CN104977416B

CN104977416B - For predicting the biomarker of the effect of anti-CMET antibody

Info

Publication number: CN104977416B
Application number: CN201510156233.5A
Authority: CN
Inventors: 郑钟石; 安兑臻; 孙大淳; 李恩真
Original assignee: Samsung Electronics Co Ltd
Current assignee: Samsung Electronics Co Ltd
Priority date: 2014-04-03
Filing date: 2015-04-03
Publication date: 2018-11-27
Anticipated expiration: 2035-04-03
Also published as: US10378061B2; EP2937421B1; CN104977416A; EP2937421A2; US20150284808A1; EP2937421A3

Abstract

Provide the effect for predicting anti-C-met antibodies and/or the method for anti-C-met antibodies application selection subject comprising the level of biomarker in measurement biological sample.

Description

For predicting the biomarker of the effect of anti-CMET antibody

Cross-reference to related applications

This application claims the South Korea patent application No.10-2014- submitted in Korean Intellectual Property Office on April 3 in 2014 0040146 equity, entire contents pass through herein to be referred to and being incorporated to.

Background of invention

1. invention field

Provide the effect for predicting anti-C-met antibodies and/or the biology for anti-C-met antibodies application selection subject Marker predicts the effect of anti-C-met antibodies and/or is for reference (or control) marker of icp gene expression (this method includes the water for measuring the biomarker in biological sample to the method for anti-C-met antibodies application selection subject It is flat), and the method for prediction and/or treating cancer (this method includes applying anti-C-met antibodies to the subject of selection).

2. description of related art

Ratify Trastuzumab at Food and Drug Administration (U.S.Food&Drug Association, FDA) (Herceptin) after (a kind of targeted drug produced by Genentech Inc.), various individual therapies and use have been developed In the marker for selecting applicable subject.In the case where Trastuzumab, the subject for being suitable for application can be via cancer cell Cell membrane on express HER2 growth factor receptors expression quantity selection.Developing IHC (immunohistochemistry) measuring method Afterwards, many measure method has been used, such as FISH (fluorescence in situ hybridization), CISH (add lustre in situ hybridization) etc. are suitable to select Subject.Hereafter, FDA has been approved by EGFR mutation as subject (lung and the pancreas for Tarceva (Erlotinib) application Adenocarcinoma patients) selection marker, KRAS mutation is as the subject's (colorectum applied for Vectibix and Erbitux Cancer) selection marker, etc..

For targeting the anticancer agent of c-Met albumen, its effect can sufficiently be showed for c-Met targeting agent by having studied Subject marker.Currently, c-Met targeting agent MetMab is the theme of an III clinical trial phase, wherein ventana IHC measuring method (sp44：C-met primary antibody, rabbit monoclonal) already function as total diagnostic method for selecting suitable subject.So And such diagnostic method is limited in terms of its purposes as universal diagnostic due to lower accuracy.In addition, such IHC measuring method has following weakness, i.e. result depends on individual character, damage, the tendency of virologist, etc..

In order to improve the effect of c-Met targeting antitumor agent, need to develop effect for predicting targeting antitumor agent or Selection is suitable for the biomarker of the subject of targeting antitumor agent application.

Summary of the invention

One embodiment is provided for predicting influence of the anti-C-met antibodies to subject or answering for anti-C-met antibodies With the biomarker of (for example, application or treatment of anti-C-met antibodies) selection subject.

Another embodiment provides for predicting influence of the anti-C-met antibodies to subject or for anti-C-met antibodies Using the composition and kit of selection subject, it includes the molecules or reagent for detecting biomarker.

It is used to predict influence of the anti-C-met antibodies to subject another embodiment provides composition or for anti-c- The purposes of Met antibody application selection subject, wherein the composition includes the molecule or reagent for detecting biomarker.

Another embodiment provides horizontal reference (or control) markers for comparing biomarker, thus For predicting influence of the anti-C-met antibodies to subject or for anti-C-met antibodies application selection subject.

Another embodiment provides predict the influence to subject of anti-C-met antibodies or be anti-C-met antibodies application The method of (for example, application or treatment of anti-C-met antibodies) selection subject comprising biology of the measurement from subject imitates The presence of biomarker and/or level (such as presence and/or amount of biomarker) in product.In one embodiment, The method includes the expressions of biomarker in biological sample of the measurement from subject, and the biology is marked The level and the level of reference mark object of will object, wherein biomarker is at least one selected from the group below：THSD7A, MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4 and CAV1, and reference mark object is at least one selected from the group below： EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and TUT1；And it determines described anti- The application of C-met antibodies or its antigen can have effect or suitable to subject in situation：In CAV1, In the case where FAM126A, MET, RAB31, ST8SIA4 and/or THSD7A, the level of the biomarker is higher than the ginseng According to the level of marker；And/or in the case where CMHL and/or PHC1, the level of the biomarker is lower than the reference The level of marker.

It is used to predict influence of the anti-C-met antibodies to subject another embodiment provides biomarker or is anti- The purposes of C-met antibodies application (for example, application or treatment of anti-C-met antibodies) selection subject.

Another embodiment provides prevention and/or the methods for the treatment of cancer comprising applies to the subject of selection Anti- C-met antibodies.

Another embodiment provides the method for c-Met inhibition comprising it is anti-to apply anti-c-Met to the subject of selection Body.

Brief description

Figure 1A includes the image obtained by Ventana MET IHC measuring method to mice xenograft model.

The figure of Figure 1B shows the opposite Ct value obtained by RT-PCR, indicates which model is non-response (non-effect) Group or response (effect) group (Y-axis：Opposite Ct value, X-axis：IHC score, ◆：Non-response (non-effect) group, ●：It responds (effect) Group).

The figure of Fig. 2A shows the expression water of reference mark object (crt gene) and biomarker (marker candidate) It is flat.

The figure of Fig. 2 B shows the expression of internal reference mark object (crt gene).

The figure of Fig. 3 A shows the expression of the inside reference mark object (crt gene) measured using specific primer.

The figure of Fig. 3 B shows the expression of the reference mark object (crt gene) of the selection measured using specific primer.

Detailed description of the invention

Comparing group (hereinafter response or effect group) or anti-C-met antibodies of the anti-C-met antibodies with effect does not have effect Group (hereinafter non-response or non-effect group) in gene expression, and select between response group and non-response group Show the gene of biggish expression difference.It is proposed the gene selected or by protein that the gene encodes for for predicting c- The biomarker of Met antibody effects.In addition, selecting to show between the different cells or respective cells of same cell system lesser Expression difference or the gene for not showing expression difference, and the albumen for proposing the gene of selection or being encoded by the gene Matter is the reference or control marker for comparing the expression of target gene and/or target protein.

One embodiment provides at least one gene as biomarker for predicting anti-C-met antibodies to tested The influence of person or purposes for anti-C-met antibodies application selection subject, the gene is in the response group of anti-C-met antibodies and non- Expression difference is shown between response group.

In one embodiment, biomarker can be at least one selected from the group below：THSD7A, MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4 and CAV1.Biomarker can be at least one selected from the group below：Above description Gene overall length (entire) DNA, cDNA and mRNA and by gene encode protein.Following table 1, which summarizes, can be used as biology The information of the gene of marker：

【Table 1】

Biomarker can be from showing the gene of larger difference to the base for showing less big difference on expression Because being arranged as follows with declining order：THSD7A>MET>RAB31>FAM126A>PHC1>CHML>ST8SIA4>CAV1.In order to implement The selection of more accurate effect prediction or applicable subject can more preferably select to show larger expression between gene The gene of difference is used as biomarker.Therefore, in one embodiment, biomarker may include as above preferential selection Gene or outside the gene preferentially selected, further include at least one selected from remaining gene.

In one embodiment, biomarker may include：

1)THSD7A；

2) THSD7A and at least one combination selected from the group below：MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4 and CAV1；

3)MET；

4) MET and at least one combination selected from the group below：THSD7A, RAB31, FAM126A, PHC1, CHML, ST8SIA4 and CAV1；

5) combination of THSD7A and MET；

6) i) combination (THSD7A+MET) of THSD7A and MET and ii) selected from by RAB31, FAM126A, PHC1, CHML, At least one combination of the group of ST8SIA4 and CAV1 composition；

7)RAB31；

8) RAB31 and at least one combination selected from the group below：THSD7A, MET, FAM126A, PHC1, CHML, ST8SIA4 and CAV1；

9) selected from the group below at least two：THSD7A, MET and RAB31 (can wherein exclude the group of THSD7A and MET It closes)；

10) i) selected from at least two and ii by THSD7A, MET and the RAB31 group formed) it is selected from by FAM126A, At least one combination of the group of PHC1, CHML, ST8SIA4 and CAV1 composition；

11)FAM126A；

12) FAM126A and at least one combination selected from the group below：THSD7A, MET, RAB31, PHC1, CHML, ST8SIA4 and CAV1；

13) selected from the group below at least two：THSD7A, MET, RAB31 and FAM126A (can wherein exclude to be selected from the group At least two：THSD7A, MET and RAB31)；Or

14) i) selected from by THSD7A, MET, RAB31 and FAM126A group form at least two and ii) be selected from by At least one combination of the group of PHC1, CHML, ST8SIA4 and CAV1 composition.

In another embodiment, the respective cells in different types of cell category or same cell type are had found Between show slight difference on expression or do not show the gene of difference.The gene may be used as referring to (or control) marker With for by the expression of target gene compared with referring to (or control).Target gene can be any base for measuring its expression Cause.It selects for example, target gene can be for predicting influence of the anti-C-met antibodies to subject or for anti-C-met antibodies application Select the biomarker of subject.In this case, reference mark object can predict anti-C-met antibodies to the shadow of subject It rings or to be used as in anti-C-met antibodies application selection subject referring to the expression to compare target gene.

In the expression of measurement target gene, if as the expression referring to the gene for comparing with cell category Or same cell type respective cells and change, then can not achieve the accurate measurement of the expression of target gene；Therefore, properly The selection of reference mark object the expression of precise measurement target gene is very important.

In one embodiment, reference mark object can be selected from for endogenous gene necessary to cell survival.For example, ginseng It may include at least one selected from the group below according to marker：EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and TUT1.In one embodiment, due to RPL23A, TPT1, MATR3, SRSF3, and The expression quantity of HNRNPC can be basically comprised and be selected from very constant horizontal maintenance (referring to embodiment 1), reference mark object At least one of the following group：RPL23A, TPT1, MATR3, SRSF3 and HNRNPC, and optionally further include it is selected from the group below extremely Few one kind：EEF1A1, HUWE1, SMARCA4, WDR90 and TUT1, but not limited to this.In one embodiment, reference mark Object may include RPL23A, TPT1, MATR3, SRSF3 and HNRNPC.Alternatively, reference mark object may include TPT1, EEF1M, TUT1, MATR3 and SMARCA4.

Reference mark object may include at least one selected from the group below：The full length DNA of above-described gene, cDNA, and MRNA, and the protein encoded by gene.In this case, the cell used in measurement expression to can be lung cancer thin Born of the same parents, for example, lung cancer adenocarcinoma cell, non-small cell lung cancer cell, etc., but not limited to this.Summarizing in following table 2 can be used as joining According to the information of the gene of marker：

【Table 2】

Another embodiment provides use reference mark object to measure (or estimation) expression of target gene as reference is compared Horizontal method, wherein reference mark object can be at least one selected from the group below：EEF1A1,RPL23A,TPT1,HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and TUT1.The method of measurement (or estimation) expression of target gene level can wrap The expression of target gene in measurement biological sample is included, and compares the expression of target gene and the expression water of reference mark object It is flat.The method of measurement gene expression dose may further include the expression of measurement reference mark object.It can be from living body The cell or tissue of (separated) is separated, or the measurement expression water from the gene (DNA or RNA) or protein that cell or tissue extracts It is flat.It can be by measuring the gene (such as full length DNA, cDNA, mRNA, etc.) or by base from the biological sample that living body separates Because the amount of the protein of coding implements the measurement of expression.Another embodiment provide selected from EEF1A1, RPL23A, At least one of TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and TUT1 are used for as reference mark object Measurement (or estimation) purposes of the expression of target gene from the biological sample that living body separates.

Another embodiment provides for predict anti-C-met antibodies to subject influence (or subject fight c- The responsiveness or sensibility of Met antibody) or be anti-C-met antibodies using the composition of selection subject, it includes for detecting The molecule or reagent of biomarker or the protein by biomarker coding.For predicting anti-C-met antibodies to subject Influence or for anti-C-met antibodies application selection subject composition can further include for detecting reference mark object base The molecule or reagent of protein because of (full length DNA, cDNA or mRNA) or by reference mark object gene coding.

