesis phase With reference to mode establish affinity matured antibody mutated library.Library is sieved with antigentic specificity and relative affinity sequence Choosing.By the heavy chain variable region (VH) and light chain variable region (V of 5~10 best antibody of every wheel_L) carry out fully intermeshing combine to be formed it is complete Long antibody.A small amount of antibody purification is prepared using wink turn, culture and micro affinity purification (ProteinA), using adalimumab as ginseng According to basic point, screening and identification is carried out according to the sequence of antibody antigen affinity and receptors ligand Competition binding assay.Filtered out through this The one group of antibody molecule for having good cytotoxic effects come, then to these antibody variable regions particularly CDR region sequence retrieval, determine It is the recruit found first that this group, which possesses the specific antibody of TNF α,.Have in this group of recruit one or more new Its (1) affinity of antibody molecule (2) receptors ligand Competition binding assay effect higher than adalimumab is better than adalimumab (3) In cytology and protection test (4) is in TNF α mediates lethal C57BL/6 mouse models, the protection of full people's anti-TNF alpha antibodies Effect is identical and more preferable with adalimumab.

After the amino acid sequence of antibody of the present invention is determined, the polynucleotides of the artificial synthesized coding antibody can be passed through And choose suitable host and effectively express to prepare the antibody, this is well known in the present art.

Unless stated otherwise, " Humira ", " Adalimumab " and " adalimumab " is interchangeable herein.

Brief description of the drawings

Fig. 1：After the elutriation of affinity maturation storehouse, the ELISA detections that 3000 monoclonal ScFv antibody combine rhNFa are tied Fruit.From the recombinant phages antibody library of every round difference elutriation concentration, the tablet of monoclonal appropriate density, picking are selected 1000 to 3000 monoclonals are cultivated into 96 deep hole Bacteria Culture plates and induced expression, collect supernatant and carry out ELISA inspections (longitudinal axis is OD450nm absorbances for survey；Transverse axis is the sample number of detection supernatant)；

Fig. 2：The full Human monoclonal antibodies of H3L4 are directed to the affinity measurement result (SPR technique) of monomer rhTNF α；

Fig. 3：The full Human monoclonal antibodies of H3L5 are directed to the affinity measurement result (SPR technique) of monomer rhTNF α；

Fig. 4：Full people source H3L4 monoclonal antibodies and adalimumab suppress the MCF-7 cytotoxicity tests of TNF α induction；H3L4 monoclonal antibodies IC50 be 0.45ng/ml, the IC50 of adalimumab is 8ng/ml；

Fig. 5：Pharmacological effect testing program in the animal body of full people source H3L4 monoclonal antibodies and adalimumab.

Fig. 6：The system signal transduction pathway of TNF and acceptor^[4]。

Fig. 7：A series of biologicallies that TNF-α antibody produces after being combined with cell membrane surface TNF-α.

Embodiment

Hereafter the present invention will be illustrated by specific embodiment, it will be appreciated that, following embodiments are not intended to limit this The scope of invention.

Embodiment

Embodiment 1：The preparation of hybridoma and carrier

1.The preparation of antigen and lymphocyte and immune

1.1 antigen TNF α albumen prepare

The TNF α albumen (medicine target) of people and TNF α (medicine target) albumen of monkey purchase white justice and stick up Divine Land, after being diluted with PBS, with 0.22 It is sub-packed in after the filtering of μm pin type sterile filters in 1.5ml cell cryopreservation tubes in -80 DEG C of preservations.

1.2 human lymphocytes prepare

Sterile chronic tonsillitis flesh tissue sample of winning is (with the attached institute's ear-nose-throat department cooperation of Xuzhou Medical College, tonsillotome It is derived from the patient of Tonsillectomy operation, 10 patients, 5~10 years old age), isolated wherein with lymphocyte separation medium (GE) Lymphocyte, take 30 × 10⁶It is a；Aseptic aspiration people's fresh peripheral haemocyte, it is isolated with lymphocyte separation medium (GE) In lymphocyte, take 30 × 10⁶It is a.

1.3 lymphocytes in vitro are immunized

Lymphocytes culture medium formula is as follows.Contain in 1 liter of DMEM：20% hyclone, the 200 of 1% mMs it is left-handed Glutamic acid (Sigma, cat.#G2150), the 100 of 1% × nonessential amino acid (Sigma, cat.#M7145), the 100 of 1% × penicillin streptomycin mixed liquor (Sigma, cat.#P7539,10,000U/ml penicillin+10mg/ml streptomysins), 10 units/ Every milliliter of interleukin 6 (Boehringer Mannheim, cat.#1299972), 20 units/every milliliter of people's recombinant interleukin2 (R＆ D system, cat.#202-IL-050), 20 micrograms/every milliliter of pokeweed mitogen (PWM) (PWM) (Sigma, cat.# L8777), 1 nanograms/milliliter endotoxin-free CpG (customization synthesis), 1 OPI cell culture additives (Sigma, cat.# O5003)。

Mixed after the individual lymphocyte mixing of 16 of two kinds of sources in the RPMI-1640 culture mediums containing 20%FBS Close culture, lymphocyte final concentration of 5 × 10⁵A/ml, while it is thin to add in following step 2.1 the mouse peritoneal raising obtained Born of the same parents (final concentration of 1 × 10⁵A/ml), nonessential amino acid (final concentration of 1 μ g/ml), TNF α antigen (protein immunization：Final concentration For 1 μ g/ml), and be put in CO2gas incubator and co-culture 6-12 days (changes a fresh medium for 5-6 days).

