JP6591772B2 - Biomarker for anti-c-Met antibody efficacy prediction - Google Patents

Description

  A biomarker for anti-c-Met antibody drug efficacy prediction and / or selection of anti-c-Met antibody application target, a reference marker for gene expression level comparison, and a step of measuring the biomarker level in a biological sample c Provided are a method for predicting Met antibody drug efficacy and / or a method for selecting an anti-c-Met antibody application target, and a method for preventing and / or treating cancer comprising the step of administering an anti-c-Met antibody to the selected target. .

  Since 1998, Genentech's Herceptin-targeted therapeutic agent FDA (US Food & Drug Association) has been approved, and various methods of personalized medicine have been introduced. . In the case of Herceptin, patients are selected based on the expression level of HER2 growth factor receptor expressed in the cell membrane of cancer cells. Since the development of the IHC (immunohistochemistry) inspection method, various techniques including ICH techniques such as FISH (fluorescence in situ hybridization) and CISH (chromogenic in situ hybridization) have been introduced to patient screening. Subsequently, EGFR mutations, Vectibix (R) and Erbitux (R) as selection markers for patients (lung and pancreatic cancer) in Erlotinib (Tarceva, Tarceva, Genentech) ) KRAS mutation as a selection marker for Erbitux patients (colon cancer) was approved.

  For anti-cancer agents that target c-Met protein, research is currently being conducted on markers for selecting patients with good efficacy. In recent years, among the new c-Met target drugs, Phase III clinical trials have been conducted on Genentech's MetMab (registered trademark). At this time, as a companion diagnostic method, the Ventana IHC assay (sp44: c) -Met primary antibody, rabbit monoclonal) and c-Met protein overexpression is applied. However, when other samples are tested in this way, accurate results may not be obtained, and there is a limit to use as a general diagnostic means.

  Also, the IHC method has the disadvantage that the result value is not constant due to individual differences among experimenters, the lesion site, the propensity of the pathologist, and the like.

  In order to further enhance the efficacy of treatment using c-Met target anticancer drug, development of biomarker and drug efficacy prediction technology for predicting the efficacy of the target anticancer drug and / or selecting patients suitable for application of the drug Is required.

  One embodiment of the present invention provides a biomarker for anti-c-Met antibody efficacy prediction and / or anti-c-Met antibody target selection.

  In another embodiment of the present invention, the anti-c-Met antibody efficacy prediction and / or anti-c-Met antibody application target composition comprising the biomarker detection means (for example, detection molecule or preparation) And provide kits.

  Another embodiment of the present invention provides a reference marker for comparing the level of a biomarker for predicting the efficacy of the anti-c-Met antibody and / or selecting an anti-c-Met antibody application target.

  Another embodiment of the present invention is a method for predicting the efficacy of an anti-c-Met antibody and / or selecting a target for application of an anti-c-Met antibody, comprising measuring the presence and / or level of the biomarker in a biological sample. I will provide a.

  Another embodiment of the present invention provides a method for preventing and / or treating cancer comprising administering an anti-c-Met antibody to the selected anti-c-Met antibody application target.

  Another embodiment of the present invention provides a c-Met suppression method comprising the step of administering an anti-c-Met antibody to the selected anti-c-Met antibody application target.