Another embodiment provides for predict anti-C-met antibodies to subject influence (or subject fight c- The responsiveness or sensibility of Met antibody) or be anti-C-met antibodies using the kit of selection subject, it includes for detecting The molecule or reagent of biomarker or the protein by biomarker coding.For predicting anti-C-met antibodies to subject Influence or for anti-C-met antibodies application selection subject kit can further include for detecting reference mark object base The molecule or reagent of protein because of (full length DNA, cDNA or mRNA) or by reference mark object gene coding.

Another embodiment provides the reference compositions of the expression for measuring (measurement or estimation) target gene Or kit, it includes for detecting reference mark object gene (full length DNA, cDNA or mRNA) or being compiled by reference mark object gene The molecule or reagent of the protein of code.In one embodiment, when target gene is biomarker described above, group It closes object or kit can be used for predicting influence or for anti-C-met antibodies application selection tested of the anti-C-met antibodies to subject Person.

Molecule or reagent for detecting biomarker or reference mark object can be commonly used in gene or protein Any type of detection assay method.For example, can implement via common enzyme reaction, fluorescence, luminous, and/or radiological measuring Gene or protein-detecting assays.More specifically, protein can be detected by method selected from the group below：Immunochromatography is exempted from Epidemic disease histochemistry, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (EIA), fluorescence Immunoassay (FIA), luminescence immunoassay (LIA), western blot, microarray, surface plasmon resonance (SPR), Flow Cytometry Assay etc., but not limited to this.Furthermore it is possible to any by using being used with the interfertile primer of gene or probe Common gene (DNA or RNA) detection method, including but not limited to common polymerase chain reaction (PCR；Such as qPCR, RT-PCR etc.), FISH (fluorescence in situ hybridization) and/or microarray detect gene.For example, for detecting biomarker or ginseng Molecule or reagent according to marker can be can in conjunction with gene (hybridization) primer, probe or aptamer, specific recognition and/ Or the antibody or aptamer of the protein encoded by gene are combined, or any combination thereof.Primer, probe, aptamer or antibody can be It synthesizes or recombinates.Primer can be able to detect biomarker genes or reference mark object gene (full length DNA, cDNA, or MRNA complete genome) or intragenic about 5 to about 1000bp, about 10 to about 500bp, about 20 to about 200bp, or about 50 to about The genetic fragment of 200bp, and may include or form the 3 '-ends and/or 5 '-substantially with complete genome or genetic fragment About 5 to about 100bp, about the 5 to about 50bp of end, about 5 to about 30bp, or about 10 can hybridize (such as complementary) to the region of about 25bp Nucleotide sequence.It is substantially to have about 5 that the probe or aptamer that can hybridize with gene or its segment, which may include or form, To about 100bp, the nucleotide sequence of about 5 to about 50bp, about 5 to about 30bp, or about 5 to about 25bp size can be with life Object marker or reference mark object (full length DNA, cDNA or mRNA) segment (about 5 to about 100bp, about 5 to about 50bp, about 5 to About 30bp, or about 5 to about 25bp) hybridization (or complementary).As used in this article, term " can hybridize " can refer to draw 80% or higher between object, probe or aptamer and gene regions, such as 90% or higher, 95% or higher, 98% or higher, 99% or higher or 100% complementarity is in conjunction with the given zone complementarity of gene.

The example of the probe and primer that can be used for detecting biomarker or reference mark object is instantiated in following table 3-5：

【Table 3】

Gene	Probe sequence (5'-3')
		THSD7A	CCTCTTGAACTTGCGTGCCTG(SEQ ID NO:109)
MET	CTTCACTTCGCAGGCAGATTCC(SEQ ID NO:143)
		RAB31	ATACGCTGAATCCATAGGTGCCA(SEQ ID NO:155)
FAM126A	TCTCTGCTGACCTGATTGATGCT(SEQ ID NO:178)
		PHC1	ACCTCCTCACCTGTTGTAGCC(SEQ ID NO:201)
ST8SIA4	ACTGCTCTTGACCACTGACACA(SEQ ID NO:236)
		CHML	CCTCTGGCTGCTTATCATCACC(SEQ ID NO:213)

CAV1	TAGATAACAAGACCTCAGTGCCTTCC(SEQ ID NO:248)
		RPL23A	ACTGGCTCCTGATTACGATGCTT(SEQ ID NO:260)
TPT1	CATAACTGGCTTCTGCTTGTCATCC(SEQ ID NO:261)
		EEF1A1	CCAGCAGCAACAATCAGGACAG(SEQ ID NO:262)
SRSF3	TTCCACTCTTACACGGCAGC(SEQ ID NO:263)
		TUT1	CCTGTGGTCAAGTTCTGTCATCG(SEQ ID NO:264)
HNRNPC	CTGCTGCTCTGCTCCTCTTCT(SEQ ID NO:265)
		HUWE1	TCCTCTTCCTCCTCATCCTCACT(SEQ ID NO:266)
WDR90	TGGTCACTCAGCACACGGAA(SEQ ID NO:267)
		MATR3	TGACCAGACAGAGCAGGAACC(SEQ ID NO:268)
SMARCA4	CCTTCCTCATCATCGTGCCTCT(SEQ ID NO:269)

【Table 4】

【Table 5】

In one embodiment, it can be selected from the group below at least one for detecting the probe of biomarker THSD7A Kind：SEQ ID NO:109 to 142, for example, at least one selected from the group below：SEQ ID NO:109 probe includes SEQ ID NO:110 to 120 probe groups include SEQ ID NO:121 to 131 probe groups, and include SEQ ID NO:132 to 142 Probe groups.Primer for detecting biomarker THSD7A can be SEQ ID NO:270 primer, SEQ ID NO:271 Primer, or the primer pair comprising two kinds of primers, but not limited to this.

Probe for detecting biomarker MET can be at least one selected from the group below：SEQ ID NO:143 to 154, for example, SEQ ID NO:143 probe includes SEQ ID NO:144 to 154 probe groups, or combinations thereof.For detecting The primer of biomarker MET can be SEQ ID NO:272 primer, SEQ ID NO:273 primer, or include both The primer pair of primer, but not limited to this.

Probe for detecting biomarker RAB31 can be at least one selected from the group below：SEQ ID NO:155 to 177, for example, at least one selected from the group below：SEQ ID NO:155 probe includes SEQ ID NO:156 to 166 probe Group, and include SEQ ID NO:167 to 177 probe groups.Primer for detecting biomarker RAB31 can be SEQ ID NO:278 primer, SEQ ID NO:279 primer, or the primer pair comprising both primers, but not limited to this.

Probe for detecting biomarker FAM126A can be at least one selected from the group below：SEQ ID NO:178 To 200 and 225 to 235, for example, at least one selected from the group below：SEQ ID NO:178 probe includes SEQ ID NO:179 It include SEQ ID NO to 189 probe groups:190 to 200 probe groups, and include SEQ ID NO:225 to 235 probe Group.Primer for detecting biomarker FAM126A can be SEQ ID NO:274 primer, SEQ ID NO:275 draw Object, or the primer pair comprising both primers, but not limited to this.

Probe for detecting biomarker PHC1 can be at least one selected from the group below：SEQ ID NO:201 to 212, for example, SEQ ID NO:201 probe includes SEQ ID NO:202 to 212 probe groups, or combinations thereof.For detecting The primer of biomarker PHC1 can be SEQ ID NO:276 primer, SEQ ID NO:277 primer, or comprising this two The primer pair of kind primer, but not limited to this.

Probe for detecting biomarker CHML can be at least one selected from the group below：SEQ ID NO:213 to 224, for example, SEQ ID NO:213 probe includes SEQ ID NO:214 to 224 probe groups, or combinations thereof.For detecting The primer of biomarker CHML can be SEQ ID NO:282 primer, SEQ ID NO:283 primer, or comprising this two The primer pair of kind primer, but not limited to this.

Probe for detecting biomarker ST8SIA4 can be at least one selected from the group below：SEQ ID NO:236 To 247, for example, SEQ ID NO:236 probe includes SEQ ID NO:237 to 247 probe groups, or combinations thereof.For examining The primer for surveying biomarker ST8SIA4 can be SEQ ID NO:280 primer, SEQ ID NO:281 primer, or packet Primer pair containing both primers, but not limited to this.

Probe for detecting biomarker CAV1 can be at least one selected from the group below：SEQ ID NO:248 to 259, for example, SEQ ID NO:248 probe includes SEQ ID NO:249 to 259 probe groups, or combinations thereof.For detecting The primer of biomarker CAV1 can be SEQ ID NO:284 primer, SEQ ID NO:285 primer, or comprising this two The primer pair of kind primer, but not limited to this.

Probe for detecting reference mark object EEF1A1 can be SEQ ID NO:262 probe, but not limited to this.With It can be SEQ ID NO in the primer of detection reference mark object EEF1A1:290 primer, SEQ ID NO:291 primer or packet Primer pair containing both primers, but not limited to this.

Probe for detecting reference mark object RPL23A can be SEQ ID NO:260 probe, but not limited to this.With It can be SEQ ID NO in the primer of detection reference mark object RPL23A:286 primer, SEQ ID NO:287 primer or packet Primer pair containing both primers, but not limited to this.

Probe for detecting reference mark object TPT1 can be SEQ ID NO:261 probe, but not limited to this.For The primer of detection reference mark object TPT1 can be SEQ ID NO:288 primer, SEQ ID NO:289 primer includes this The primer pair of two kinds of primers, but not limited to this.

Probe for detecting reference mark object HUWE1 can be SEQ ID NO:266 probe, but not limited to this.With It can be SEQ ID NO in the primer of detection reference mark object HUWE1:298 primer, SEQ ID NO:299 primer or packet Primer pair containing both primers, but not limited to this.

Probe for detecting reference mark object MATR3 can be SEQ ID NO:268 probe, but not limited to this.With It can be SEQ ID NO in the primer of detection reference mark object MATR3:302 primer, SEQ ID NO:303 primer or packet Primer pair containing both primers, but not limited to this.

Probe for detecting reference mark object SRSF3 can be SEQ ID NO:263 probe, but not limited to this.With It can be SEQ ID NO in the primer of detection reference mark object SRSF3:292 primer, SEQ ID NO:293 primer or packet Primer pair containing both primers, but not limited to this.

Probe for detecting reference mark object HNRNPC can be SEQ ID NO:265 probe, but not limited to this.With It can be SEQ ID NO in the primer of detection reference mark object HNRNPC:296 primer, SEQ ID NO:297 primer or packet Primer pair containing both primers, but not limited to this.

Probe for detecting reference mark object SMARCA4 can be SEQ ID NO:269 probe, but not limited to this. Primer for detecting reference mark object SMARCA4 can be SEQ ID NO:304 primer, SEQ ID NO:305 primer Or the primer pair comprising both primers, but not limited to this.

Probe for detecting reference mark object WDR90 can be SEQ ID NO:267 probe, but not limited to this.With It can be SEQ ID NO in the primer of detection reference mark object WDR90:300 primer, SEQ ID NO:301 primer or packet Primer pair containing both primers, but not limited to this.

Probe for detecting reference mark object TUT1 can be SEQ ID NO:264 probe, but not limited to this.For The primer of detection reference mark object TUT1 can be SEQ ID NO:294 primer, SEQ ID NO:295 primer includes this The primer pair of two kinds of primers, but not limited to this.

Another embodiment provides the influence of anti-C-met antibodies to subject is predicted, (or to fight c-Met anti-by subject The responsiveness or sensibility of body) or for anti-C-met antibodies application (for example, application or treatment of anti-C-met antibodies) selection (or mirror It is fixed) method of subject comprising in the biological sample of measurement (or measurement) from subject the presence of biomarker and/ Or it is horizontal (such as presence and/or amount of biomarker).In the method, reference mark object can be used and be used as and compare reference Implement the presence of biomarker and/or the measurement or measurement of level.

For example, in CAV1, FAM126A, MET, in the case where RAB31, ST8SIA4 and/or THSD7A, in the table of gene When higher up to level, it can determine that (or prediction) anti-C-met antibodies can show effect and (use the treatment of anti-C-met antibodies Effective) or biological sample or obtain (separation or separate) biological sample subject be suitable for it is anti-using anti-c-Met Body.In addition, when expression is lower, can determine (or prediction) anti-C-met antibodies in the case where CMHL and/or PHC1 Effect (the use of the treatment of anti-C-met antibodies being effective) or biological sample can be shown or obtain (separation or separating) life The imitate subject of product of object is suitable for using anti-C-met antibodies.

The expression of biomarker can be by by the expression comparative assessment of itself and reference mark object.For example, Polymerase chain reaction (PCR can be used with reference table 6；Such as competitive PCR, real-time PCR (RT-PCR), etc.) implement biology The determination (or prediction) of the effect and/or applicability of the assessment of marker expression and anti-C-met antibodies.

【Table 6】

(Δ Ct=reference mark object Ct value (cycle threshold) (if using two or more reference mark objects, the art The meaning of one's words refers to " average value of the Ct value of reference mark object ") the Ct value of-biomarker)

In table 6, reference mark object can be at least one selected from the group below：EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and TUT1, described above.

