CN107446046A - Anti- CD20 protein monoclonal antibodies and application thereof - Google Patents

Abstract

The present invention relates to biological technical field, discloses a kind of hybridoma cell strain (deposit number is CGMCC No.13819), and thus monoclonal antibody UMAB58 caused by hybridoma cell strain.The invention further relates to monoclonal antibody UMAB58 to prepare the application in being used to detect the immune detection instrument of CD20 albumen, the immunohistochemical kit of the UMAB58 containing monoclonal antibody, and applications of the monoclonal antibody UMAB58 in the kit for marked tumor is prepared.Monoclonal antibody of the present invention can be combined with CD20 protein-specifics, and with other intracellular albumen no cross reactions, significantly improve specificity, accuracy and the reliability of the detection of CD20 protein immunizations.

Description

Anti- CD20 protein monoclonal antibodies and application thereof

Technical field

The present invention relates to biological technical field, and in particular to can specific bond CD20 albumen monoclonal antibody UMAB58, Produce the cell line and the diagnostic method of the application antibody and purposes of the monoclonal antibody.

Background technology

CD20 also known as MS4A1, it is nonglycosylated type III memebrane protein, belongs to MS4A tetratransmembrane albumen superfamily members. Mainly express in pre B cell, resting B cells, mature B cell and B lymphoma cells, and lost during plasma cell differentiation. CD20 intracellular region is serine/threonine rich in area and contains multiple phosphorylation consensus sequences, in the B cell and evil of activation CD20 is by hyperphosphorylation in property B tumour cells.CD20 is related to fat Bo structures, as calcium channel, participates in regulation B cell Activation and survival.

CD20 is as mature B cell and the surface marker of most of B malignant cells, and CD20 is not after antibody is contacted By internalization or it can come off so that antibody exists for a long time in cell surface.Immunohistochemistry (IHC) is clinically commonly used at present The expression situation of albumen in Pathological experiment detection tumour cell, but the core of IHC experiments is the Dan Ke of binding proteins specific Grand antibody, the quality of its performance directly decide the sensitivity and specificity entirely detected.Therefore, a kind of combine specifically is developed Property the higher monoclonal antibody for CD20 albumen have great importance to IHC detection CD20 expressions.

The content of the invention

In view of this, it is an object of the invention to provide a kind of monoclonal of the higher CD20 albumen of binding specificity to resist Body, and its preparing the application in being used to detect the immune detection instrument of CD20 albumen.

The invention provides a kind of hybridoma cell strain, it is commonly micro- to be preserved in China Committee for Culture Collection of Microorganisms Bio-Centers (referred to as CGMCC), preservation date is on April 6th, 2017, and deposit number is CGMCC No.13819.

It is thin by above-mentioned hybridoma present invention also offers a kind of monoclonal antibody UMAB58 of specific binding CD20 albumen Born of the same parents' strain produces.

The preparation method of monoclonal antibody of the present invention is as follows：

(1) structure of recombinant expression carrier：According to CD20ORF nucleotide sequences (CD20ORF nucleotide sequences such as SEQ ID Shown in NO.1,894bp；CD20 amino acid sequences are as shown in SEQ ID NO.2)

Primer PCR amplification CD20ORF 1bp positions are designed to introduce respectively in restricted to 894bp bit sequences, gene both sides Enzyme cutting site SgfI and MluI, expression vector pCMV6-Entry is inserted, structure CD20 amino acid sequences the 1st to the 297th Recombinant expression plasmid pCMV6-rCD20；Upstream amplification primer sequence, SEQ ID NO.3: CACGCGATCGCATGACAACACCCAGAAATTCA downstream amplification primer sequence SEQ ID NO.4: ACCGACGCGTAGGAGAGCTGTCATTTTCTATT

(2) expression and purification of CD20 recombinant proteins：By CD20 recombinant expression plasmids convert HEK293T cells, crack from The heart obtains supernatant, and DDK affinity columns purify, and obtain the CD20 recombinant proteins of purifying；

(3) screening and preparation of monoclonal antibody：Balb/c mouse are immunized using the CD20 recombinant proteins of above-mentioned purifying, taken Mouse spleen cells are merged with SP2/0 cells, and limiting dilution assay obtains monoclonal, and ELISA method screening positive hybridoma is thin Born of the same parents, the hybridoma cell strain that can secrete anti-CD20 specific antibodies is obtained, is named as UMAB58, hypotype is accredited as IgG1；Pass through Serum free medium prepares antibody, is purified by affinity column and obtains CD20 monoclonal antibodies UMAB58.Pass through respectively Western Blot, immunohistochemical experiment verify the sensitivity and specificity of the monoclonal antibody.