2. the preparation of hybridoma

2.1 the preparation of feeder cells

In fusion the previous day, the neck that breaks is put to death BALB/c mouse and (is purchased from Beijing Vital River Experimental Animals Technology Co., Ltd. Buy), it is soaked in 75% alcohol 5 minutes, in super-clean bench, scissors abdominal cut skin is used under sterile working, exposes peritonaeum, uses The intraperitoneal 10ml HAT culture mediums of syringe injection (20%FBS, HAT1 ×, remaining is DMEM), pressure-vaccum, suctions out culture medium repeatedly It is put into 50ml centrifuge tubes, trypan blue cell count, adjustment cell concentration is 2 × 105/ml, adds 96 orifice plates, 100 μ l/ Hole, is put into CO2gas incubator overnight.This operation suitable for the experiment in need for using mouse peritoneal feeder cells.

2.2 myeloma cells prepare (Shanghai life science institute of the myeloma cell P3X63Ag8.653 Gou Bai Chinese Academy of Sciences Cell resource center)

Culture is to exponential phase, and 1000rpm, centrifuges 5 minutes, is suspended with the DMEM without FBS, and 1000rpm centrifuges 5 points Clock, flicks bottom, is suspended with the DMEM culture mediums without FBS, and trypan blue counts, cytoactive 95%.

2.3 cell electro' asions and HAT screenings

The lymphocyte after being co-cultured 6 days with TNF α antigen, trypan blue living cell counting are collected, 1300rpm centrifuges 5 points Clock, abandons supernatant, flicks bottom, is suspended with a small amount of DMEM culture mediums without FBS；It is fully mixed with same amount of myeloma cell It is even, mend DMEM culture mediums and centrifuged 5 minutes to 40ml, 2000rpm, abandon supernatant；

The sterile pronase solution of 2ml (CalBiochem, 53702) is added, after slight suspension cell is rolled into a ball, is acted on 2 minutes, Add 3-5ml FBS to terminate, add electro' asion solution and centrifuged 5 minutes to 40ml, 2000rpm, abandon supernatant；A small amount of electricity is added to melt Conjunction solution gently after suspension cell group, is added to 40ml, 2000rpm and is centrifuged 5 minutes, abandon supernatant；Bottom is flicked, adds electro' asion Solution, cell count, adjusts cell to 2 × 10⁶A/ml, is divided into 2ml/ pipes；Number of seconds according to 2ml volumes is set, and is started Electro' asion device (BTX)；After fusion, 1000rpm is centrifuged 5 minutes, abandons supernatant；After adding a small amount of HAT culture mediums suspension cell, add Enter the HAT culture mediums of appropriate volume, according to fusion when lymphocyte addition, 1 × 10⁶A/plate, feeding is completed before adding In 96 orifice plates for supporting cell, it is put into CO2gas incubator and is cultivated.

7 days after fusion, carry out 1/2 with HAT culture mediums and change liquid, 10 days after fusion, liquid is changed entirely with HAT culture mediums.

2.4 cell conditioned medium antigentic specificity ELISA are detected

Coating：It is a set of to be coated with for human TNF alpha albumen with double set ELISA method detection specific antibodies 12 days after fusion, it is a set of It is coated with for monkey TNF α albumen.4 DEG C of overnight wrapper sheets, concentration are the μ l/ holes of 500,000 cell membranes/50, and coating buffer is the 1% of PH8.3 BSAPBS。

Closing：Closed with after PBST board-washings 3 times with 10% skim milk powder PBS, when incubation at room temperature 1 is small.Then PBST is used Board-washing 3 times.

Sample-adding：50ul cell conditioned mediums are suctioned out into hole, 1: 1000 human serum of negative control (health adult's donation) is positive Compare as the wooden parenteral solution of 0.1ug/ml Ah Da.Be incubated at room temperature 2 it is small when after, with PBST board-washings 3 times.

Secondary antibody：Then time Goat anti-Human IgG HRP (the Goat Anti-Human IgG of peppery acid group peroxidase mark are added H＆L-HRP, article No.：Ab81202), 50 μ // hole, when incubation at room temperature 1 is small after, with PBST board-washings 3 times.

Colour developing：TMB develops the color, 50 μ l/ml TMB, is reacted after 10~15 minutes with 2M hydrochloric acid color development stopping.A₄₅₀Reading.

Choose positive hybridoma growth hole standard：People and monkey TNF α albumen coating ELISA are positive at the same time, and human serum Albumen coating ELISA respective apertures are negative, are antigentic specificity.

2.5 expand culture

After detecting for the first time, select positive hole to be extended to 4 96 hole plate cultures, spend 2 days, institute's reaming is detected, Determine positive hole, be extended to 24 holes.Treat that 24 hole cell length to bottom hole about 1/3, then carry out ELISA detections.The method is equally applicable In the detection of later stage antibody.