Method described herein may further include for every kind of biomarker, and measurement can be with biomarker The reference standard expression value compared, as listed in table 6.Reference standard expression value can be measured as follows, for example, (i) (a) Know the subject group (also known as " effect group ") for anti-C-met antibodies sensitivity and (b) to be known as anti-C-met antibodies insensitive Δ Ct is measured to every kind of biomarker in the subject group (also known as " non-effect group ") of (such as resistance)；And (ii) is in the future It is averaged from the Δ Ct of (a) and (b) to provide referring to expression value.As explained above, Δ Ct is one or more referring to mark Will object (EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and TUT1's) is averaged The Ct value of the given biomarker of Ct value-calculating standard expression value.Effect group and non-effect group can be by confirming anti-c- Met Antibody Efficacy (such as anticancer efficacy, such as inhibit cancer cell multiplication) preceding internal test (such as clinical trial) or from Body tests (such as cell tests) to determine.

Alternatively, can be by comparing the expression of biomarker in the biological sample from subject and referring to sample The expression of biomarker measures " low or high expression level " in product.Reference sample can be anti-C-met antibodies and not imitate Fruit (insensitive group of such as anti-C-met antibodies) or confrontation C-met antibodies it is resistant (such as the non-effect group of anti-C-met antibodies or Anti- C-met antibodies resistance group) any cell or tissue.It can be at least one selected from the group below for example, referring to sample：Carefully Born of the same parents system H1373 (ATCC, CRL-5866), HCC1806 (ATCC, CRL-2335), Caki-1 (ATCC, HTB-46), SKBR3 (ATCC, HTB-30), BT474 (ATCC, HTB-20), HT-29 (ATCC, HTB-38), LoVo (ATCC, CCL-229), HCT116 (ATCC, CCL-247), SW620 (ATCC, CCL-227), Ls174T (ATCC, CL-188), and the weight due to anti-C-met antibodies Cell that is multiple and/or persistently applying and fight C-met antibodies acquisition resistance.Therefore, predict anti-C-met antibodies to the shadow of subject It rings or selects the method for (or identification) subject can for anti-C-met antibodies application (for example, application or treatment of anti-C-met antibodies) To further comprise following step, i.e., biology in the expression of biomarker and reference sample in comparative biology sample The expression of marker, described above.In this case, the method may further include in measurement reference sample The step of expression of biomarker.The method may further include following step, that is, determine (prediction or choosing Select) in biomarker (at least one selected from the group below：CAV1, FAM126A, MET, RAB31, ST8SIA4 and THSD7A) When expression is higher than the expression of reference sample or biomarker (CMHL, PHC1, or combinations thereof) expression water When the flat expression lower than reference sample, anti-C-met antibodies to biological sample or obtain (separation) biological sample by It is anti-using anti-c-Met that there is examination person the subject of influence or biological sample or acquisition (separation) biological sample to be suitable for Body.

The level of measurement biomarker or reference mark object may include i) with for detecting biomarker or referring to mark The molecule or reagent of will object handle biological sample (react with it or contact)；And ii) quantitative analysis reaction mixture to be to survey Determine the level of biomarker or reference mark object.In one embodiment, before step i), can further implement to mention The step of for biological sample, wherein the preparation step may include obtained from patient (separation) biological sample or obtain from The biological sample of patient's separation.It, can for detecting molecule or the reagent of biomarker or reference mark object in step i) To be described above.In one embodiment, for detecting the molecule or reagent of biomarker or reference mark object Can be conjugated with universal marker, the marker for example fluorescence, secondary antibody, pearl (such as magnetic beads or polystyrene bead), dyestuff or Any combination thereof.Step i) is configurable to by adding to biological sample for detecting biomarker or reference mark object Molecule or reagent to form compound.In step ii), reaction mixture be can be derived from biomarker or reference mark Object and for detecting the compound of the interaction (in conjunction with) between biomarker or the molecule or reagent of reference mark object, It can be obtained in step i).Quantitative analysis may include that compound is being quantified compound, conjugation after biological sample separation Marker in compound or the biomarker or reference mark object from compound separation.

The level of measurement biomarker or reference mark object may include i) with for detecting biomarker or referring to mark The molecule or composition of will object handle biological sample (react with it or contact)；And ii) quantitative analysis reaction mixture with Measure the level of biomarker or reference mark object.In one embodiment, before step i), can further implement The step of providing biological sample, wherein the preparation step may include obtaining (separation) biological sample from patient or obtaining The biological sample separated from patient.In step i), for detecting molecule or the combination of biomarker or reference mark object Object can be described above.In one embodiment, for detect biomarker or reference mark object molecule or Composition can be conjugated with universal marker, the marker for example fluorescence, secondary antibody, pearl (such as magnetic beads or polystyrene bead), Dyestuff, or any combination thereof.Step i) is configurable to by adding to biological sample for detecting biomarker or ginseng Molecule or composition according to marker is to form compound.In step ii), reaction mixture be can be derived from biomarker Or reference mark object and for detect the interaction between biomarker or the molecule or composition of reference mark object (knot Close) compound, can obtain in the step i).Quantitative analysis may include measuring compound after biological sample separation The biomarker or reference mark object for changing compound, being conjugated in the marker of compound or being separated from compound.

Subject can refer to any patient for being suitable for being applied with the therapy of anti-C-met antibodies.Subject can be any Mammal, for example, primate such as people or monkey, rodent (rat or mouse), etc..It is suffered from for example, subject can be The patient of cancer.Biological sample can be at least one selected from the group below：Cell, tissue, body fluid (such as blood, serum, blood Slurry etc.), etc., from subject, (such as any mammal, for example, primate, such as people or monkey, (rat is small for rodent Mouse), etc.) separation, or artificial culture.For example, biological sample can be cancer cell or cancerous tissue, or mentioned from cell or tissue The DNA or RNA taken, or the protein separated from cell or tissue.Biological sample can be unprocessed sample or processed Sample (such as RRPE (through formalin it is fixed through paraffin embedding) sample).

In one embodiment, subject can be cancer patient.Cancer can be with the overexpression of c-Met and/or different It often activates related.Cancer can be solid tumor or hematologic cancers.Cancer can be preinvasive cancer or metastatic cancer.For example, Cancer can be but not limited to selected from the group below one or more：Squamous cell carcinoma (squamous cell carcinoma) is small Cell lung cancer (small-cell lung cancer), non-small cell lung cancer (non-small-cell lung cancer), lung Gland cancer (adenocarcinoma of the lung), prognosis of squamous cell lung cancer (squamous cell carcinoma of the Lung), peritoneal cancer (peritoneal carcinoma), cutaneum carcinoma (skin cancer), the melanoma in skin or eyeball, The carcinoma of the rectum (rectal cancer), anal cancer, the cancer of the esophagus (esophagus cancer), intestinal tumor (small Intestinal tumor), endocrine gland cancer (endocrine gland cancer), parathyroid carcinoma (parathyroid Cancer), adrenal (adrenal cancer), soft tissue sarcoma (soft-tissue sarcoma), carcinoma of urethra (urethral cancer), chronic or acute leukemia, lymphocytic lymphoma (lymphocytic lymphoma), liver Cytoma (hepatoma), gastric cancer (gastric cancer), human primary gastrointestinal cancers (gastrointestinal cancer), cancer of pancreas (pancreatic cancer), spongioblastoma (glioblastoma), cervical carcinoma (cervical cancer), oophoroma (ovarian cancer), liver cancer (liver cancer), bladder cancer (bladder cancer), adenoma (hepatocellular adenoma), breast cancer (breast cancer), colon cancer (colon cancer), colorectal cancer (large intestine cancer), carcinoma of endometrium (endometrial carcinoma) or uterine cancer (uterine Carcinoma), Salivary Gland Tumors (salivary gland tumor), kidney (kidney cancer), prostate cancer (prostate cancer), carcinoma of vulva (vulvar cancer), thyroid cancer (thyroid cancer), head or neck cancer (head or neck cancer), the cancer of the brain (brain cancer), osteosarcoma (osteosarcoma), etc..Implement at one In scheme, subject can be the patient with lung cancer (such as lung cancer gland cancer, non-small cell gland cancer, etc.).

Can by using can with any universal genetic measuring method of the primer of gene recombination, probe or aptamer, such as But it is not limited by polymerase chain reaction (PCR；Such as q PCR or RT-PCR), fluorescence in situ hybridization (FISH) or microarray Measuring method implements the presence of biomarker and/or reference mark object and/or the measurement of expression.In an embodiment In, it can be by universal genetic quantitative determination method, such as pass through the presence of PCR measurement biomarker and/or reference mark object And/or expression.Alternatively, the presence of general sequencing identification biomarker can be passed through.In one embodiment, primer It can be designed as the complete genome or gene of detection biomarker or reference mark object gene (full length DNA, cDNA or mRNA) The segment of interior continuous nucleotide, for example, about 5 to about 100bp, for example, about 10 to about 500bp, about 20 to about 200bp, or about 50 To the segment of about 200bp.Primer can be include or composition be substantially (consisting essentially of) nucleotide The primer pair of sequence, the nucleotide sequence are able to be about 5 to about 100bp, for example, about 5 to about 50bp with magnitude range, About 5 to about 30bp, or about 10 to 25bp 3 '-and 5 '-petiolareas hybridization (such as complementary).It can be with the probe of gene recombination or suitable It is substantially with about 5 to about 100bp, about 5 to about 50bp, about 5 to about 30bp, or about 5 to about that body, which may include or form, The nucleotide sequence of the size of 25bp, can be with biomarker or reference mark object gene (full length DNA, cDNA or mRNA) Segment (about 5 to about 100bp, about 5 to about 50bp, about 5 to about 30bp, or about 5 to about 25bp) hybridization (or complementary).As herein Used in, term " can hybridize " can refer to 80% or higher between primer, probe or aptamer and gene regions, such as 90% or higher, 95% or higher, 98% or higher, 99% or higher or 100% complementarity and gene given zone it is mutual Benefit property combines.

The presence of biomarker and/or reference mark object and/or expression can be by quantifying egg encoded by it White matter measurement.Enzymatic reaction, glimmering can be detected by using the chemicals, antibody, and/or aptamer of specific binding protein Light, luminous and/or radioactivity implement protein quantization.It is, for example, possible to use the analytical technology implementations selected from but not limited to the following group Protein quantization：Immunochromatography, immunohistochemical staining, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (EIA), fluorescence immunoassay (FIA), luminescence immunoassay (LIA), western blot, Microarray, flow cytometry, immunohistochemistry (IHC), surface plasmon resonance (SPR), etc..

Another embodiment provides the methods for inhibiting c-Met or prevention and/or treating cancer comprising high to having Horizontal CAV1, FAM126A, MET, RAB31, ST8SIA4, and/or THSD7A's and/or low-level CMHL and/or PHC1 Subject applies anti-C-met antibodies, and wherein term " high level " and " low-level " can be determined as described above.Implement at one In scheme, subject can be the subject as above selected.

Inhibit the method for c-Met or prevention and/or treating cancer to may further include before step of applying to be anti-c-Met The step of subject of antibody application identification.Authentication step can be the subject identified by applying for anti-C-met antibodies Method choice biological sample or the step of subject, and can by implement step described in selection method or Interested subject or biological sample is selected to implement by being identified through selection method.

In one embodiment, the method for inhibition c-Met or prevention and/or treating cancer may include：

For anti-C-met antibodies application identification subject；And

Anti- C-met antibodies are applied to the subject.

Alternatively, the method for inhibition c-Met or prevention and/or treating cancer may include：

Presence and/or level by measuring biomarker are anti-C-met antibodies application selection subject；And

Anti- C-met antibodies are applied to the subject of selection.

It in the above-mentioned methods, can be for inhibiting c-Met or prevention and/or treating cancer effectively to measure the anti-c- of application Met antibody.

In one embodiment, anti-C-met antibodies can be by c-Met albumen be identified as antigen any antibody and/ Or its antigen-binding fragment.For example, anti-C-met antibodies can identify the given zone in the given zone of c-Met, such as the domain SEMA For epitope.It can be any antibody or antigen binding fragment for acting on c-Met to induce c-Met internalization intracellular and degradation Section.

As used in this article, unless otherwise narration, term " anti-C-met antibodies " can be used for not only complete including antibody Shaping type, but also including its antigen-binding fragment.

Term " c-Met " or " c-Met albumen " refer to a kind of receptor tyrosine kinase of combination hepatocyte growth factor (HGF) (RTK).C-Met can be the c-Met albumen from any species, especially mammal, such as primate, such as people c- Met (such as NP_000236) or monkey c-Met (such as macaque (Macaca mulatta), NP_001162100) or rodent are all Such as mouse c-Met (such as NP_032617.2) or rat c-Met (such as NP_113705.1).C-Met albumen may include by It is identified as the nucleotide sequence coded polypeptide of GenBank accession number NM_000245, has and is identified as GenBank accession number NP_ The polypeptide of 000236 amino acid sequence or its extracellular domain.Receptor tyrosine kinase c-Met participates in various mechanism, such as cancer shape At, transfer, the migration of cancer cell, the immersion and angiogenesis of cancer cell.