Further the specificity of said monoclonal antibody is verified using OriGene high-density proteins chip： On OriGene high-density protein chips lysate, every kind of protein lysate are overexpressed comprising 10,000 HEK293T cell protein There is the repetition of two copies on chip.Protein lysate is by trace on nitrocellulose filter.Each protein lysate Positioning can be accurately positioned by Excel file.Albumen is divided into 40 sub- matrixes on protein chip, on each sub- matrix There are some references, by referring to can quantify the content of albumen on each chip point, monitor the repetition of each immune response data Property, and the direction of positioning positive signal.

The monoclonal antibody UMAB58 and said chip are hybridized and determine positive signal site by the present invention, are as a result shown Monoclonal antibody UMAB58 of the present invention specifically binds CD20 albumen, and with other albumen no cross reactions.

Present invention also offers monoclonal antibody UMAB58 to prepare for detecting in the immune detection instrument of CD20 albumen Application.

Specifically, the immune detection instrument is kit, chip or test paper.

In the particular embodiment, the invention provides a kind of immunologic combined detection reagent kit, including above-mentioned monoclonal to resist Body UMAB58, it can detect the expression situation of CD20 in histocyte.

Present invention also offers application of the said monoclonal antibody in the kit for marked tumor is prepared.Wherein institute State tumour and specifically refer to the propagation of tumour cell and the CD20 closely related tumour of expression, including but not limited to B lymthomas.

Compared with prior art, the invention provides a kind of hybridoma cell strain (deposit number CGMCC No.13819), and thus monoclonal antibody UMAB58 caused by hybridoma cell strain.Present invention also offers monoclonal antibody UMAB58 is preparing the application in being used to detect the immune detection instrument of CD20 albumen, the immune group of the UMAB58 containing monoclonal antibody Change kit, and applications of the monoclonal antibody UMAB58 in the kit for marked tumor is prepared.List of the present invention Clonal antibody can be combined with CD20 protein-specifics, and with other intracellular albumen no cross reactions, significantly improve CD20 eggs Specificity, accuracy and the reliability of white immune detection, it is true to reflect CD20 protein expression levels in tumor infiltrating lymphocyte, It can be applied to the detection of the tumour immunity microenvironment such as lymthoma.

Preservation information

Classification And Nomenclature for the hybridoma cell strain UMAB58 of preservation is：The anti-human leukocyte differentiation antigen 20 (CD20) of mouse Monoclonal hybridoma strain；

Depositary institution's full name：China Committee for Culture Collection of Microorganisms's common micro-organisms center；

Depositary institution is referred to as：CGMCC；

Depositary institution address：Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica；

Preservation date：On April 6th, 2017；

Deposit number：CGMCC No.13819.

Brief description of the drawings

In order to illustrate more clearly about the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing There is the required accompanying drawing used in technology description to be briefly described.

Fig. 1 shows the design of the cloning site of embodiment 1 as schemed, and wherein shading part is ORF areas；

Fig. 2 shows the recombinant C D20 albumen Western blot testing result figures of embodiment 2, with anti-DDK detection recombinant Cs D20 Expression of the albumen in HEK293T cells, wherein the HEK293T cell pyrolysis liquids that left side swimming lane is transfection empty carrier are antigen Testing result, right lanes are the testing result of the HEK293T cell pyrolysis liquid antigens of transfection pCMV6-rCD20 plasmids；

Fig. 3 shows the recombinant C D20 protein SDS-PAGE result figures of embodiment 2, with anti-DDK affinity columns purification of Recombinant CD20 Albumen, albumen after purification pass through SDS-PAGE glue electricity arteries and veins, coomassie brilliant blue staining；

Fig. 4 shows that embodiment 3 identifies endogenous CD20 eggs in 10 kinds of different people's Tissue lysates with monoclonal antibody UMAB58 White Western blot testing result figures.From left to right it is followed successively by 1：Testis, 2：Nethike embrane, 3：Uterus, 4：Mammary gland, 5：Brain, 6： Liver, 7：Ovary, 8：Thyroid gland, 9：Colon, 10：Spleen.