2.6 cell conditioned medium human antibodies quantitatively detect

It is still positive cell hole culture supernatant after ELISA again is identified that step 2.5, which is produced, is used The people Ig of BethylLaboratories quantitatively detects ELISA kit (article No. E88-104), and specific steps press kit explanation Book carries out.

2.7 relative affinities sort

Preparation of samples：Antibody to be compared：The antibody purification of concentration known, or by known institute after step 2.6 quantitatively detection Cells and supernatant containing antibody concentration, is diluted to 4~8 same concentrations (120nM, 40nM, 13.1nM, 4.4nM).Then press The step of described in 2.4, carries out ELISA detections.Since all samples are adjusted to same antibody concentration in advance, the difference of OD values will Caused by the affinity of antibody.OD values are higher, and relative affinity is higher.Map and calculate using Prism softwares and is relatively each The affinity of antibody.Integrated embodiment 3~5 and this inspection result, select antigen affinity and highest 10 of function assessment efficiency Cell growth hole, i.e., 1.1,1.5,1.6,1.6,1.24,2.2,2.39,3.85,3.12,3.37.

2.8 limiting dilution assays subclone, cell expansion culture

In subclone the previous day either same day collection mouse peritoneal feeder cells (using HT culture mediums), cell concentration 1 ×10⁵A/ml, adds 96 orifice plates, 100ul/ holes.To through step 2.7 detection after screen 1.1,1.5,1.6,1.6,1.24, 2.2nd, after 2.39,3.85,3.12,3.37 positive hybridoma cell strains carry out Trypan Blue counting respectively, cell is pressed respectively Following concentration is taped against in plank, and density is 5/hole, spreads 1 piece；1/hole, spread 1 piece；0.5/hole, spread 2 pieces.It is put into titanium dioxide Carried out in carbon incubator culture 5-7 days after, through inverted microscope from bottom hole cell, confirm as monoclonal with marking pen circle Hole.Only shift the cells and supernatant in these monoclonal holes, 50 microlitres, per hole, carry out ELISA detections (see 2.4 methods). In the hole that antigen positive is determined through ELISA, according to cell state and OD values, from be subcloned every hybridoma cell strain (1.1, 1.5th, 1.6,1.6,1.24,2.2,2.39,3.85,3.12,3.37) in choose the supernatant in 3-5 best monoclonal cell hole Carry out the identification of lower step (2.9).

The identification of 2.9 subclass

Tablet is coated with 2 μ g/ml goat anti-human iggs (Fc), 4 DEG C overnight, then are closed with BSA, add cell conditioned medium to be measured, and 37 When incubation 2 is small at DEG C, enzyme mark subclass secondary antibody IgG1, IgG2, IgG3, IgG4, κ, λ (Southem are then added Biotechnology), develop the color, A₄₅₀Reading, judges the subclass of surveyed cell line as IgG2, κ.Often walked before liquid feeding and all use PBST Washing 3 times.In the 3-5 monoclonal cell hole filtered out from the every hybridoma cell strain being subcloned by step 2.8, select One monoclonal cell strain for being determined as IgG2- κ, it is respectively：1.1.71、1.5.58、1.6.17、1.24.2、2.2.108、 2.39.45、3.85.3、3.4.32、3.12.78、3.76.109.This 10 monoclonal cell strains are extended to 24 holes (with containing The DMEM culture mediums of 20%FBS), treat that cell is grown, after detection, be extended to square vase.

2.10 cell cryopreservation

Frozen stock solution is prepared：10%DMSO, 60%FBS, 30%DMEM, are put in precooling on ice, cell blow it is outstanding after, be put into centrifugation Guan Zhong, trypan blue count, and centrifugation, abandons supernatant, precooling frozen stock solution are added, by 2~5 × 10⁶A/pipe, is frozen.Cell is put into Program temperature reduction box (Nalgene) is placed on -70 DEG C of refrigerator overnights, is transferred in liquid nitrogen within second day.

2.11 sequencings, clone's monoclonal human hybridization tumor gene

After hybridoma is subcloned, filter out keep antigentic specificity monoclonal cell strain 1.1.71,1.5.58, 1.6.17、1.24.2、2.2.108、2.39.45、3.85.3、3.4.32、3.12.78、3.76.109.It is sequenced and is divided immediately Son clone, antibody gene enter appropriate expression vector, and by plasmid DNA amplification, purifying, in -80 DEG C of persistences.

Embodiment 2：Monoclonal antibody prepares and identification

1.Antibody is prepared using extracorporeal culture-ing

By the 1.1.71,1.5.58 grown in the DMEM culture mediums containing 15% hyclone, 1.6.17,1.24.2, 2.2.108,2.39.45,3.85.3,3.4.32,3.12.78,3.76.109 cell, gradually reduce serum to serum-free either (Invitrogen, 12338-026) is comprised only in the serum free medium of a small amount of serum, is put into 225cm²Square vase, by inoculation 1 × 10⁵The cell concentration of a/ml, is inoculated with 100ml, respectively 4 bottles of the inoculation of every plant of cell.