C-Met (receptor that one kind is directed to hepatocyte growth factor (HGF)) is segmented into three parts：It is extracellular, cross-film and It is intracellular.Extracellular portion is made of α (the alpha)-subunit and β (beta)-subunit being connected to each other via disulfide bond, and containing negative Duty combines the domain SEMA, the domain PSI (clump albumen-brain signal albumen (semaphorin)-integrin homeodomain) and the domain IPT of HGF (the shared immunoglobulin like fold in clump albumen and transcription factor domain).The domain SEMA of c-Met albumen can have SEQ ID NO:79 amino acid sequence, and be the extracellular domain functioned to combine HGF.The given zone in the domain SEMA is (that is, have SEQ ID NO:The region of 71 amino acid sequence corresponds to amino acid sequence (the SEQ ID NO in the domain SEMA of c-Met albumen: 79) range of amino acid residue 106 to 124) it is second in the epitope in the domain SEMA and third propeller (propeller) ring region between.The effect in the area is the epitope of the anti-C-met antibodies of specificity of present disclosure.

As used in this article, term " epitope " refers to antigenic determinant, i.e., the part identified in antigen by antibody.At one In embodiment, epitope can be the domain SEMA (the SEQ ID NO comprising c-Met albumen:79) 5 or more Continuance ammines in Base acid residue, such as SEQ ID NO:The region of 5 to 19 continuous amino acid residues in 71 amino acid sequence.Continuous ammonia Base acid can be the continuous amino acid in linear order, or in the three-dimensional construction of epitope continuously, without in linear order It is continuous in column.For example, epitope, which can be, to be had selected from SEQ ID NO:The 5 to 19 of the part combination of 71 amino acid sequence The polypeptide of a adjoining (or continuous) amino acid, wherein polypeptide basically comprises the SEQ ID NO for serving as the required element of epitope:73 (EEPSQ) amino acid sequence.For example, it includes that composition is substantially, or group becomes SEQ ID NO that epitope, which can be,:71, SEQ ID NO:72 or SEQ ID NO:The polypeptide of 73 amino acid sequence.

With SEQ ID NO:The epitope of 72 amino acid sequence corresponds in the domain SEMA of c-Met albumen second and the The outermost portion of ring between three propellers.With SEQ ID NO:The epitope of 73 amino acid sequence is implemented according to one The site that the antibody or antigen-binding fragment of scheme are most specifically bound.

In this way, anti-C-met antibodies, which can be specifically bound, to be had selected from SEQ ID NO:The 5 to 19 of 71 amino acid sequence A adjoining (or continuous) amino acid, and include SEQ ID NO:Epitope of 73 (EEPSQ) as required element.For example, anti-c-Met Antibody can be specifically bound comprising SEQ ID NO:71, SEQ ID NO:72 or SEQ ID NO:73 amino acid sequence Epitope.

In one embodiment, anti-C-met antibodies or its antigen-binding fragment may include：

At least one complementary determining region of heavy chain (CDR) selected from the group below：(a) CDR-H1, it includes SEQ ID NO:4 ammonia Base acid sequence；(b) CDR-H2, it includes SEQ ID NO:5, SEQ ID NO:2 amino acid sequence, or include SEQ ID NO: 8-19 continuous amino acid in 2 and include SEQ ID NO:The amino acid sequence of 2 the 3rd to the 10th amino acid residue； (c) CDR-H3, it includes SEQ ID NO:6, SEQ ID NO:85 amino acid sequence, or include SEQ ID NO:In 85 6-13 continuous amino acid and include SEQ ID NO:The amino acid sequence of 85 the 1st to the 6th amino acid residue；Or comprising The heavy chain variable region of at least one complementary determining region of heavy chain；

At least one complementary determining region of light chain (CDR) selected from the group below：(a) CDR-L1, it includes SEQ ID NO:7 ammonia Base acid sequence, (b) CDR-L2, it includes SEQ ID NO:8 amino acid sequence, and (c) CDR-L3, it includes SEQ ID NO: 9, SEQ ID NO:15, SEQ ID NO:86 amino acid sequence, or include SEQ ID NO:9-17 continuous amino in 89 Acid and include SEQ ID NO:The amino acid sequence of 89 the 1st to the 9th amino acid residue；Or it is mutual comprising at least one light chain Mend the light chain variable region for determining area；

The combination of at least one complementary determining region of heavy chain and at least one complementary determining region of light chain；

The combination of heavy chain variable region and light chain variable region.

Herein, SEQ ID NO:4 to 9 amino acid residue is indicated separately below with following Formulas I to VI：

Formulas I

Xaa₁-Xaa₂-Tyr-Tyr-Met-Ser(SEQ ID NO:4),

Wherein Xaa₁It is being a lack of or be Pro or Ser, and Xaa₂It is Glu or Asp,

Formula II

Arg-Asn-Xaa₃-Xaa₄-Asn-Gly-Xaa₅-Thr(SEQ ID NO:5),

Wherein Xaa₃It is Asn or Lys, Xaa₄It is Ala or Val, and Xaa₅It is Asn or Thr,

Formula III

Asp-Asn-Trp-Leu-Xaa₆-Tyr(SEQ ID NO:6),

Wherein Xaa₆It is Ser or Thr,

Formula IV

Lys-Ser-Ser-Xaa₇-Ser-Leu-Leu-Ala-Xaa₈-Gly-Asn-Xaa₉-Xaa₁₀-Asn-Tyr-Leu- Ala(SEQ ID NO:7)

Wherein Xaa₇It is His, Arg, Gln or Lys, Xaa₈It is Ser or Trp, Xaa₉It is His or Gln, and Xaa₁₀It is Lys Or Asn,

Formula V

Trp-Xaa₁₁-Ser-Xaa₁₂-Arg-Val-Xaa₁₃(SEQ ID NO:8)

Wherein Xaa₁₁It is Ala or Gly, Xaa₁₂It is Thr or Lys, and Xaa₁₃It is Ser or Pro, and

Formula IV

Xaa₁₄-Gln-Ser-Tyr-Ser-Xaa₁₅-Pro-Xaa₁₆-Thr(SEQ ID NO:9)

Wherein Xaa₁₄It is Gly, Ala or Gln, Xaa₁₅It is Arg, His, Ser, Ala, Gly or Lys, and Xaa₁₆It is Leu, Tyr, Phe or Met.

In one embodiment, CDR-H1 may include amino acid sequence selected from the group below：SEQ ID NO:1,22, 23 and 24.CDR-H2 may include amino acid sequence selected from the group below：SEQ ID NO:2,25 and 26.CDR-H3 may include Amino acid sequence selected from the group below：SEQ ID NO:3,27,28 and 85.

CDR-L1 may include amino acid sequence selected from the group below：SEQ ID NO:10,29,30,31,32,33 and 106. CDR-L2 may include amino acid sequence selected from the group below：SEQ ID NO:11,34,35 and 36.CDR-L3, which may include, to be selected from The amino acid sequence of the following group：SEQ ID NO:12,13,14,15,16,37,86 and 89.

In another embodiment, antibody or antigen-binding fragment may include heavy chain variable region and light chain variable region, The heavy chain variable region contains the polypeptide (CDR-H1) comprising amino acid sequence selected from the group below：SEQ ID NO:1,22,23, and 24, the polypeptide (CDR-H2) comprising amino acid sequence selected from the group below：SEQ ID NO:2,25 and 26, and comprising being selected from the group Amino acid sequence polypeptide (CDR-H3)：SEQ ID NO:3,27,28 and 85；The light chain variable region contains comprising being selected from The polypeptide (CDR-L1) of the amino acid sequence of the following group：SEQ ID NO:10,29,30,31,32,33 and 106, comprising being selected from the group Amino acid sequence polypeptide (CDR-L2)：SEQ ID NO:11,34,35 and 36, and include amino acid sequence selected from the group below Polypeptide (CDR-L3)：SEQ ID NO 12,13,14,15,16,37,86 and 89.

In an embodiment of anti-C-met antibodies or antigen-binding fragment, heavy chain variable region includes SEQ ID NO: 17,74,87,90,91,92,93 or 94 amino acid sequence, and light chain variable region includes SEQ ID NO:306,18,19, 20,21,75,88,95,96,97,98,99 or 107 amino acid sequence.

By with the zoogenic animal derived antibody of desired antigen non-immune in order to which therapeutic treatment purpose is to people Generally cause immunogenicity when injection, and so develops chimeric antibody to inhibit such immunogenicity.Pass through heredity The constant region replacement of engineering human antibody causes the constant region of the animal derived antibody of anti-isotype response, to prepare inosculating antibody Body.Compared with animal derived antibody, chimeric antibody is to improve considerable, but variable region is still for anti-isotype response Amino acid sequence with animal derived, so that chimeric antibody has side effect for potential antiidiotype response.? Humanized antibody is developed to reduce such side effect.By the way that weight will be played in antigen binding in the variable region of chimeric antibody The complementary determining region to be acted on (CDR), which is grafted onto human antibody frame, generates humanized antibody.

It grafts using CDR to generate in humanized antibody, selection is spread out using the human antibody of which optimization to receive animal The CDR of raw antibody is vital.Using antibody database, the analysis of crystal structure and the technology of molecule modeling.However, Even if there is also the CDR's for being located at animal derived when the CDR of animal derived antibody to be grafted onto the human antibody frame of optimization The amino acid of antigen binding is influenced in frame.Therefore, in many cases, antigen-binding affinity is not maintained, and So the other antibody engineering technology of application is required to restore antigen-binding affinity.

Anti- C-met antibodies can be but not limited to the antibody of mouse-derived, mouse-human chimeric antibody, humanized antibody, or Human antibody.Antibody or its antigen-binding fragment can separate or non-naturally occurring from living body.Antibody or its antigen-binding fragment It can be synthesis or recombination.

Complete antibody includes two full-length light chains and two total length heavy chains, wherein every light chain passes through disulfide bond and heavy chain Connection.Antibody has heavy chain constant region and constant region of light chain.Heavy chain constant region belongs to gamma (γ), mu (μ), alpha (α), Delta (δ) or epsilon (ε) type, can be categorized further, as gamma1 (γ 1), gamma 2 (γ 2), 3 (γ of gamma 3), gamma 4 (γ 4), alpha 1 (α 1) or alpha 2 (α 2).Constant region of light chain belongs to kappa (κ) or lambda (λ) Type.

As used in this article, term " heavy chain " refers to total length heavy chain and its segment comprising resists comprising being enough to provide to be directed to The variable region V of the amino acid sequence of former specificity_HAnd 3 constant region C_H1, C_H2And C_H3And hinge.Term " light chain " refers to Full-length light chains and its segment, the variable region V including being directed to the amino acid sequence of specificity of antigen comprising being enough to provide_LWith it is constant Area C_L。

Term " complementary determining region (CDR) " refers to the amino acid in the hypervariable region of the heavy chain or light chain that are present in immunoglobulin Sequence.Heavy chain and light chain can separately include 3 CDR (CDRH1, CDRH2 and CDRH3；And CDRL1, CDRL2 and CDRL3). CDR can provide contact residues, play an important role in combination of the antibody to antigen or epitope.Term " specificity knot Conjunction " and " specific recognition " are known to a person of ordinary skill in the art, and indicate that antibody and antigen are specific mutual each other Effect is to lead to immunologic competence.

Term " antigen-binding fragment " used herein refers in intact immunoglobulins comprising containing antigen binding domain The segment of polypeptide portion, the antigen binding domain have the ability of molecule of the antigen binding.In specific embodiments, antigen Binding fragment can be scFv, (scFv)₂, scFvFc, Fab, Fab ' or F (ab ')₂, but not limited to this.

In antigen-binding fragment, comprising light chain and heavy chain variable region, constant region of light chain and the first heavy chain constant region C_H1's Fab has 1 antigen binding site.

Fab ' segment and Fab segment are the difference is that Fab ' is included in C_H1C-terminal have at least one cysteine The hinge area of residue.

F(ab’)₂Antibody bridges to be formed via the disulphide of the cysteine residues in the hinge area of Fab ' segment.

Fv is minimum antibody fragment only with heavy chain variable region and light chain variable region.Generate Fv segment recombinant technique be It is as known in the art.

Two chain Fv include the heavy chain variable region and light chain variable region connected by non-covalent bond.ScFv generally comprise via Peptide linker is connected by covalently key connection or in C-terminal with dimeric structure, such as the heavy chain variable region of two chain Fv and light chain can Become area.Peptide linker can be identical as description above, and including but not limited to those have 1 to 100,2 to 50, especially 5 to 25 A amino acid length, and can include but is not limited to any kind of amino acid.