Fig. 5 show the formalin of embodiment 4 fix, human tonsil's ImmunohistochemistryResults Results figure (primary antibody CD20 of FFPE Monoclonal antibody UMAB58)；

Fig. 6 show the formalin of embodiment 4 fix, human lymphoma ImmunohistochemistryResults Results figure (the primary antibody CD20 of FFPE Monoclonal antibody UMAB58)；

Fig. 7 shows that the formalin of embodiment 4 is fixed, (primary antibody is that CD20 is mono- to people's spleen ImmunohistochemistryResults Results figure of FFPE Clonal antibody UMAB58)；

Fig. 8 shows that (upper left corner is phalloidine to the human peripheral leukemia T cell immunofluorescence dyeing result figure of embodiment 5 The microfilament of phalloidin marks, upper right corner primary antibody are CD20 monoclonal antibody UMAB58, and the lower left corner contaminates for DAPI cores, the lower right corner For overlay chart)；

Fig. 9 show embodiment 6OriGene protein chip qualification results figure (primary antibody is CD20 monoclonal antibodies UMAB58,1:100；Secondary antibody For DyLight649-conjugated AffiniPure Fragment Goat-anti-Mouse IgG, 1:400).

Embodiment

Below in conjunction with the embodiment of the present invention, the technical scheme in the embodiment of the present invention is clearly and completely described, Obviously, described embodiment is only part of the embodiment of the present invention, rather than whole embodiments.Based in the present invention Embodiment, the every other embodiment that those of ordinary skill in the art are obtained under the premise of creative work is not made, all Belong to the scope of protection of the invention.

The structure of embodiment 1, CD20 recombinant expression plasmids

It is with the plasmid RC201242 (894bp containing CD20ORF) obtained from bio tech ltd of Aureal Dongyuan County of the U.S. Template, design two primers and introduce restriction enzyme site SgfI and MluI respectively, be cloned into expression vector pCMV6-Entry, establish CD20 recombinant expression plasmids.Cloning site design is as shown in Figure 1.

The expression and purification of embodiment 2, CD20 recombinant proteins

1st, HEK293T cells are transfected：HEK293T cells are with 1:3 reach and continue to cultivate in culture dish；Take 7.5mLDMEM (nothings Serum and antibiotic) into 50mL pipes, add 300 μ LPEI MegaTran1.0 and mix；Add 75 μ g CD20 recombination expression matter Grain DNA is mixed into mixing liquid and is stood 30 minutes；Take 515 μ L into each culture dish in 37 DEG C of 5%CO respectively₂In incubator Culture.After transfection 24 hours, 25 μ L2M sodium butyrates are added per ware cell to final concentration 5mM.

2nd, cell lysis：After transfection 48 hours, cell cracking is carried out.Culture medium is sucked, 1mLPBS is added and is rinsed, inhaled Remove PBS.1mL lysis buffers are added, use preceding addition protease inhibitors PI and PMSF.It is placed in ice chest and is shaken on shaking table Swing, collect and lysate is obtained in all culture dishes, 4 DEG C of centrifugations, collect supernatant.Take table of a small amount of supernatant using WB identification recombinant Cs D20 Reach, result figure 2.