The present invention has the following contents.
(1) Anti-c-Met antibody or antigen binding thereof comprising a molecule or preparation for detection of one or more biomarkers selected from the group consisting of THSD7A, MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4 and CAV1 A composition for predicting the efficacy of a fragment or selecting an application target.
(2) The anti-biomarker according to (1), wherein the biomarker is a combination of THSD7A; or THSD7A and one or more selected from the group consisting of MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1. A composition for predicting the efficacy of a c-Met antibody or an antigen-binding fragment thereof or selecting an application target.
(3) The anti-biomarker according to (1), wherein the biomarker is MET; or a combination of MET and one or more selected from the group consisting of THSD7A, RAB31, FAM126A, PHC1, CHML, ST8SIA4 and CAV1. A composition for predicting the efficacy of a c-Met antibody or an antigen-binding fragment thereof or selecting an application target.
(4) The anti-biomarker according to (1), wherein the biomarker is RAB31; or RAB31 and one or more selected from the group consisting of THSD7A, MET, FAM126A, PHC1, CHML, ST8SIA4 and CAV1. A composition for predicting the efficacy of a c-Met antibody or an antigen-binding fragment thereof or selecting an application target.
(5) The biomarker is FAM126A; or a combination of FAM126A and one or more selected from the group consisting of THSD7A, MET, RAB31, PHC1, CHML, ST8SIA4, and CAV1, according to (1) A composition for predicting the efficacy of an anti-c-Met antibody or an antigen-binding fragment thereof or selecting an application target.
(6) The biomarker is at least two kinds selected from the group consisting of THSD7A, MET, RAB31 and FAM126A, and is used for predicting or applying the anti-c-Met antibody or antigen-binding fragment thereof according to (1) Composition for sorting.
(7) additionally comprising a molecule or preparation for detection of one or more reference markers selected from the group consisting of EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARAC4, WDR90 and TUT1. A composition for predicting the efficacy or selecting an application target of the anti-c-Met antibody or antigen-binding fragment thereof according to any one of (6) to (6).
(8) The detection molecule or preparation is a primer, probe or aptamer that can hybridize with the biomarker or reference marker, or an antibody or aptamer that specifically binds to a protein encoded by the biomarker or reference marker, Alternatively, a composition for predicting the efficacy or selecting an application target of the anti-c-Met antibody or antigen-binding fragment thereof according to (7), which is a combination thereof.
(9) The detection molecule or preparation may be one or more probes selected from SEQ ID NOs: 109 to 269, one or more primers selected from SEQ ID NOs: 270 to 305, or a combination thereof. A composition for predicting the efficacy or selecting an application target of the anti-c-Met antibody or antigen-binding fragment thereof according to any one of (1) to (8).
(10) The anti-c-Met antibody or antigen-binding fragment thereof specifically binds to an epitope comprising 5 to 19 consecutive amino acids including SEQ ID NO: 73 (EEPSQ) of the amino acid sequence of SEQ ID NO: 71. A composition for predicting the efficacy or selecting an application target of the anti-c-Met antibody or antigen-binding fragment thereof according to any one of (1) to (9).
(11) The anti-c-Met antibody or antigen-binding fragment thereof according to (10), wherein the c-Met antibody or antigen-binding fragment thereof includes any one of the following (i) to (iv): Or composition for selection of application target;
(I) one or more heavy chain complementarity determining regions selected from the group consisting of the following CDR-H1 to CDR-H3, or a heavy chain variable region comprising the one or more heavy chain complementarity determining regions; SEQ ID NO: CDR-H1 having the amino acid sequence of 4, amino acid sequence of SEQ ID NO: 5, amino acid sequence of SEQ ID NO: 2, or continuous 8 to 19 amino acids from the 3rd amino acid to the 10th amino acid in the amino acid sequence of SEQ ID NO: 2 CDR-H2 having an amino acid sequence consisting of amino acids, amino acid sequence of SEQ ID NO: 6, amino acid sequence of SEQ ID NO: 85, or 6 to 13 consecutive amino acids including amino acids 1 to 6 in the amino acid sequence of SEQ ID NO: 85 CDR-H3 having an amino acid sequence consisting of the amino acids
(Ii) one or more light chain complementarity determining regions selected from the group consisting of the following CDR-L1 to CDR-L3, or a light chain variable region comprising the one or more light chain complementarity determining regions; SEQ ID NO: CDR-L1 having an amino acid sequence of 7 amino acid sequences, CDR-L2 having an amino acid sequence of SEQ ID NO: 8, amino acid sequence of SEQ ID NO: 9, amino acid sequence of SEQ ID NO: 15, amino acid sequence of SEQ ID NO: 86, or SEQ ID NO: 89 CDR-L3 having an amino acid sequence consisting of 9 to 17 amino acids including the first to ninth amino acids in the amino acid sequence of
(Iii) A combination of the heavy chain complementarity determining region and the light chain complementarity determining region (iv) A combination of the heavy chain variable region and the light chain variable region.
(12) measuring the expression level of the target gene in the biological sample; and comparing the expression level of the target gene with the expression level of the reference marker in the biological sample, wherein the reference marker is EEF1A1, RPL23A , TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARAC4, WDR90, and TUT1 selected from the group consisting of TUT1 gene expression level measurement method.
(13) Gene expression level measurement including a molecule or preparation for detection of one or more reference markers selected from the group consisting of EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARAC4, WDR90, and TUT1 Composition.
(14) The detection molecule or preparation is a primer, probe or aptamer that can hybridize with the reference marker, or an antibody or aptamer that specifically binds to a protein encoded by the reference marker, or a combination thereof. (13) The composition for measuring gene expression level according to (13).