Antigen-binding fragment can be used protease and obtain (for example, can be by the limit with papain to whole antibody Property cutting processed obtains Fab segment, and can obtain F (ab') by being cut with pepsin₂Segment), or can be by making It is prepared with genetic recombination techniques.

As used in this article, term " hinge area ", which refers to, functions between the domain CH1 and CH2 in heavy chain of antibody to be anti- Former binding site provides region flexible.

When animal's antibody undergoes chimerization process, by the IgG1 hinge of animal origin human IgG1's hinge or IgG2 hinge Replacement, while the disulphide bridges between two heavy chains are reduced to 2 from 3 in number.In addition, the IgG1 of animal derived is cut with scissors Chain is shorter than human IgG1's hinge.Thus, hinge chain rigidity is to change.In this way, the modification of hinge area can cause humanized antibody Antigen binding effect improvement.It is those skilled in the art's public affairs via amino acid deletions, addition or the hinge area modification replaced Know.

In one embodiment, at least one amino acid residue on the amino acid sequence of hinge area can be passed through Missing, insertion, addition or any combination replaced modify anti-C-met antibodies or its antigen-binding fragment, so that it shows increasing Strong antigen binding effect.For example, antibody, which can contain, includes SEQ ID NO:100 (U7-HC6), 101 (U6-HC7), 102 (U3-HC9), the hinge area of the amino acid sequence of 103 (U6-HC8) or 104 (U8-HC5), or include SEQ ID NO:105 The hinge area (non-modified people's hinge) of amino acid sequence.Specifically, hinge area has SEQ ID NO:100 or 101 amino Acid sequence.

In one embodiment, anti-C-met antibodies can be monoclonal antibody.It can be by with accession number KCLRF-BP- 00220, the hybridoma cell line that microorganism classification is named as SAIT-MET-AbF46 preservation generates monoclonal antibody, specificity (Korean Patent Publication text No.2011-0047698 is referred to, content is complete by referring in conjunction with the extracellular region of c-Met albumen It is incorporated herein).Anti- C-met antibodies may include all antibody limited in Korean Patent Publication text No.2011-0047698.

In anti-C-met antibodies, light chain other than CDR or light chain variable region as defined above and heavy chain variable region and The remainder of heavy chain moiety, such as constant region of light chain and heavy chain constant region can be those any Asias from immunoglobulin Type (such as IgA, IgD, IgE, IgG (IgG1, IgG2, IgG3, IgG4), IgM, etc.).

As a further example, anti-C-met antibodies or antibody fragment may include：

Heavy chain comprising amino acid sequence selected from the group below：SEQ ID NO:62 amino acid sequence is (wherein from the 1st to The amino acid sequence of 17 amino acid residues is signal peptide) or SEQ ID NO:62 the 18th to the 462nd amino acid sequence Column, SEQ ID NO:(wherein the amino acid sequence of the from the 1st to the 17th amino acid residue is signal to 64 amino acid sequence Peptide), SEQ ID NO:64 the 18th to the 461st amino acid sequence, SEQ ID NO:66 amino acid sequence is (wherein from The amino acid sequence of 1 to the 17th amino acid residue is signal peptide) and SEQ ID NO:66 the 18th to the 460th ammonia Base acid sequence；With

Light chain comprising amino acid sequence selected from the group below：SEQ ID NO:68 amino acid sequence is (wherein from the 1st to The amino acid sequence of 20 amino acid residues is signal peptide), SEQ ID NO:68 the 21st to the 240th amino acid sequence Column, SEQ ID NO:(wherein the amino acid sequence of the from the 1st to the 20th amino acid residue is signal to 70 amino acid sequence Peptide), SEQ ID NO:70 the 21st to the 240th amino acid sequence and SEQ ID NO:108 amino acid sequence.

For example, anti-C-met antibodies can be selected from the group：

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:62 amino acid sequence or SEQ ID NO: 62 the 18th to the 462nd amino acid sequence, the light chain include SEQ ID NO:68 amino acid sequence or SEQ ID NO:68 the 21st to the 240th amino acid sequence；

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:64 amino acid sequence or SEQ ID NO: 64 the 18th to the 461st amino acid sequence, the light chain include SEQ ID NO:68 amino acid sequence or SEQ ID NO:68 the 21st to the 240th amino acid sequence；

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:66 amino acid sequence or SEQ ID NO: 66 the 18th to the 460th amino acid sequence, the light chain include SEQ ID NO:68 amino acid sequence or SEQ ID NO:68 the 21st to the 240th amino acid sequence；

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:62 amino acid sequence or SEQ ID NO: 62 the 18th to the 462nd amino acid sequence, the light chain include SEQ ID NO:70 amino acid sequence or SEQ ID NO:70 the 21st to the 240th amino acid sequence；

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:64 amino acid sequence or SEQ ID NO: 64 the 18th to the 461st amino acid sequence, the light chain include SEQ ID NO:70 amino acid sequence or SEQ ID NO:70 the 21st to the 240th amino acid sequence；

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:66 amino acid sequence or SEQ ID NO: 66 the 18th to the 460th amino acid sequence, the light chain include SEQ ID NO:70 amino acid sequence or SEQ ID NO:70 the 21st to the 240th amino acid sequence；

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:62 amino acid sequence or SEQ ID NO: 62 the 18th to the 462nd amino acid sequence, the light chain include SEQ ID NO:108 amino acid sequence；

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:64 amino acid sequence or SEQ ID NO: 64 the 18th to the 461st amino acid sequence, the light chain include SEQ ID NO:108 amino acid sequence；With

Antibody comprising heavy chain and light chain, the heavy chain include SEQ ID NO:66 amino acid sequence or SEQ ID NO: 66 the 18th to the 460th amino acid sequence, the light chain include SEQ ID NO:108 amino acid sequence.

According to an embodiment, anti-C-met antibodies, which can contain, includes SEQ ID NO:The the 18th to the 460th 's of 66 The heavy chain of amino acid sequence and include SEQ ID NO:The light chain of 68 the 21st to the 240th sequence, or include SEQ ID NO:The heavy chain of 66 the 18th to the 460th amino acid sequence and include SEQ ID NO:The light chain of 108 sequence.

SEQ ID NO:70 polypeptide is the light chain comprising people kappa (κ) constant region, and has SEQ ID NO:68 The polypeptide of amino acid sequence is by having SEQ ID NO with tyrosine replacement:The 62nd of the polypeptide of 70 amino acid sequence (corresponding to the SEQ ID NO according to kabat numbering:The 36th of 68) histidine obtain polypeptide.It can be by replacing Change the generation yield for improving antibody.With SEQ ID NO:The polypeptide of 108 amino acid sequence is by with tryptophan replacement the 32 (SEQ ID NO:According to the position 27e of kabat numbering in the amino acid sequence of 68 amino acid residue 21 to 240；Position In in CDR-L1) the 32nd serine obtain polypeptide.By such replacement, antibody and antibody fragment comprising such sequence Raised activity, such as c-Met binding affinity are shown, c-Met degrading activity and Akt phosphorylation inhibit.

Anti- C-met antibodies can be prepared with pharmaceutical acceptable carrier.It to include in mixture or pharmaceutical composition Pharmaceutical acceptable carrier can be those and be commonly used in the carrier with antibody processed, can be selected from the group below one or more： It is lactose, dextrose, sucrose, D-sorbite, mannitol, starch, gum arabic, calcium phosphate, alginates, gelatin, calcium silicates, micro- Crystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate (methylhydroxy benzoate), nipasol (propylhydroxy benzoate), talcum, stearic acid Magnesium and mineral oil, but not limited to this.Anti- C-met antibodies may further include selected from the group below one or more：It is lubricious Agent, wetting agent, sweetener, flavour enhancer, emulsifier, suspending agent and preservative.

It can be with the anti-C-met antibodies of oral or extra-parenteral administration.Parenteral administration may include intravenous injection, subcutaneous to infuse It penetrates, intramuscular injection, intraperitoneal injection, endothelium application, local application, intranasal administration, intrapulmonary application and rectal administration.Due to mouth Clothes application leads to the digestion of protein or peptide, it is necessary to which coating prepares the active constituent in the composition being administered orally to prevent stomach In digestion.Further, it is possible to use optional apparatus applies composition, the optional apparatus enables active material to be delivered to target Cell.

Anti- C-met antibodies can be used to prevent and/or treating cancer.Cancer can with the overexpression of c-Met and/or (exception) activation is related.Cancer can be solid cancer or hematologic cancers.For example, cancer can be selected from the group below at least one Kind：Squamous cell carcinoma, Small Cell Lung Cancer, non-small cell lung cancer, adenocarcinoma of lung, prognosis of squamous cell lung cancer, peritoneal cancer, cutaneum carcinoma, skin Or the melanoma in eyeball, the carcinoma of the rectum, anal cancer, the cancer of the esophagus, intestinal tumor, endocrine gland cancer, parathyroid carcinoma, Adrenal, soft tissue sarcoma, carcinoma of urethra, chronic or acute leukemia, lymphocytic lymphoma, hepatoma, human primary gastrointestinal cancers, Gastric cancer, cancer of pancreas, spongioblastoma, cervical carcinoma, oophoroma, liver cancer, bladder cancer, adenoma, breast cancer, colon cancer, Colorectal cancer, carcinoma of endometrium or uterine cancer, Salivary Gland Tumors, kidney, prostate cancer, carcinoma of vulva, thyroid cancer, head and neck cancer, The cancer of the brain and osteosarcoma, but not limited to this.

The prevention of cancer and/or therapeutic effect may include not only inhibiting the growth of cancer cell, but also inhibit due to it The effect of cancer progression caused by migration, intrusion and transfer.Therefore, cancer may include preinvasive cancer or metastatic cancer.

The biomarker and/or reference mark object proposed by this specification can be used for selecting to be suitable for high accuracy Using the subject of anti-C-met antibodies, it is achieved in individual therapy, so that anti-C-met antibodies can show most individual patient Big effect.Biomarker and/or reference mark object can be also used for the clinical trial of anti-C-met antibodies.

Embodiment

Hereinafter, the present invention can be described in detail by embodiment.

Following embodiment is intended merely to illustrate the present invention, and is not construed as the limitation present invention.

Reference example 1：The building of anti-C-met antibodies

1.1. the generation of " AbF46 " (a kind of mouse antibodies for c-Met)

1.1.1. mouse is immune

Mouse is immunized necessary to exploitation hybridoma cell line in order to obtain, to 5 BALB/c mouses (Japan SLC, Inc.) the 100 μ g people c-Met/Fc fusion protein (R&DSystems) of every intraperitoneal injection and 1 volume in (4 to 6 week old) The mixture of complete Freund's adjuvant.2 weeks after injection, with the incomplete Freund's adjuvant of 50 μ g people c-Met/Fc albumen and 1 volume Mixture to same mouse carry out second of intraperitoneal injection.Second immune 1 week latter, final booster immunization response.3 days Afterwards, from the tail bleeds taken blood of mouse, and serum is diluted in PBS with 1/1000, and for checking needle by ELISA To the potency of the antibody of c-Met.Selection is found to be the mouse with enough antibody titers to use in cell fusion process.

1.1.2. the generation of cell fusion and hybridoma

3 days before cell fusion, in the peritonaeum of 50 μ g people c-Met/Fc fusion proteins and the mixture of the PBS of 1 volume Injecting immune BALB/c mouse (Japan SLC, Inc.).By immunized mouse anesthesia, cut out later from left one side of something of body Spleen.Then spleen is hanged splenocyte with net processing with separating Morr. cell in culture medium (DMEM, GIBCO, Invitrogen) It is floating.Cell suspending liquid is centrifuged to recycle cellular layer.Splenocyte (the 1x10 that will so obtain⁸A cell) and myeloma cell (Sp2/0)(1x10⁸A cell) mixing, then it is rotated to out cell granule.Cell granule is slowly suspended, in DMEM 45% polyethylene glycol (PEG) (1mL) is handled 1 minute in 37 DEG C, and supplements 1mL DMEM.Cell is added in 10 minutes 10mL DMEM carries out incubating 5 minutes later in 37 DEG C of water-bath.Then, cell volume is adjusted to 50mL, be centrifuged later. By the cell granule being thusly-formed with 1~2 × 10 in Selective agar medium (HAT culture medium)⁵The density of a cell/mL is resuspended, And 0.1mL cell suspending liquid is distributed to every hole of 96 orifice plates, then by 96 orifice plate in 37 DEG C in CO₂Incubator medium temperature It educates to establish hybridoma group.

1.1.3. selection generates the hybridoma of the monoclonal antibody for c-Met albumen

The hybridoma group established from reference example 1.1.2, passes through user c-Met/Fc fusion protein and people Fc Albumen shows the hybridoma of the specific response to c-Met albumen as the ELISA screening of antigen.