3rd, DDK affinity columns purify：With 0.45 μM, the lysate supernatant after 33mm pvdf membrane filter filter centrifugations is simultaneously 15mL pipes are transferred to, the Beads 1mL mixed is added, is put into after sealing in 360 degree of vortex mixers, in 4 DEG C of combinations 2 hours；Take out 15mL is managed, and lysate is poured into BIO-RAD chromatographic columns, and is caught and penetrated liquid, and liquid sampling WB detections are penetrated after drop is most；With cracking Wash buffer post material 1-2 times, Beads is rinsed 3 times with TBST again after drop is most, washed after drop is most with 0.1M Glycine pH3.5 De-, 200 μ L, drop are not collected to the greatest extent, second and third each 500 μ L, the 4th 250 μ L, collected to a 1.5mL centrifuge tube for the first time In, and it is rapidly added NaH₂PO₄(pH=11.0) pH7.0 or so is neutralized to, often pipe addition glycerine to final concentration of 10%, Tween-80 to final concentration of 0.1%.Recombinant C D20 albumen after purification is identified with SDS-PAGE, sees Fig. 3.

From Fig. 2 results, in 30- after WB is detected in the HEK293T cell pyrolysis liquids of transfection pCMV6-rCD20 plasmids There is obvious specific band at 40kD, be consistent substantially with the theoretical molecular 33kD of polypeptide.Show recombinant C D20 albumen in cell Specifically expressing.

From Fig. 3 results, the albumen of purifying has obvious specific band at PAGE glue 30-40kD, the reason with polypeptide It is consistent substantially by molecular weight 33kD.Show to have obtained the preferable CD20 recombinant proteins of purity.

The preparation and screening of embodiment 3, CD20 monoclonal antibodies

To Balb/c mouse, (it is real that tonneau China is tieed up in Beijing to the CD20 protein fragments purified according to caused by standard method restructuring Test zoo technical Co., Ltd) it is immunized.Specific method is as follows：

1st, animal immune：Purified CD20 antigens are emulsified with complete Freund's adjuvant, using subcutaneous or intraperitoneal injection side 6-8 week old Balb/c mouse are immunized in method, and for 30 μ g/ only, interval carries out being immunized for second immunizing dose after two weeks, with not exclusively not Family name's adjuvant emulsion, immunizing dose are 30 μ g/.It is immune to take tail blood to determine serum titer with ELISA method gradient dilution afterwards twice；Root Determine whether booster immunization according to result, choose antibody titer highest mouse and carry out cell fusion.

2nd, cell fusion：Myeloma cell uses the sp2/0 in Balb/c sources, is in exponential phase during fusion；Take Immune mouse spleen, is made lymphocyte single cell suspension；Mouse spleen lymphocyte is with myeloma cell with 1:5-1:10 mixing, 37 DEG C 50%PEG (PH 8.0) 1mL is added dropwise, adds incomplete culture medium and remaining terminate liquid, centrifugation adds HAT after abandoning supernatant Culture medium, which suspends, to be mixed, and MC constant volumes to 50mL, is dispensed into 3.5cm culture dishes, is put in wet box, is placed in 37 DEG C, 5%CO₂It is permanent Cultivated in warm incubator.

3rd, screen and clone：Fusion selects cell clone in 7-10 days, and ELISA surveys are carried out using CD20 purification of recombinant proteins Examination.Mark cell line number.Limiting dilution is carried out to positive hole cell, determines ELISA values, picking within 5-6 days after each limiting dilution OD280 is positive to be worth higher monoclonal hole progress limiting dilution, until ELISA determines 96 orifice plates, hardened fruit is the positive entirely.Picking The positive is worth high monoclonal singling.Its corresponding fusion plate cell line is UMAB58.

4th, the preparation and purification of ascites monoclonal antibody：The male Balb/c mouse peritoneal injections 0.5ml norphytanes of 10-12 week old, Every mouse is injected intraperitoneally with 1mL syringes and wash the monoclonal cell suspension being resuspended through PBS after one week, cell dosage for 5 × 10⁶/ only, make a call to 2 mouse per strain antibody.Ascites, centrifuging and taking supernatant are collected after mouse ascites accumulation, affinity chromatography carries out abdomen Water purifies, and selects corresponding post material according to antibody subtype, monoclonal antibody caused by cell line UMAB58 is IgG1, is entered using protein G Row purifying.Monoclonal antibody concentration mensuration after purification, WB are detected, dispense, frozen at -20 DEG C.Wherein WB testing results are shown in Fig. 4.