2.Antibody purification

Take out in 225cm²The flask culture cell conditioned medium of 10 days or so, centrifugation, removes cell fragment, passes through RProteinA affinity chromatographys carry out antibody purification.The cells and supernatant of pH7.4 direct loading after 0.22 μm is considered membrane filtration, 10 times of bed volume is then washed with pH7.4PBS streams, then is eluted with pH3.0 glycine solutions, every section of 0.5ml collects eluent. Read every section of OD₂₈₀, by each section of mixing containing antibody.OD is detected again₂₈₀, by 1.58OD=1mg calculating antibody concentration.By collection Preservation in sterile condition after the filter of 0.22 μm of antibody-solutions filtering.Antibody purification purity is verified with SDS-PAGE glue.It is true to carry out LAL tests Determine endotoxin-free pollution (Genscript, Cat：L00350), this antibody purification is used for affinity experiment (embodiment 4), cell Pharmacological effect experiment (embodiment 6) in function test (embodiment 5), animal body.Based on to TNF α affinity and thin to TNF α Born of the same parents' poison inhibitory activity is tested, and 3.12.78 is chosen to be template monoclonal antibody and carries out affinity maturation (to its CDR1/CDR2/CDR3 improvement And optimization).

3. embodiment 3：Affinity maturation

In order to improve the affinity of the antibody, the single-chain antibody scFv built is used as template, carries out random mutation, and The single-chain antibody of mutation is subjected to phage display, then screens to obtain the antibody of more high-affinity by ELISA.

3.1 the heavy chain and light chain of Anti-TNF α is sequenced

After immune, fusion and monoclonal, anti-TNF alpha list is chosen based on affinity and cell function experimental result Clonal antibody cell line does affinity matured antibody experiment for template.

The sequence analysis of antibody gene heavy chain and light chain.The total serum IgE of anti-TNF alpha Monoclonal Antibody Cell uses Invitrogen companiesReagent kits (15596-026) are extracted；Then using Takara companies Random primer in 5'RACE FULL kits (D315), using total serum IgE as template, reverse transcription is the first chain eDNA, and according to examination The specification operating procedure of agent box, connector is added at 5 ' ends；Then use kit leukorrhea adapter-primer, respectively with people's heavy chain base Because IgG2 constant regions special primer and light chain gene κ chain constant region specific primers (see below) are expanded together, resisted The heavy chain variable region and light chain variable region of TNF α monoclonal antibody gene.Heavy chain and light chain special primer for PCR amplification are：

IgG2 reverse primers：GCGCCTGAGTTCCACGACAC

κ chain reverse primers：CACAACAGAGGCAGTTCCAG

Pcr amplification product is cloned into carrier T (Takara, D101A), and is sequenced, sequencing obtains consistent heavy chain Variable region VH and light chain variable region VL (referred to herein as " source life type " VH and VL).

The structure of 3.2 source life type scFv antibody and and establish ELISA detection method using source life type scFv antibody as sample

Sequencing result in 3.1, designs heavy chain variable region and light chain variable region specific primer, and respectively in heavy chain Variable region 5 ' is held and 3 ' ends add SfiI sites and XhoI sites, and the end of light chain variable region 5 ' and 3 ' ends add NheI sites and NotI Site, heavy chain variable region (VH) and light chain variable region (VL) specificity amplification primer are as follows：

VH forward primers：ACTCGCGGCCCAGCCGGCCATGGCC GAGGTGCAGCTGGTGCAGTC

VH reverse primers：CCACCACTCGAGGC GCTCGAGACGGTGACCAGGGT

VL forward primers：TGGCGGGTCGACG GATATTGTGATGACCCAGACT

VL reverse primers：TGTTCTGCGGCCGC TTTGATCTCCACCTTGGTC

Cloned respectively with right-on source life type VH and VL as template, PCR amplification heavy chain variable region and light chain variable region Afterwards, digestion, is cloned into Vector for Phage Display pFL249 (gene chemical synthesis structure) step by step, carries out sequence verification.

Correct Cloning Transformation is sequenced into TG1 competent cells (Stratagene, 200123) in selection, picking monoclonal Cultivated, induced, collect supernatant, ELISA detections are carried out by antigen of TNF α albumen.

Structure, screening and the sequencing analysis of 3.3 random mutation scFv antibody libraries

Using the GeneMorph II Random Mutagenesis kits (200550) of Stratagene companies, with VH forward primers and VL reverse primers carry out fallibility PCR amplification, and the PCR product expanded is purified, digestion, is connected to On pFL249 carriers, then electricity is transformed into TGI competent cells, complete by adding helper phage M13K07 recovery bacteriophages Whole function production random mutation recombinant phages antibody library.Respectively with 1000 nanograms/milliliters, 100 nanograms/milliliters, 10 nanograms/ Milliliter, the huamn tumor necrosis factory alpha albumen coating of 1 nanograms/milliliter carry out more wheel progressively successive elutriations.And to each different elutriations The enriched library bed board for stepping up affinity after concentration elutriation is retained and clone.Bitten from the restructuring of every round difference elutriation concentration In phage antibody library, 1000 to 3000 monoclonals of picking are to 96 deep hole Bacteria Culture plates on the tablet of monoclonal appropriate density Cultivated and induced expression, collection supernatant carry out ELISA detections (enumerate ELISA testing results and see Fig. 1), given birth in OD values than source In the high monoclonal of type positive control, 200 monoclonals are selected to be sequenced from high to low according to OD values.Analyze sequencing result, After the inhuman source clone for removing FR region mutations, according to OD values, from high to low, the VH and VL of 20 mutation is selected to be used to build respectively Full length antibody.