People c-Met/Fc fusion protein is seeded to microtiter plate with the amount in/hole 50 μ L (2 μ g/mL), and allows to glue It is attached to the surface in every hole.The antibody for keeping unbonded is removed by cleaning.For for selecting not combining c-Met but identifying Fc's People's Fc albumen is attached to plate surface by antibody in an identical manner.

The Hybridoma Cell Culture object obtained in reference example 1.1.2 is added to every hole of plate with the amount of 50 μ L, and incubates 1 Hour.The Tris buffered saline for keeping unreacted cell sufficient amount and Tween 20 (TBST) are washed away.Goat is resisted small Mouse IgG- horseradish peroxidase (HRP) was added to plate, and in incubation at room temperature 1 hour.The TBST of plate sufficient amount is cleaned, is connect So that peroxide enzyme-to-substrate (OPD) is reacted.Measurement is in the absorbance of 450nm on ELISA plate reader.

By secretion specificity and the strong hybridoma cell line of the antibody of the inhuman Fc repetition selection in conjunction with people c-Met.From The hybridoma cell line obtained by repeating selection, single gram for generating monoclonal antibody is isolated eventually by limiting dilution It is grand.The hybridoma cell line of the generation monoclonal antibody is individually cloned on October 6th, 2009 with preservation No.KCLRF- BP-00220, microorganism classification are named as SAIT-MET-AbF46 and are preserved in Korea Cell system research base according to budapest treaty (one is located at the area South Korea Seoul Zhong Lu (Jongno-Gu) to golden meeting (Korean Cell Line Research Foundation) The International Depository Authority of Yungun-Dong) (referring to Korean Patent Laid-Open disclosure No.2011-0047698).

1.1.4. the generation and purifying of monoclonal antibody

The hybridoma obtained in reference example 1.1.3 is tied up in the culture medium of serum-free and is cultivated, and is trained from cell It supports object and generates simultaneously monoclonal antibody purification (AbF46).

Firstly, it will be supplemented with the hybridoma centrifugation cultivated in the culture medium (DMEM) of 10% (v/v) FBS in 50mL, And cell granule is cleaned two or more times with 20mL PBS to remove FBS from it.Then, by cell in 50mL DMEM It is resuspended, and in 37 DEG C in CO₂It is incubated 3 days in incubator.

After cell is removed by centrifugation, supernatant is being used into the preceding separation for storing or being immediately available for antibody in 4 DEG C And purifying.Using equipped with affinity column (protein G sepharose column；Pharmacia, USA) AKTA system (GE Healthcare) Then to be concentrated with filter (Amicon) from 50 to 300mL supernatant antibody purification.It, will be in PBS before for following embodiment Antibody storage.

The building of (1.2.chAbF46 a kind of chimeric antibody for c-Met)

Mouse antibodies are easy to cause the immunogenicity of people.In order to solve this problem, pass through the amino acid with human IgG1's antibody Sequence replacement constant region, rather than the mouse antibodies AbF46 structure that the variable region for being responsible for antibody specificity is generated from experimental example 1.1.4 Build chAbF46 (a kind of chimeric antibody).

In this regard, gene is designed as the nucleotide comprising " EcoRI- signal sequence-VH-NheI-CH-TGA-XhoI " Sequence (SEQ ID NO:38) (for heavy chain) and the nucleotides sequence of " EcoRI- signal sequence-VL-BsiWI-CL-TGA-XhoI " Arrange (SEQ ID NO:39) it (for light chain), and synthesizes.Then, with EcoRI (NEB, R0101S) and XhoI (NEB, R0146S) Digestion has heavy chain nucleotide sequence (SEQ ID NO:38) DNA fragmentation and there is light chain nucleotide sequence (SEQ ID NO: 39) it is cloned into respectively is packaged in OptiCHOTM antibody expression kit (catalogue number later by DNA fragmentation 12762-019, Invitrogen) in pOptiVECTM-TOPO TA Cloning Kit and pcDNATM3.3-TOPO TA clone In kit (catalogue number 8300-01).

The carrier of every kind of building is expanded using Qiagen Maxiprep kit (catalogue number 12662), and is used Freestyle^TM293 expression system of MAX (Invitrogen) implements transient expression.It is expressed using 293F cell, and will It is in the form of suspension culture in FreeStyle^TMIt is cultivated in 293 expression culture mediums.Before transient expression at 1 day, with 5x10⁵It is a thin Born of the same parents/ml concentration provides cell, and after 24 hours, reaches 1x10 in cell number⁶When a cell/ml, implement instantaneous table It reaches.By using Freestyle^TMThe liposome reagent method of MAX reagent (Invitrogen) implements transfection, wherein managing in 15ml In, by DNA with 1:1 (heavy chain DNA:Light chain DNA) mixing rate provide, and with 2ml OptiPro^TMSFM(invtrogen) It mixes (pipe A), and in another 15ml pipe, by 100ul (microlitre) Freestyle^TMMAX reagent and 2ml OptiPro^TMSFM mixes (pipe B), then mixing tube A and pipe B, and incubates 15 minutes.Before the mixture and transient expression of acquisition The cell provided is slowly mixed together within 1 day.After completing transfection, by cell at 37 DEG C in 130rpm incubator, 80% humidity, and 8%CO₂Under conditions of incubate 5 days.

Hereafter, by cell in the DMEM for being supplemented with 10% (v/v) FBS in 37 DEG C in 5%CO₂Under the conditions of incubate 5 hours, Then in the DMEM of no FBS in 37 DEG C in 5%CO₂Under the conditions of incubate 48 hours.

After centrifugation, supernatant is applied to AKTA Prime (GE Healthcare) with antibody purification.In this regard, 100mL supernatant is loaded into the flow velocity of 5mL/min equipped with albumin A column (GE healthcare, 17-0405-03) AKTA Prime, then with IgG elution buffer (Thermo Scientific, 21004) elution.Buffer is replaced with PBS To purify chimeric antibody AbF46 (hereinafter referred to as " chAbF46 ").

1.3. humanized antibody huAbF46 is constructed from chimeric antibody chAbF46

1.3.1. heavy chain humanization

In order to design two weight domains domain H1- and H3- weight domain, the mouse antibodies AbF46's purified in analysis and reference example 1.2 VH gene shares highest identity/homology human germline gene.Ig BLAST(www.ncbi.nlm.nih.gov/ Igblast/) result discloses identity/identity/homology that VH3-71 has 83% on amino acid levels.According to CDR-H1, CDR-H2 and the CDR-H3 of Kabat numbering restriction mouse antibodies AbF46.It is designed with by mouse antibodies The CDR of AbF46 is introduced into the frame of VH3-71.Therefore, in position 30 (S → T), 48 (V → L), 73 (D → N) and 78 (T → L) Place carries out the back mutation to the amino acid sequence of mouse AbF46.Then, by H1 at position 83 (R → K) and 84 (A → T) into One-step mutation is finally to establish H1- weight (SEQ ID NO:40) and H3- weighs (SEQ ID NO:41).

In order to use in design H4- weight, human antibody frame is analyzed by blast search.As a result VH3 hypotype is disclosed (being known as most stable of) is closely similar in frame and sequence with mouse antibodies AbF46.By the CDR- of mouse antibodies AbF46 H1, CDR-H2 and CDR-H3 are limited according to Kabat numbering, and are introduced into VH3 hypotype to construct H4- weight (SEQ ID NO: 42)。

1.3.2. light chain humanized

In order to design the two light domain domain H1- (SEQ ID NO:And the light domain H2- (SEQ ID NO 43):44), analysis and mouse The VH gene of antibody A bF46 shares the human germline gene of highest identity/homology.IgBLAST search result discloses VK4-1 There is 75% identity/homology on amino acid levels.Limit mouse antibodies AbF46's according to Kabat numbering CDR-L1, CDR-L2 and CDR-L3.It is designed so that the CDR of mouse antibodies AbF46 to be introduced into the frame of VK4-1.Therefore, At position 36 (Y → H), the back mutation of the amino acid sequence to mouse AbF46 is carried out at 46 (L → M) and 49 (Y → I).Only Back mutation at one is carried out at position 49 (Y → I) on H2- is light.

In order to design light (the SEQ ID NO of H3-:45), pass through the VL gene of blast search analysis and mouse antibodies AbF46 The human germline gene of shared highest identity/homology.Therefore, VK2-40 is selected.It was found that the VL and VK2- of mouse antibodies AbF46 40 have 61% identity/homology on amino acid levels.By CDR-L1, CDR-L2 and the CDR-L3 of mouse antibodies according to It limits, and is introduced into the frame of VK4-1 according to Kabat numbering.Position 36 (Y → H) on H3- is light, 46 (L → M) and 49 Back mutation is carried out at (Y → I).

In order in light (the SEQ ID NO of design H4-:46) it is used in, analyzes human antibody frame.Blast search discloses Vk1 Hypotype (being known as most stable of) and mouse antibodies AbF46 are closely similar in frame and sequence.By mouse antibodies AbF46's CDR-L1, CDR-L2 and CDR-L3 are limited according to Kabat numbering, and are introduced into Vk1 hypotype.Therefore, on H4- is light Back mutation is carried out at position 36 (Y → H), 46 (L → M) and 49 (Y → I).

Hereafter, there is heavy chain nucleotide sequence (H1- with EcoRI (NEB, R0101S) and XhoI (NEB, R0146S) digestion Weight：SEQ ID NO:47, H3- weights：SEQ ID NO:48, H4- weights：SEQ ID NO:49) DNA fragmentation and there is light chain nucleotide (H1- is light for acid sequence：SEQ ID NO:50, H2- is light：SEQ ID NO:51, H3- is light：SEQ ID NO:52, H4- is light：SEQ ID NO:53) it is cloned into respectively is packaged in OptiCHOTM antibody expression kit (catalogue number later by DNA fragmentation 12762-019, Invitrogen) in pOptiVECTM-TOPO TA Cloning Kit and pcDNATM3.3-TOPO TA clone In kit (catalogue number 8300-01), to construct recombinant vector to express humanized antibody.

After centrifugation, supernatant is applied to AKTA Prime (GE Healthcare) with antibody purification.In this regard, 100mL supernatant is loaded into the flow velocity of 5mL/min equipped with albumin A column (GE healthcare, 17-0405-03) AKTA Prime, then with IgG elution buffer (Thermo Scientific, 21004) elution.Buffer is replaced with PBS To purify humanization antibody A bF46 (hereinafter referred to as " huAbF46 ").Humanized antibody huAbF46 used in the following embodiment Include H4- weight (SEQ ID NO:And light (the SEQ ID NO of H4- 42):46) combination.

1.4.huAbF46 the building in the library scFV of antibody

For the scFv for heavy chain and light chain variable region building huAbF46 antibody from huAbF46 antibody, for heavy chain With every kind in light chain variable region, gene is designed as the structure with " VH- connector-VL ", and center tap has amino acid sequence "GLGGLGGGGSGGGGSGGSSGVGS"(SEQ ID NO:54).Encode the polynucleotide sequence of the scFv of the design of huAbF46 (SEQ ID NO:55) it is synthesized in Bioneer, and the expression vector of polynucleotides has SEQ ID NO:56 nucleotides sequence Column.

After expression, discovery product shows the specificity to c-Met.

1.5. library gene is constructed to carry out affinity maturation

1.5.1. the synthesis of the selection of target CDR and primer

The affinity maturation of huAbF46 is realized in following steps.Firstly, limiting 6 complementations according to Kabat numbering It determines area (CDRs).CDR is provided in following table 7.

Table 7

CDR	Amino acid sequence
		CDR-H1	DYYMS(SEQ ID NO:1)
CDR-H2	FIRNKANGYTTEYSASVKG(SEQ ID NO:2)
		CDR-H3	DNWFAY(SEQ ID NO:3)
CDR-L1	KSSQSLLASGNQNNYLA(SEQ ID NO:10)
		CDR-L2	WASTRVS(SEQ ID NO:11)
CDR-L3	QQSYSAPLT(SEQ ID NO:12)

In order to for random sequence to be introduced into the CDR of antibody, following design primer.Routinely, using N codon to incite somebody to action The base (25%A, 25%G, 25%C, 25%T) of same ratio is introduced into desired mutational site.In this experiment, with as follows Mode carry out introducing of the randomized bases to the CDR of huAbF46, thus every in the wild-type polynucleotide for encoding each CDR In three nucleotide of a codon, first and second nucleotide are conservative, and other in the 85% of entire sequence Three kinds of nucleotide with identical percentage (each 5%) introduces, and to third nucleotide imparting equal probabilities (33%G, 33% C, 33%T).

1.5.2. the library of huAbF46 antibody and the affinity for c-Met are constructed

Implemented using the primer synthesized in a manner of identical with reference example 1.5.1 via the antibody base for introducing random sequence Because of library construction.Use the polynucleotides of the scFV of covering huAbF46 to obtain two PCR products as template, and is carried out Overlap extension PCR is to provide the library the scFv gene of the huAbF46 antibody for being only mutated desired CDR.It constructs from the library scFV base Because of library each in 6 CDR of targeting of preparation.