From Fig. 4 results, swimming lane 9 and swimming lane 10 about have special band in molecular weight at 35kD, show that monoclonal resists Body UMAB58 specifically can detect complete CD20 albumen by Western blot.

Embodiment 4, the SABC that monoclonal antibody UMAB58 is primary antibody detect

(1), experimental method：

1st, human tonsil's tissue that formalin is fixed is taken, human lymphoma tissue carries out FFPE with people's spleen tissue, Cut into slices using Finesse histotomes, tissue thickness is 6 μm.

2nd, dewaxing and aquation：Analyze pure 3 × 10min of dimethylbenzene, absolute ethyl alcohol 3 × 10min, 95% ethanol 5min, 85% Ethanol 5min, 75% ethanol 5min, deionized water immersion 3min × 3 time.

3rd, add antigen retrieval buffers (0.01M, pH6.0 sodium citrate buffer) pressure cooker hot high pressure and repair 3min, treat height When pressure pot temperature is down to about 90 DEG C, pressure cooker is opened, sample is taken out, then naturally cools to room temperature.Deionized water soaks 3min × 3 times.

4th, using 3% hydrogen peroxide deactivation tissue endogenous peroxydase, it is stored at room temperature 10min.Deionized water is soaked 5min × 3 time.

5th, plus confining liquid (Normal Goat Serum of PBS+5% skimmed milk powers+5%), 37 DEG C of incubation 60min.

6th, confining liquid is removed, is not rinsed, adds CD20 monoclonal antibodies (UMAB58), thinner ratio：1:100, carried out using confining liquid Dilution.It is placed in wet box, 37 DEG C of incubation 60min.PBST (0.1%Tween-20) is washed 2 times, washs 5min every time.PBST (0.02%Tween-20) is washed 1 time, washs 5min every time.

7th, 1,37 DEG C of incubation 10-20 minutes of 2 (Catlog No.D37-15) reagent of Polink- kits are added dropwise.Use PBS Washing 3 times, each 5min.2,37 DEG C of incubation 10-20 minutes of Polink-2 kits (Catlog No.D37-15) reagent are added dropwise, Washed 3 times using PBS, each 5min.

8th, developed the color using DAB solution (Zhong Shan Golden Bridge ZLI-9019), develop the color 3~10min.Distill water washing.

9th, haematoxylin redyeing nucleus 2min, distilled water rinsing, the differentiation of 1% hydrochloric acid.Distilled water rinses 3 times, is stored at room temperature 1min。

10th, it is dehydrated and transparent：75% ethanol 5min, 100% ethanol 5min x 3 times, 85% ethanol 5min, 95% ethanol 5min, 100% 3 × 5min of ethanol；3 × 5min of dimethylbenzene, neutral gum mounting.

11st, microscopy, Fig. 5-7 is seen.

(2), experimental result：

From Fig. 5-7 results, organized in human tonsil, human lymphoma tissue and visible specificity in people's spleen tissue Film dyes.As a result it is consistent with CD20 positioning in the cell and tissue expression specificity, show that monoclonal antibody UMAB58 can be used In the level of Immunohistochemical detection CD20 albumen.

Embodiment 5, the Immunofluorescence test that monoclonal antibody UMAB58 is primary antibody

(1), experimental method：

1st, cell paving version：Take the human peripheral leukemia T cell of in vitro culture to tile into 24 orifice plates, place incubator training Support 24 hours.

2nd, culture medium is removed, washed once with the PBS of preheating, makes cell monolayer culture.

3rd, it is fixed：4% paraformaldehyde (PBS preparations) room temperature fixes 10 minutes.

4th, fixer is removed, PBS is washed 3 times.If not using at once, it is immersed in NaN3/PBS and is stored in 4 DEG C.

5th, penetrate：Punching 5 minutes is penetrated with 0.1%Triton-X-100 (PBS preparations) at room temperature, PBS is washed 3 times.

6th, plus confining liquid (PBS+2%BSA), 37 DEG C are incubated 60 minutes.