3.4 structure full length antibodies and affinity sequence

3.4.1 before basis as a result, design heavy chain variable region and light chain variable region specific primer, and respectively in heavy chain Variable region 5 ' is held and 3 ' ends add SfiI sites and SalI sites, the end of light chain variable region 5 ' and 3 ' ends plus SfiI sites with BsiwI sites, heavy chain variable region and light chain variable zone amplication primer are as follows：

VH forward primers 1：TGGCAGCGGCCACAGGGGCCCACTCC GAGGTGCAGCTGGTGCAGTC

VH reverse primers 1：GCCCTTGGTCGACGC GCTCGAGACGGTGACCAGGGT

VL forward primers 1：TGGCAGCGGCCACAGGGGCCCACTCC GATATTGTGATGACCCAGACT

VL reverse primers 1：AGCCACCGTACG TTTGATCTCCACCTTGGTC

Cloned respectively with the VH and VL of source life type, and 20 VH and 20 VL clones after mutation are template, PCR amplification After heavy chain variable region and light chain variable region, digestion, the κ constant regions pCI for being cloned into the IgG2 constant regions containing someone and people respectively is carried On body (Promega, E1731), and carry out sequence verification.

3.4.2 20 total length heavy chains after mutation are combined with the full-length light chains of source life type respectively, by 20 after mutation The heavy chain combinations of full-length light chains and source life type, will totally 40 kinds of combinations using FreeStyle MAX transfection systems (Invitrogen, 16447-100) cotransfection is into CHO-S cells, 37 DEG C, 8%CO₂After culture 6 days, supernatant is collected by centrifugation.

Antibody concentration in 40 antibody supernatants is carried out by 2.6 step methods in previous embodiment 1 to quantify, then by foregoing reality Apply 2.7 step methods in example 1 and carry out relative affinity sequence.5 affinity are selected respectively according to relative affinity ranking results Highest heavy chain is named as H1, H2, H3, H4, H5 and 5 affinity highest light chain L1, L2, L3, L4, L5.

3.4.3 5 heavy chain mutants and 5 light chain mutants previous step screened are mutually combined, and are made into 25 entirely Long mutant antibodies：HIL1, H1L2, H1L3, H1L4, H1L5, H2L1, H2L2, H2L3, H2L4, H2L5, H3L1, H3L1, H3L2, H3L3, H3L4, H3L5, H4L1, H4L2, H4L3, H4L4H4L5, H5L1, H5L2, H5L3, H5L4, H5L5.By their heavy and light chains Cotransfection, culture, collect supernatant, and ProteinA purifying, reuses SPR technique and carry out affinity measure by ProteOn.

4 affinity of embodiment is tested

Affinity test is carried out by ProtOn code tests Operating Guideline.Select and cure test antibodies with chip, flowing through Monomer huamn tumor necrosis factory alpha protein pattern.Antibody can be supernatant or purifying protein.Specifically, by 4mM1- (3- diformazans Aminopropyl) -3- ethyl-carbodiimide hydrochlorides and 1mM hydroxy thiosuccinimides (Bio-Rad) mixing after inject immediately Continue 60 seconds to activate chip, it is 20 μ g/ml's that injection, which is dissolved in 10mM10mM acetic acid to receive concentration in (pH5.0) solution, immediately after Monoclonal antibody (such as H3L4 or H3L5), continues 240 seconds by 30 mul/min of speed.Inactivated with 1M hydrochlorics isobutyl ester.By chip Be rotated by 90 °, rinsed with running buffer to baseline stability, five various concentrations monomer rhTNF α of parallel injection (44,22, 11st, 5.5 and 2.75nM) and running buffer, respectively enter 6 respective rails of chip.Held with reference to being mutually 100 mul/min It is 200 seconds continuous, dissociation 600 seconds；

The result is shown in Fig. 2, Fig. 3 and table 1 below.Curve in Fig. 2 and Fig. 3 for various concentrations monomer rhTNF α and is solidificated in chip On antibody H3L4 and H3L5 combination-dissociation curve, calculated by 1: 1 binding pattern, the full Human monoclonal antibodies of H3L4 are directed to monomer rhTNF The affinity of α is 3.6pM, and the full Human monoclonal antibodies of H3L5 are 20.6pM for the affinity of monomer rhTNF α.The results show that at 25 In new wound antibody, there are 20 H/L combinations (i.e. 1-2,5, No. 9-25) higher than the affinity of A Damu.4 (i.e. 3,4,6,8) and Ah It is similar up to wood.1 (7) are lower than Ah 's wood.Wherein, the affinity of antibody of H3L4 monoclonal antibodies is 50 times about stronger than Ah 's wood.