By the affinity for c-Met in each library compared with the affinity for c-Met of wild type.With it is wild Type is compared, and most of libraries are lower in the affinity for c-Met.It is obtained in some mutant for the affinity of c-Met To holding.

1.6. from antibody of the library selection with improved affinity

Behind the affinity maturation for the building library of c-Met, the nucleotides sequence of the scFv from each clone is analyzed Column.The nucleotide sequence so obtained is summarized in table 8, and is converted to IgG form.Using respectively from clone in subsequent experiment 4 kinds of antibody that L3-1, L3-2, L3-3 and L3-5 are generated.

Table 8

Clone	The library of building	CDR sequence
			H11-4	CDR-H1	PEYYMS(SEQ ID NO:22)
YC151	CDR-H1	PDYYMS(SEQ ID NO:23)
			YC193	CDR-H1	SDYYMS(SEQ ID NO:24)
YC244	CDR-H2	RNNANGNT(SEQ ID NO:25)
			YC321	CDR-H2	RNKVNGYT(SEQ ID NO:26)
YC354	CDR-H3	DNWLSY(SEQ ID NO:27)
			YC374	CDR-H3	DNWLTY(SEQ ID NO:28)
L1-1	CDR-L1	KSSHSLLASGNQNNYLA(SEQ ID NO:29)
			L1-3	CDR-L1	KSSRSLLSSGNHKNYLA(SEQ ID NO:30)
L1-4	CDR-L1	KSSKSLLASGNQNNYLA(SEQ ID NO:31)
			L1-12	CDR-L1	KSSRSLLASGNQNNYLA(SEQ ID NO:32)
L1-22	CDR-L1	KSSHSLLASGNQNNYLA(SEQ ID NO:33)
			L2-9	CDR-L2	WASKRVS(SEQ ID NO:34)
L2-12	CDR-L2	WGSTRVS(SEQ ID NO:35)
			L2-16	CDR-L2	WGSTRVP(SEQ ID NO:36)
L3-1	CDR-L3	QQSYSRPYT(SEQ ID NO:13)
			L3-2	CDR-L3	GQSYSRPLT(SEQ ID NO:14)
L3-3	CDR-L3	AQSYSHPFS(SEQ ID NO:15)
			L3-5	CDR-L3	QQSYSRPFT(SEQ ID NO:16)
L3-32	CDR-L3	QQSYSKPFT(SEQ ID NO:37)

1.7. the antibody of selection is converted to IgG

The corresponding polynucleotides for encoding the heavy chain of 4 kinds of selection antibody are designed as having " EcoRI- signal sequence-VH- NheI-CH-XhoI"(SEQ ID NO:38) structure.The heavy chain of huAbF46 antibody is used as former state, because its amino acid exists Do not change during affinity maturation.However, in the case where hinge area, using U6-HC7 hinge (SEQ ID NO:57) it replaces The hinge of substitution IgG1.For light chain, also gene is designed as with " EcoRI- signal sequence-VL-BsiWI-CL-XhoI " Structure.The polynucleotides of the light chain variable region of the 4 kinds of antibody selected after coding affinity maturation are synthesized in Bioneer.Then, it uses EcoRI (NEB, R0101S) and XhoI (NEB, R0146S) digestion has heavy chain nucleotide sequence (SEQ ID NO:38) DNA Segment and the DNA fragmentation (DNA fragmentation comprising CDR-L3 derived from L3-1- with light chain nucleotide sequence：SEQ ID NO: 58, the DNA fragmentation comprising CDR-L3 derived from L3-2：SEQ ID NO:59, the DNA fragmentation comprising CDR-L3 derived from L3-3： SEQ ID NO:60, and the DNA fragmentation comprising CDR-L3 derived from L3-5：SEQ ID NO:61), it is cloned into respectively later It is packaged in OptiCHOTM antibody expression kit (catalogue number 12762-019, Invitrogen) POptiVECTM-TOPO TA Cloning Kit and pcDNATM3.3-TOPO TA Cloning Kit (catalogue number 8300- 01) in, to construct recombinant vector to express the antibody of affinity maturation.

The carrier of every kind of building is expanded using Qiagen Maxiprep kit (catalogue number 12662), and is used Freestyle^TM293 expression system of MAX (Invitrogen) implements transient expression.It is expressed using 293F cell, and will It is in the form of suspension culture in FreeStyle^TMIt is cultivated in 293 expression culture mediums.When 1 day before starting transient expression, with 5x10⁵ The concentration of a cell/ml provides cell, and after 24 hours, reaches 1x10 in cell number⁶When a cell/ml, implement wink When express.By using Freestyle^TMThe liposome reagent method of MAX reagent (Invitrogen) implements transfection, wherein In 15ml pipe, by DNA with 1:1 (heavy chain DNA:Light chain DNA) mixing rate provide, and with 2ml OptiPro^TMSFM (invtrogen) (pipe A) is mixed, and in another 15ml pipe, by 100ul (microlitre) Freestyle^TMMAX reagent and 2ml OptiPro^TMSFM mixes (pipe B), then mixing tube A and pipe B, and incubates 15 minutes.Before the mixture and transient expression of acquisition The cell provided is slowly mixed together within 1 day.After completing transfection, by cell at 37 DEG C in 130rpm incubator, 80% humidity, and 8%CO₂Under conditions of incubate 5 days.

After centrifugation, supernatant is applied to AKTA Prime (GE Healthcare) with antibody purification.In this regard, 100mL supernatant is loaded into the flow velocity of 5mL/min equipped with albumin A column (GE healthcare, 17-0405-03) AKTA Prime, then with IgG elution buffer (Thermo Scientific, 21004) elution.Buffer is replaced with PBS To purify antibody (hereinafter referred to as " huAbF46-H4-A1 (origin L3-1), huAbF46-H4-A2 of 4 kinds of affinity maturations (origin L3-2), huAbF46-H4-A3 (origin L3-3) and huAbF46-H4-A5 (origin L3-5) ").

1.8. the huAbF46-H4-A1 of constant region and/or hinge area substitution is constructed

In the 4 kinds of antibody selected in reference example 1.7, find huAbF46-H4-A1 in the affinity for c-Met most It is high and minimum in Akt phosphorylation and c-Met palliating degradation degree.In the antibody, hinge area or constant region and hinge area are replaced Generation.

Antibody huAbF46-H4-A1 (U6-HC7) is made of heavy chain and light chain, and the heavy chain includes huAbF46-H4-A1's Heavy chain variable region, the constant region of U6-HC7 hinge and human IgG1's constant region, the light chain include the light chain of huAbF46-H4-A1 Variable region and people's kappa constant region.Antibody huAbF46-H4-A1 (IgG2 hinge) is made of heavy chain and light chain, the heavy chain packet Containing heavy chain variable region, human IgG2's hinge area and human IgG1's constant region, the light chain include the light chain variable of huAbF46-H4-A1 Area and people's kappa constant region.Heavy chain variable region of the antibody huAbF46-H4-A1 (IgG2Fc) by huAbF46-H4-A1, human IgG2 Hinge area and human IgG2's constant region, and the light chain structure of the light chain variable region comprising huAbF46-H4-A1 and people's kappa constant region At.Therefore, in people's kappa constant region of light chain the 36th histidine residues changed into all three antibody tyrosine with Improve antibody tormation.

In order to for construct three kinds of antibody, coding by huAbF46-H4-A1 heavy chain variable region, U6-HC7 hinge area, and Polypeptide (the SEQ ID NO that human IgG1's constant region is constituted:62) polynucleotides (SEQ ID NO:63), coding is by huAbF46- Polypeptide (the SEQ ID NO that the heavy chain variable region of H4-A1, human IgG2's hinge area and human IgG1's constant region are constituted:64) multicore glycosides Acid (SEQ ID NO:65) heavy chain variable region by huAbF46-H4-A1, human IgG2's hinge area and human IgG2's constant region, are encoded Polypeptide (the SEQ ID NO of composition:66) polynucleotides (SEQ ID NO:67), and coding by huAbF46-H4-A1 light chain Polypeptide (the SEQ ID that variable region (the 36th histidine is wherein replaced with tyrosine residue) and people's kappa constant region are constituted NO:68) polynucleotides (SEQ ID NO:69) it is synthesized in Bioneer.Then, by the DNA piece with heavy chain nucleotide sequence Section insertion is packaged in OptiCHOTM antibody expression kit (catalogue number 12762-019, Invitrogen) In pOptiVECTM-TOPO TA Cloning Kit, and the DNA fragmentation with light chain nucleotide sequence is inserted into pcDNATM3.3- In TOPO TA Cloning Kit (catalogue number 8300-01), so that carrier construction is to express antibody.

The carrier of every kind of building is expanded using Qiagen Maxiprep kit (catalogue number 12662), and is used Freestyle^TM293 expression system of MAX (Invitrogen) implements transient expression.It is expressed using 293F cell, and will It is in the form of suspension culture in FreeStyle^TMIt is cultivated in 293 expression culture mediums.Before transient expression at 1 day, with 5x10⁵It is a thin Born of the same parents/ml concentration provides cell, and after 24 hours, reaches 1x10 in cell number⁶When a cell/ml, implement instantaneous table It reaches.By using Freestyle^TMThe liposome reagent method of MAX reagent (Invitrogen) implements transfection, wherein managing in 15ml In, by DNA with 1:1 (heavy chain DNA:Light chain DNA) mixing rate provide, and with 2ml OptiPro^TMSFM (invtrogen) (pipe A) is mixed, and in another 15ml pipe, by 100ul (microlitre) Freestyle^TMMAX reagent and 2ml OptiPro^TMSFM mixes (pipe B), then mixing tube A and pipe B, and incubates 15 minutes.Before the mixture and transient expression of acquisition The cell provided is slowly mixed together within 1 day.After completing transfection, by cell at 37 DEG C in 130rpm incubator, 80% humidity, and 8%CO₂Under conditions of incubate 5 days.

After centrifugation, supernatant is applied to AKTA Prime (GE Healthcare) with antibody purification.In this regard, 100mL supernatant is loaded into the flow velocity of 5mL/min equipped with albumin A column (GE healthcare, 17-0405-03) AKTA Prime, then with IgG elution buffer (Thermo Scientific, 21004) elution.Buffer is replaced with PBS Finally to purify 3 kinds of antibody (huAbF46-H4-A1 (U6-HC7), huAbF46-H4-A1 (IgG2 hinge) and huAbF46-H4- A1(IgG2Fc)).In three kinds of antibody, huAbF46-H4-A1 (IgG2Fc) representativeness is selected to be used for embodiment below, And referred to as anti-C-met antibodies L3-1Y/IgG2.

Reference example 2：The preparation of xenograft models and test sample

There is patient's derivative tumors tissue (tumour via intraperitoneal injection grafting：Non-small cell lung cancer (NSCLC)) 14 kinds Mice xenograft model is obtained from Oncotest GmbH (Germany).

Drug candidate final form (L3-1Y/IgG2 is applied to 14 kinds of mice xenograft models respectively：N (each mould Type)=10) and empty medium (control：N (each model)=10), and the tumor size in each model is measured, by This measures the response to antibody.

L3-1Y/IgG2 is weekly applied with the amount of 5mg/kg and (in the case where control, is applied PBS buffer solution), In tumor size from mice xenograft model reach 500mm³Or more when start to apply.Experiment is carried out in total 6 weeks, and reach 2000mm in tumor size³Or more when stop.

It is calculated by the following formula tumor size：

Tumor size (mm³)=(major diameter * minor axis * minor axis)/2

The measurement for implementing effect group is analyzed via ANOVA, and excluding p- value is 0.05 or smaller situation.Namely Say, by ANOVA analysis test it is following it is assumed that the distribution of tumor size is compared with antibody untreated fish group i.e. in antibody processing group Do not change, wherein being 0.05 or more hour in p- value, group is determined as non-effect group, and when p- value is more than 0.05, and group determines For effect group.

The response results from the above-mentioned mice xenograft model handled for L3-1Y/IgG2 are shown in table 9：

【Table 9】

Tumor tissues are extracted from mouse after completing above-mentioned experiment, their a part is prepared as what only formalin was fixed (FFPE) block through paraffin embedding, and remainder is carried out to use Qiagen RNeasy Mini according to the scheme of manufacturer The Total RNAs extraction of kit (catalogue number 74104).

Use Ventana MET IHC (immunohistochemistry) (Roche；US2013089541A1) according to the mark of manufacturer Quasi-project using the FFPE block of preparation to measure surface expression c-MET, and passes through real-time PCR (RT- using the total serum IgE extracted PCR) (MET sense primer：CCTTGAACAGAATCACTG(SEQ ID NO:272)；MET antisense primer： CCATGTTTCATGTATGGTA(SEQ ID NO:273)) measurement c-MET mRNA expression.