7th, CD20 monoclonal antibodies (UMAB58), thinner ratio are added：1:100, it is diluted using confining liquid, 37 DEG C are incubated 60 points Clock.PBS is washed 3 times.

8th, Alexa is addedAffiniPure Goat Anti-Mouse IgG (H+L), thinner ratio：1: 500, it is diluted using confining liquid, room temperature lucifuge is incubated 60 minutes.PBS is washed 3 times.

9th, Alexa is added594-Phalloidin (phalloidine) marks microfilament.

10th, DAPI (HH3342) redyes nucleus 3 minutes, microscopy.

As a result as shown in figure 8, in the visible specific membrane dyeing in human peripheral leukemia T cell surface, monoclonal is shown Antibody UMAB58 can be used for the level of Immunofluorescence test CD20 albumen.

The specific detection of embodiment 6, monoclonal antibody UMAB58

Lysate is overexpressed comprising 10,000 HEK293T cell protein on OriGene high-density protein chips, per hatching egg White lysate has the repetition of two copies on chip.Protein lysate is by trace on nitrocellulose filter.Each hatching egg The positioning of white lysate can be accurately positioned by Excel file.Albumen is divided into 40 sub- matrixes on protein chip, each There are some references on sub- matrix, by referring to can quantify the content of albumen on each chip point, monitor each immune response number According to repeatability, and positioning positive signal direction.It is to use OriGene albumen (OriGene Cat PA100001) below Chip carries out the experimental method of UMAB58 Identification of the antibodies experiments：

1st, a protein chip is placed in 50mL centrifuge tubes, infiltrates chip using 40mL deionized waters, be placed on shaking table, Mixed at room temperature 30 minutes.Deionized water is discarded, chip is balanced using 10mLPBST.Room temperature treatment 10 minutes.

2nd, add 40mL5% skim milks (being diluted with PBST) into 50mL centrifuge tubes to be placed on shaking table, room temperature envelope Close 30 minutes.

3rd, primary antibody UMAB58 is diluted using confining liquid (5% skim milk), thinner ratio is classified as 1:100.

4th, the sealed membrane by cleaning is pasted on experimental bench, and 250-300 μ L primary antibodies are added dropwise on sealed membrane.

5th, protein chip is extracted out from confining liquid, by the one of protein chip NC films down, contacted from one side of chip Antibody, slowly slide, by surface tension of liquid, antibody will slowly infiltrate chip NC films, until whole NC films infiltration is in primary antibody In solution.Whole operation process avoids producing bubble.Chip is moved on under 4 DEG C of environment, stood, primary antibody is incubated overnight.In chip Upper capping culture dish lid, sticks a hygenic towelette thereon, causes antibody to evaporate to prevent from being incubated for a long time.

6th, chip was moved in 50mL centrifuge tubes in second day, rinses chip twice using PBST, remove unnecessary antibody.Make Chip is washed with 40mL PBST (0.1%Tween-20), is placed on shaking table and is well mixed, washing three times, washs 5min every time.

7th, secondary antibody DyLight649-conjugated AffiniPure are diluted using confining liquid (5% skim milk) Fragment Goat-anti-Mouse IgG, dilution ratio 1:400.

8th, carry out secondary antibody according to above-mentioned steps 4, step 5 and be incubated operation.Incubation at room temperature 1 hour.Aluminium foil is used above chip Paper covers, to prevent signal bleaching.

9th, according to above-mentioned steps 6, chip is washed using PBST.

10th, using deionized water rinsing chip, to remove remaining salinity and denaturant.

11st, drying at room temperature chip, it is ensured that chip is completely dried.

12nd, fluorescence signal is read using chip scanner.

13rd, chip direction and the site of positive signal are determined according to BSA-Cy3 and BSA-Cy5.

14th, corresponding protein lysate ID is found out according to positive signal site, according to lysate database information, found pair Answer the information such as protein name, NCBI typings number (accession number), protein I D, albumen size.

As a result as shown in figure 9, monoclonal antibody UMAB58 can specifically identify CD20 albumen on OriGene protein chips, show Monoclonal antibody UMAB58 specificity is preferably.