125, table newly creates full Human monoclonal antibody and adalimumab and is directed to monomer human TNF alpha affinity

Numbering	Sample ID	KD(M)
			1	H1L1	8.90E-11
2	H1L2	7.90E-11
			3	H1L3	2.40E-10
4	H1L4	2.30E-10
			5	H1L5	2.30E-11
6	H2L1	3.30E-10
			5	H2L2	7.40E-10
S	H2L3	2.60E-10
			9	H2L4	9.50E-11
10	H2L5	2.50E-11
			11	H3L1	5.70E-11
12	H3L2	8.20E-12
			13	H3L3	3.80E-11
14	H3L4	3.60E-12
			15	H3L5	2.06E-11
16	H4L1	1.70E-11
			17	H4L2	3.50E-11
1S	H4L3	3.80E-11
			19	H4L4	3.00E-11
20	H4L5	3.10E-11
			21	H5L1	2.10E-11
22	H5L2	4.40E-11
			23	H5L3	9.30E-12
24	H5L4	2.50E-11
			25	H5L5	4.90E-11
	Humira	1.50E-10

Embodiment 5：Cytology function test

5.1 antibody neutralizations detect

TNF-α is combined meeting stimulus signal path with acceptor, causes inflammation, meronecrosis etc. by a series of cascade reaction Effect.When endocrine gets muddled, TNF-α also can largely assemble in the normal tissue, and normal tissue damages, so as to draw Play the diseases such as rheumatoid arthritis.Monoclonal antibody drug specific can be combined and block its phase with acceptor with TNF-α Interaction, so as to suppress the lethal effect of TNF-α normal tissue, achievees the purpose that control and relief of symptoms sign.For The In vitro biological activity detection method of WBP112 monoclonal antibody drugs is designed and is opened based on the mechanism of action (MOA) Hair.

In the presence of actinomycin D (ActD), rhTNF- α and l cell L929 surface TNF-α by Body interaction can cause rapid dissociation, the death of cell.Anti-TNF alpha monoclonal antibody drug specific can be tied with rhTNF- α Close, block its interaction with acceptor, neutralize cytotoxic effects of the rhTNF- α to L929 cells.By investigating medicine pair The neutralization inhibitory action of rhTNF- α cytotoxicities detects its biological activity.

The neutralization activity testing result of foregoing 25 antibody and adalimumab is shown in Table 2.The biological activity of H3L5 is about 3.5 times of Ah 's wood, the biological activity of H3L4, H3L2 are about 2.4 times of Ah 's wood.The ammonia of the variable region (VH3) of heavy chain H3 Base acid sequence is Seq ID No.1；The amino acid sequence of the variable region (VL5, VL4, VL2) of light chain L5, L4, L2 is respectively Seq Amino acid sequence table (is referred to) in ID No.2,3,4.In appended sequence table, the amino acid sequence with underscore represents corresponding sequence Each CDR of row.

225, table newly creates the neutralization activity testing result of full Human monoclonal antibody and adalimumab

Numbering	ID	Activity
			1	H1L1	181%
2	H1L2	Neutralization activity is less than Humira
			3	H1L3	Neutralization activity is less than Humira
4	H1L4	Neutralization activity is less than Humira
			5	H1L5	Neutralization activity is less than Humira
6	H2L1	Neutralization activity is less than Humira
			7	H2L2	Neutralization activity is less than Humira
8	H2L3	Neutralization activity is less than Humira
			9	H2L4	Neutralization activity is less than Humira
10	H2L5	Neutralization activity is less than Humira
			11	H3L1	137%
12	H3L2	235%
			13	H3L3	Neutralization activity is less than Humira
14	H3L4	239%
			15	H3L5	349%
16	H4L1	Neutralization activity is less than Humira
			17	H4L2	Neutralization activity is less than Humira
18	H4L3	Neutralization activity is less than Humira
			19	H4L4	148%
20	H4L5	Neutralization activity is less than Humira
			21	H5L1	Neutralization activity is less than Humira
22	H5L2	Neutralization activity is less than Humira
			3	H5L3	Neutralization activity is less than Humira
24	H5L4	Neutralization activity is less than Humira
			25	H5L5	Neutralization activity is less than Humira
26	Humira	100%

5.2H3L4 suppresses cancer cell (MCF-7) apoptosis caused by TNF α

Under certain condition, human TNF alpha and cancer cell (MCF-7) are incubated altogether, TNF α can induce about 40% cancer cell (MCF-7) apoptosis.

Fig. 4 shows that H3L4 and adalimumab, can inhibit cancer cell caused by TNF α (MCF-7) apoptosis, with dosage Increase, inhibitory action gradually strengthens, until Apoptosis caused by complete inhibition TNF α.Apoptosis effect caused by TNF α is dropped As low as the required dose of half (art claims IC50, half-inhibition concentration) is the common finger for pharmacologically comparing different pharmaceutical drug effect Mark, this is test result indicates that the IC50 of H3L4 monoclonal antibodies is 0.45ng/ml；Adalimumab IC50 is 8ng/ml, H3L4 monoclonal antibodies IC50 is about 18 times stronger than adalimumab.