The result obtained from Ventana MET IHC is shown in Figure 1A.It is 2~3 in IHC score in this measuring method When, sample is determined as effect group.As shown in Figure 1A in addition LXFA297, LXFA983 and LXFA1041 (it is non-effect Power group) with 2~3 IHC score, the high precision selection for not providing effect or non-effect group this indicates IHC measuring method is (quasi- True property：About 50%).

Meanwhile shown in Figure 1B be determined as in figure 1A effect group 6 models (LXFA297, LXFA983, LXFA1041, LXFA623, LXFA526 and LXFA1647) acquisition RT-PCR result.In fig. ib, Y-axis is from RT-PCR The Ct value of measurement, X-axis are the IHC scores obtained above, and " ◆ " refers to non-effect group, and "●" refers to effect group.As shown in Figure 1B , according to RT-PCR's as a result, the Ct value in non-effect group is 0 or more, and the Ct value in effect group is less than 0.Cause This provides the more acurrate of non-effect or effect group according to the selection of RT-PCR result compared with previous existing IHC measuring method Select (accuracy：About 71% to about 93%).It therefore, can if mainly using RT-PCR result and additionally considering IHC score With realize more accurately selection (for example, RT-PCR Ct value less than 0 and when IHC score is 2 to 3, can choose sample conduct Effect group).

Embodiment 1：The selection of biomarker

Using the xenograft sample (14 kinds of preclinical samples) in reference example 2 to test the c- prepared in reference example 1 The effect of Met antibody L3-1Y/IgG2 measures the gene expression dose in L3-1Y/IgG2 effect and non-effect group.Use acquisition Gene expression dose, measure the difference (△ log2 (exp)) of gene expression between effect and non-effect group, and select imitating With the gene of difference in height between power and non-effect group.

Using 2.0 Microarray Experiments initial data of Affymatrix people u133plus (cell file), and use by The difference for the microarray analysis console measurement gene expression that Affymatrix is provided, (probe is strong by the log2 of every kind of probe of measurement Degree) value is for use as standard value.The probe used is summarized in table 10：

【Table 10】

Based on the expression difference measured between effect group and non-effect group, gene is listed from maximum to minimum.

The result of acquisition is summarized in table 11 (in table 11, between the bigger finger effect of delta expFold and non-effect Expression difference it is bigger)：

【Table 11】

Gene	ΔexprFold	Probe I D
			THSD7A	4.29	213894_at
THSD7A	4.29	214920_at
			THSD7A	3.73	230008_at
MET	2.64	213816_s_at
			RAB31	2.46	217763_s_at
RAB31	2.30	217764_s_at
			FAM126A	2.30	223625_at
PHC1	2.14	218338_at
			CHML	2.00	2263S0_at
FAM126A	2.00	227239_at
			ST8SIA4	2.00	242943_at
CAV1	1.62	212097_at

As shown in table 11, the expression difference between effect and non-effect is listed with following order：THSD7A > MET > RAB31 > FAM126A > PHC1 > CHML > ST8SIA4 > CAV1.

Select biomarker of 8 kinds of genes as the effect for measuring anti-C-met antibodies.

Embodiment 2：The selection of reference mark object

Use 120 lung cancer gland cancer microarray data (public DB-GEO in total：Gene expression complete or collected works；In ht:// Www.ncbi.nlm.nih.gov/geo/), the gene that there is the variation of low expression level in iuntercellular is selected.

For using affymetrix U133plus2.0 microarray from total serum IgE derived from the NSCLC tumour that GEO is obtained Initial data (cell file) measures log2 (int) value of each probe, and is listed in above-mentioned 120 sample rooms with low variation The gene of coefficient (CV).Then, selection has similar log2 with target gene (the 8 kinds of biomarkers selected in embodiment 1) (int) gene of Distribution value.The primer used is summarized in table 12：

【Table 12】

The result of acquisition is shown in Fig. 2A and 2B.As shown in Fig. 2A, selecting 10 kinds of genes, (it is with low gene table Up to variation), i.e. EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and TUT1 make For reference mark object.

Compared with previous existing crt gene, the variation and classification performance difference of the reference mark object of selection are measured (Oncotype DXTM；B referring to fig. 2).

The probe and primer of 10 kinds of reference mark objects for selection are summarized in table 13 and 14：

【Table 13】

【Table 14】

Using the 14 kinds of NSCLC mRNA samples and method as described above prepared in reference example 2,10 kinds of selection are measured The variation of CV (coefficient of variation) value of reference mark object and crt gene.

The result of acquisition is shown in Fig. 3 A (crt gene) and 3B (the reference mark object of selection).As shown in Fig. 3 A and 3B Show, the average CV value of 10 kinds of reference mark objects of selection is 11.770, with previous existing crt gene (Oncotype DX^TM) average CV value (average CV=15.40335) compared to reducing quite a lot of.In 10 kinds of reference mark objects, 5 kinds of genes RPL23A, TPT1, MATR3, SRSF3 and HNRNPC show especially low changes in gene expression (the average CV value of 5 kinds of genes =8.39).

Embodiment 3：The effect group of anti-C-met antibodies is selected using the biomarker and reference mark object of selection

The biomarker of selection and reference mark object are applied to mice xenograft model, and check marker Effect/non-effect group selection accuracy.

In this regard, by the total serum IgE extracted from the tumor tissues of mice xenograft model carry out using table 15 probe and PCR of the primer of table 16 under conditions of table 17, obtain 8 kinds of biomarkers and 5 kinds of reference mark objects (TPT1, EEF1M, TUT1, MATR3 and SMARCA4) Ct value.

【Table 15】

【Table 16】

【Table 17】

Implement the measurement of effect or non-effect group according to table 18：

【Table 18】

In table 18：

" reference standard value " is for CAV1, FAM126A, MET, RAB31, ST8SIA4 and THSD7A, numerical value=[Min (effect Force value (Δ Ct))+Max (non-effect value (Δ Ct))]/2；

" reference standard value " for CMHL and PHC1=[Min (non-effect value (Δ Ct))+Max (effect value (Δ Ct))]/ 2；

ΔCt：The biology of Average Ct values-every kind of 5 kinds of reference mark objects (TPT1, EEF1M, TUT1, MATR3 and SMARCA) The Ct value of marker)；

Min (effect value (Δ Ct))：The minimum delta Ct of effect group；

Max (non-effect value (Δ Ct))：The maximum Δ Ct of non-effect group；

Min (non-effect value (Δ Ct))：The minimum delta Ct of non-effect group；With

Max (effect value (Δ Ct))：The maximum Δ Ct of effect group；

By the Δ Ct value calculated every kind of biomarker compared with the numerical value of table 18.In CAV1, FAM126A, MET, In the case where RAB31, RAB31, ST8SIA4 and THSD7A, it is higher than the numerical value of table 18 in the Δ Ct value of single biomarker When, sample is determined as effect group, and in the case where CMHL and PHC1, is lower than table 18 in the Δ Ct value of single biomarker Numerical value when, sample is determined as effect group.

Show that effect/non-effect group measurement of 14 kinds of mice xenograft models of reference example 2 is accurate in table 19 Property and Δ fold values.

【Table 19】

(accuracy：Using the accuracy for the prediction Antibody Efficacy that every kind of biomarker obtains, as numerical value is closer to 1 (corresponding to 100%), accuracy is higher, and is calculated by the following formula：

Accuracy={ (TP+TN)/14 }

(TP：Using biomarker efficacy predictions and using L3-1Y/IgG2 treatment actual experiment in (see Table 9) display positive findings sample number)

(TN：Using biomarker efficacy predictions and using L3-1Y/IgG2 treatment actual experiment in (see Table 9) display negative findings sample number)

Δ multiple：(crt gene (reference mark object) Ct is (if referring to mark by delta Ct between effect and non-effect group The number of will object is two or more, then it means " Average Ct values of reference mark object ")-target gene (biomarker) Ct difference), instruction can distinguish the mRNA expression range of effect and non-effect group).

As shown in table 19, the effect of anti-C-met antibodies is may be implemented in the biomarker and reference mark object of selection It is measured with the pin-point accuracy of non-effect group, accuracy is at least about 60%, for example, at least about 80%.

It should be appreciated that only with descriptive sense rather than should consider illustrative implementation described herein to limit purpose Scheme.The description of features or aspect in each embodiment should have been generally acknowledged that the other classes that can be used in other embodiments As features or aspect.

All references cited herein, including publication, patent application and patent pass through herein to be referred to and being incorporated to, Its degree just as every bibliography individually and be explicitly indicated for by refer to be incorporated to and herein completely list.

In describing background of the invention (especially in the background of the appended claims) using term "one" and " one Kind " and " described/should " and " at least one/kind " and similar indicant should be construed as covering odd number and plural number the two, unless Indicated otherwise or context herein is clearly contradicted.Term " at least one/kind " and the adjoint one or more item (examples of a batch Such as, " at least one of A and B ") use should be construed as meaning selected from one (A or B) for listing item or two or more Kind lists any combination (A and B) of item, and unless otherwise indicated herein or context is clearly contradicted.Term "comprising", " tool Have ", " comprising " and " containing " should be construed as open-ended term (this means that " including but not limited to "), unless otherwise record. The narration of numberical range herein, which is intended merely to serve as, individually refers to the shorthand method for falling into each separate value in range, unless It is indicated otherwise herein, and each separate value is incorporated to specification just as its individually narration herein.It can be to appoint What suitable order implements all methods described herein, and unless otherwise indicated herein or context is in addition clearly contradicted. The use of any and all examples or exemplary language (such as " such as ") provided herein is intended merely to more preferably illustrate this hair It is bright, and the scope of the present invention is not caused to limit, Unless Otherwise Requested.Language in specification should not be construed as indicating any Not claimed element is necessary to practice of the invention.

There is described herein the preferred embodiments of the invention, including it is for carrying out the present invention known for inventor best Mode.The modification of those preferred embodiments after reading foregoing description for those of ordinary skill in the art can become it is aobvious and It is clear to.The expected those of skill in the art of inventor use such modification in due course, and inventor be intended to the present invention with herein In the different mode that is expressly recited implement.Thus, the present invention includes chatting in applicable the appended claims being allowed by the law The all modifications and equivalent program for the theme stated.In addition, the present invention covers the above-described element in its all possible modification Any combination, unless otherwise indicated herein or context is in addition clearly contradicted.

Claims

1. the molecule or reagent for detecting biomarker are preparing one kind for predicting anti-C-met antibodies or its antigen binding Segment is in the effect treated in non-small cell lung cancer or is the anti-C-met antibodies of application or the selection of its antigen-binding fragment with non-small Purposes in the composition of cell lung cancer subject, wherein the biomarker is

THSD7A, or

THSD7A and at least one combination selected from the group below：MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1,

Wherein the anti-C-met antibodies or the specific binding of its antigen-binding fragment, which have, is selected from SEQ ID NO:71 amino acid Sequence and include SEQ ID NO:The epitope of 73 5 to 19 continuous amino acids.

2. the purposes of claim 1, it is characterised in that determine the anti-C-met antibodies or its antigen-binding fragment in following situation When can the effective or subject be suitble to using the anti-C-met antibodies or its antigen-binding fragment：

In the case where CAV1, FAM126A, MET, RAB31, ST8SIA4 and/or THSD7A, the biomarker is being come from Level in the biological sample of the subject is higher than the level of reference mark object or reference sample；Or

In the case where CMHL and/or PHC1, water of the biomarker in the biological sample from the subject The flat level for being lower than reference mark object or reference sample；

Wherein the reference mark object is at least one selected from the group below：EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and TUT1, and the reference sample is the wherein anti-C-met antibodies or its antigen Binding fragment does not have virtuous sample.

3. the purposes of claim 1, wherein the anti-C-met antibodies or its antigen-binding fragment include：

At least one complementary determining region of heavy chain (CDR) selected from the group below：(a) CDR-H1, it includes SEQ ID NO:4；(b)CDR- H2, it includes SEQ ID NO:5, SEQ ID NO:2, or include SEQ ID NO:2 8-19 continuous amino acid and include SEQ ID NO:2 the 3rd to the 10th amino acid sequence；(c) CDR-H3, it includes SEQ ID NO:6, SEQ ID NO:85, Or include SEQ ID NO:85 6-13 continuous amino acid and include SEQ ID NO:85 the 1st to the 6th amino acid sequence Column；

At least one complementary determining region of light chain selected from the group below：(a) CDR-L1, it includes SEQ ID NO:7, (b) CDR-L2, Include SEQ ID NO:8, and (c) CDR-L3, it includes SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:86, or packet The NO of ID containing SEQ:89 9-17 continuous amino acid and include SEQ ID NO:89 the 1st to the 9th amino acid sequence；Or A combination thereof.

4. the purposes of any one of claims 1 to 3, wherein the molecule or reagent for detecting biomarker includes choosing From SEQ ID NO:At least one probe of 109-259 is selected from SEQ ID NO:At least pair of primers or its group of 270-285 It closes.