SEQUENCE LISTING

<110>Wuxi Origene Bio-tech Co., Ltd.

<120>Anti- CD20 protein monoclonal antibodies and application thereof

<210> 1

<211>894

<212> DNA

<213>Artificial sequence

<400> 1

1 ATGACAACAC CCAGAAATTC AGTAAATGGG ACTTTCCCGG CAGAGCCAAT GAAAGGCCCT

61 ATTGCTATGC AATCTGGTCC AAAACCACTC TTCAGGAGGA TGTCTTCACT GGTGGGCCCC

121 ACGCAAAGCT TCTTCATGAG GGAATCTAAG ACTTTGGGGG CTGTCCAGAT TATGAATGGG

181 CTCTTCCACA TTGCCCTGGG GGGTCTTCTG ATGATCCCAG CAGGGATCTA TGCACCCATC

241 TGTGTGACTG TGTGGTACCC TCTCTGGGGA GGCATTATGT ATATTATTTC CGGATCACTC

301 CTGGCAGCAA CGGAGAAAAA CTCCAGGAAG TGTTTGGTCA AAGGAAAAAT GATAATGAAT

361 TCATTGAGCC TCTTTGCTGC CATTTCTGGA ATGATTCTTT CAATCATGGA CATACTTAAT

421 ATTAAAATTT CCCATTTTTT AAAAATGGAG AGTCTGAATT TTATTAGAGC TCACACACCA

481 TATATTAACA TATACAACTG TGAACCAGCT AATCCCTCTG AGAAAAACTC CCCATCTACC

541 CAATACTGTT ACAGCATACA ATCTCTGTTC TTGGGCATTT TGTCAGTGAT GCTGATCTTT

601 GCCTTCTTCC AGGAACTTGT AATAGCTGGC ATCGTTGAGA ATGAATGGAA AAGAACGTGC

661 TCCAGACCCA AATCTAACAT AGTTCTCCTG TCAGCAGAAG AAAAAAAAGA ACAGACTATT

721 GAAATAAAAG AAGAAGTGGT TGGGCTAACT GAAACATCTT CCCAACCAAA GAATGAAGAA

781 GACATTGAAA TTATTCCAAT CCAAGAAGAG GAAGAAGAAG AAACAGAGAC GAACTTTCCA

841 GAACCTCCCC AAGATCAGGA ATCCTCACCA ATAGAAAATG ACAGCTCTCC TTAA

//

<210> 2

<211>297

<212> PRT

<213>Artificial sequence

<400> 2

ORIGIN

1 MTTPRNSVNG TFPAEPMKGP IAMQSGPKPL FRRMSSLVGP TQSFFMRESK TLGAVQIMNG

61 LFHIALGGLL MIPAGIYAPI CVTVWYPLWG GIMYIISGSL LAATEKNSRK CLVKGKMIMN

121 SLSLFAAISG MILSIMDILN IKISHFLKME SLNFIRAHTP YINIYNCEPA NPSEKNSPST

181 QYCYSIQSLF LGILSVMLIF AFFQELVIAG IVENEWKRTC SRPKSNIVLL SAEEKKEQTI

241 EIKEEVVGLT ETSSQPKNEE DIEIIPIQEE EEEETETNFP EPPQDQESSP IENDSSP

//

Claims (7)

1. a kind of monoclonal antibody UMAB58 of specific binding CD20 albumen, it is the miscellaneous of CGMCC No.13819 by deposit number Tumor cell strain is handed over to produce.

2. a kind of hybridoma cell strain, its deposit number is CGMCC No.13819.

3. monoclonal antibody as claimed in claim 1 is preparing the application in being used to detect CD20 immune detection instruments.

4. application according to claim 3, the immune detection instrument is kit, chip or test paper.

5. a kind of immunologic combined detection reagent kit, including the monoclonal antibody described in claim 1.

6. application of the monoclonal antibody as claimed in claim 1 in the kit for tagged tissue cell is prepared.

7. application according to claim 6, the histocyte is B lymthomas, tonsillotome, spleen.