The protection test of the full people source H3L4 monoclonal antibodies of embodiment 6 and adalimumab to the TNFa mouse lethals mediated

Known cancer necrosin ＆ and galactolipin Portugal amine (D-GaIN) co-injection, can cause dead mouse.Anti-TNF alpha list It is anti-to suppress this pathologic process, save the death of experimental animal.

This experiment is purchased from Shanghai Slac Experimental Animal Co., Ltd. using C57BL/6 mouse, and experimental design is shown in Table 3 and figure 5.Result of the test is shown in Table 4.In the case of being received g/kg the result is shown in identical dosage 15, H3L4 protection test mouse are from dead 4 times more upright than Ah Da of the effect of dying.

The protection test design of the full people source H3L4 monoclonal antibodies of table 3. and adalimumab to the TNFa mouse lethals mediated

Animal：C57BL/6 mouse, female, 18-20 grams

Test material：Human tumour necrosis factor (Invitrogen, PHC3013), D- galactolipins Portugal amine (SIGMA- G1639), adalimumab parenteral solution (Abbott Laboratories), H3L4 monoclonal antibodies (present invention).

Packet, method of administration and dosage：

The protection test design of the full people source H3L4 monoclonal antibodies of table 4. and adalimumab to the TNFa mouse lethals mediated

The beneficial effect that the present invention is brought

The present invention is exactly the new antibodies molecule for the initiative of TNF α medicine target：1) it has than similar drugs currently on the market Humira has the effect of more preferable；2) the original recruit's new drug of China, 3) can be with lower price and more preferable curative treatment With benefit rheumatic arthritis, rheumatoid arthritis, systemic loupus erythematosus, backbone sclerosis, interim colitis, ulcer Property colitis and anaphylactia；4) potentially possible treatment type i diabetes, obesity/hypertension/hyperlipidemia and some cancers.

Bibliography：

[1] Tracey D, Klareskog L, Sasso EH, etc. Tumor necrosis factor antagonist mechanisms ofaction：A comprehensive review [J] .Pharmacol Ther, 2008,117：244- 279.

[2] Jawaheer D, Seldin MF, Amos CI, etc. A genomenide screen in multiplex rheumatoid arthritis families suggests genetic overlap with other autoimmune Diseases [J] .Am J HumGenet, 2001,68 (4)：927-936.

[3] Bradley JR.TNF-mediated in flammatory disease [J] .J Pathol, 2008, 214：149-160.

[4] Paul AT, Gohil VM, Bhutani KK.Modulating TNF-α signaling with natural Products.Drug Discov Today, 2006,11 (15/16)：725-732.

[5] Clark J, Vagenas P, Panesar M.What does tumour necrosis factor excess do to the inmmune system long termAnn Rheum Dis, 2005,64 (Suppl4)：iv70- iv76.

[6] Chen PTC, Xu XG, Liu XS, etc. Characterisation of monoclonal antibodies T α the TNF and TNF receptor families.Cell Immunol, 2005,236 (1-2)：78-85.

[7] Shen C, etc. Adalimumab induces apoptosis of human monocytes：a comparative study with in fliximab and etanerceptAliment Pharmacol Ther2005； 21：251-258.

[8] Tian Wenzhi, Zhu Zhenping, antibody drug present situation and development trend.Biological industry technology, in May, 2013 number, p7- 21。

[9] Xie Yuting, Wang Niansong, application of the adalimumab in treating rheumatoid arthritis.World's clinical medicine, The 2nd phases of volume 33 in 2012, p65.

[10] graceful, Wang Qianqiu, the progress of adalimumab therapy psoriasis are worn.International skin cypridology magazine, In September, 2011 the 5th phase of volume 37, p275-278.

[11] Rajakulendran S, Deighton C.Adverse dermatological reactions in Rheumatoid arthritis patients treated with etanercept, an anti-TNF alpha drug [J] .Curr Drug Saf, 2006,1 (3)：259-264.

[12] Gao G H, Li J, Xie H W, etc. Therapeutic effect of inflimab on Moderate and severe active rheumatoid arthritis [J] .Nan Fang tell Ke Da Xue Xue Bao.2010,30 (4)：724-726.

[13]Briggs G G. Drug effiects on the fetus and breast-fed infant[J] .Clin Obsiet Gynecd, 2002,45 (1)：6-21.

[14] Roux C H, Brocq O, Breuil V C, etc. Pregnancy in rheumatology patients Exposed to anti-tumour necrosis factor (TNF)-α therapy [J] .Rheumatology, 2007,46 (4)：695-698.

[15] McCluggage L K, Scholtz J M.Golimumab：a tumor necrosis factor Alpha inhibitor for the treatment ofrheumatoid arthritis [J] .Ann Pharmacother, 2010,44 (1)：135-144.

[16] Nesbitt A, etc. Mechanism of action of certolizumab pegol (CDP870)：in vitro comparison with other anti-tumor necrosisfactorαagents[J].Inflamm Bowel Dis, 2007,13：1323-1332.

[17] Dall ' Acqua, W.F., Damschroder, M.M., Zhang, J., Woods, R.M., Widjaja, L. Deng (2005) Antibody humanization byframework shuffling.Methods.36,43-60.

[18] Sang Jick Kim, YoungWoo Park, and Hyo Jeong Hong. (2005) Antibody Engineeringfor the Development ofTherapeutic Antibodies.Mol.Cells, Vol.20, No.1, pp.17-29.

[19] Hwang, WY. K., Almagro, J.C., Buss, T.N., Tan, p., and Foote, J. (2005) Use ofhuman germline gennes in a CDR homologybased approach to antibody Humanization.Methods36,35-42.

[20] Hwang, W.Y. K. and Foote, J. (2005) Immunogenicity of engineered Antibodies.Methods36,3-10.

[21] Brtggemann, M. and Taussig, M.J. (1997) Production of human antibody Repertoires in transgenic mice.Curm.Opin.BiotechnoI.8,455-458.

[22] Griffiths, A.D. and Duncan, A.R. (1998) Strategies for selection Ofantibodies by phage display.Curr.Opin.Biotechnol.9,102-108.

[23] Manzurul A.Sikder and Jonathan W.Friedberg.Beyond rituximab：The Future of monoclonal antibodies in B-cell non-Hodgkin lymphoma, Current Oncology Reports, roll up the 10, the 5th phase, 420-426

[24] Chowdhury, P.S. (2003) Engineering hot spots for affinity Enhancement of antibodies.Methods Mol.Biol.2007,179-196.

[25] KyurkchieV, S.D., Shigeta, M., Koyama K. and Isojima, S..A human-mouse hybridoma producing monoclonal antibody against human sperm coating antigen.Immunology198657489-492

[26] Babcook, J.S., Leslie, K.B., Olsen, O.A., Salmon, R.A., and Schrader, J.W.A Novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of dehned Specofocities.Proc.Natl.Acad.Sci.USA Vol.93, PP.7843-7848, July1996.

Claims (12)

1. A kind of 1. human antibody, it is characterised in that：

   The amino acid sequence of the CDR1 of the heavy chain variable region of the antibody is GFTFSSYDMH, and the amino acid sequence of CDR2 is The amino acid sequence of VIWSDGSIKYYADSVKG, CDR3 are EVESAMGGFYYNGMDV；And

   The complementary determining region of the light chain variable region of the antibody be selected from it is following 1), 2) or 3)：

   1) CDR1 is that RASQDIGFDLG, CDR2 AASSLQS, and CDR3 are LQHKSYPLT；

   2) CDR1 is that RASQSIGFDLG, CDR2 AASSSQS, and CDR3 are LQHRSYPLT；

   3) CDR1 is that RASQDIGFDLG, CDR2 AASTLPR, and CDR3 are LQHKSYPLT.
2. 2. antibody as claimed in claim 1, wherein, the amino acid sequence of the heavy chain variable region of the antibody is SEQ ID NO: 1。
3. 3. antibody as claimed in claim 1 or 2, the amino acid sequence of the light chain variable region of the antibody is selected from SEQ ID NO: 2、SEQ ID NO:3 or SEQ ID NO:4.
4. 4. a kind of antibody fragment of anti-TNF alpha, the antibody fragment includes antibody according to any one of claims 1 to 3 extremely A kind of few heavy chain variable region and at least one light chain variable region.
5. 5. antibody fragment as claimed in claim 4, the antibody fragment is Fab or F (ab ')₂。
6. 6. a kind of scFv molecules of anti-TNF alpha, the scFv includes at least the one of antibody according to any one of claims 1 to 3 Kind heavy chain variable region and at least one light chain variable region.
7. 7. a kind of polynucleotides, the heavy chain of the antibody any one of the polynucleotide encoding claim 1~3 and light The scFv molecules described in antibody fragment or claim 6 described in chain, claim 4 or 5.
8. 8. a kind of carrier, the polynucleotides described in claim 7 are included in the carrier.
9. 9. a kind of conjugate of anti-TNF alpha, the conjugate is included to be covalently attached with isotope, immunotoxin and/or chemicals Antibody according to any one of claims 1 to 3 or claim 4 or 5 described in antibody fragment or claim 6 described in ScFv molecules.
10. 10. a kind of conjugate, the conjugate is by 4 or 5 institute of antibody according to any one of claims 1 to 3 or claim The conjugate described in scFv molecules or claim 9 described in the antibody fragment or claim 6 stated is with solid dielectric or partly solid Body medium is coupled and is formed.
11. 11. antibody fragment or claim 6 described in antibody according to any one of claims 1 to 3 or claim 4 or 5 The conjugate described in conjugate or claim 10 described in the scFv molecules or claim 9 is being prepared for treating one Application in the medicine of kind or a variety of following diseases：Rheumatic arthritis, rheumatoid arthritis, juvenile idiopathic arthritis, Psoriatic arthritis, Crohn's disease, ankylosing arthritis, psoriasis or ulcerative colitis.
12. 12. a kind of pharmaceutical composition, described pharmaceutical composition include it is following in one or more：It is any in claims 1 to 3 Antibody described in, the antibody fragment described in claim 4 or 5, the scFv molecules described in claim 6, described in claim 9 Conjugate, or the conjugate described in claim 10.