It is a figure which shows the efficacy group and non-efficacy group judgment result obtained using the Ventana MET IHC method with respect to a mouse | mouth xenograft model. It is a graph which shows the efficacy group and non-efficacy group judgment result obtained through RT-PCR (X axis: IHC score, ♦: non-efficacy group, ●: efficacy group). It is a graph which shows the expression level of a reference | standard marker (control gene). It is a graph which shows the expression level of a reference | standard marker (control gene). It is a graph which shows the result of having measured the expression level of the control gene using the specific primer. It is a graph which shows the result of having measured the expression level of the selected reference marker using a specific primer.

  By comparing the gene expression levels of a group showing efficacy against anti-c-Met antibody (efficacy group) and a group showing no effect (non-efficacy group), a gene having a large difference is selected, and the selected gene or The protein encoded thereby is proposed as a biomarker for predicting the efficacy of anti-c-Met antibodies. In addition, a gene having no difference in expression level or a small difference in expression level between individual cells even in the same type of cell is selected, and the selected gene or the protein encoded thereby is selected as the target gene and / or target protein. It is proposed as a reference marker that can be used as a control when comparing the expression level of.

  Using the biomarkers and / or fiducial markers proposed in the present invention, patients suitable for application of anti-c-Met antibodies can be selected with high accuracy, and thus the anti-c-Met can be selected in individual patients. Treatment tailored to each patient is possible so as to maximize the efficacy of the antibody, and can be usefully used in clinical trials of the anti-c-Met antibody.

  Specifically, one embodiment is used for anti-c-Met antibody efficacy prediction and / or anti-c-Met antibody application target selection for genes showing differential expression between anti-c-Met antibody efficacy groups and non-efficacy groups. Provides use as a biomarker.

  In one embodiment, the biomarker may be one or more selected from the group consisting of THSD7A, MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1. The biomarker may be one or more selected from the group consisting of full-length DNA, cDNA, mRNA, and proteins encoded by the aforementioned genes. The genes that can be used as the biomarkers are summarized in Table 1 below:

  If the biomarkers are listed in descending order from those with large expression difference between the efficacy group and the non-efficacy group, they are THSD7A, MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1. For more accurate efficacy prediction or application target selection, those having a large expression difference between the efficacy group and the non-efficacy group can be preferentially selected and used as the biomarker. Accordingly, in one embodiment, the biomarker may additionally include one or more selected from the group consisting of the remaining genes in addition to the preferentially selected genes.

In one embodiment, the biomarker is
(1) THSD7A;
(2) A combination of THSD7A and one or more selected from the group consisting of MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1;
(3) MET;
(4) A combination of MET and one or more selected from the group consisting of THSD7A, RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1;
(5) THSD7A and MET combination;
(6) A combination of THSD7A and MET and one or more selected from the group consisting of RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1;
(7) RAB31;
(8) A combination of RAB31 and one or more selected from the group consisting of THSD7A, MET, FAM126A, PHC1, CHML, ST8SIA4, and CAV1;
(9) Two or more selected from the group consisting of THSD7A, MET, and RAB31 (in this case, the combination of THSD7A and MET may be excluded);
(10) A combination of two or more selected from the group consisting of THSD7A, MET, and RAB31 and one or more selected from the group consisting of FAM126A, PHC1, CHML, ST8SIA4, and CAV1;
(11) FAM126A;
(12) A combination of FAM126A and one or more selected from the group consisting of THSD7A, MET, RAB31, PHC1, CHML, ST8SIA4, and CAV1;
(13) Two or more selected from the group consisting of THSD7A, MET, RAB31 and FAM126A (At this time, two or more selected from the group consisting of THSD7A, MET and RAB31 may be excluded); or ( 14) A combination of two or more selected from the group consisting of THSD7A, MET, RAB31 and FAM126A and a combination of one or more selected from the group consisting of PHC1, CHML, ST8SIA4 and CAV1.

  In another embodiment, genes that have a small difference in expression level even if the cell types are different and / or genes that have a small difference in expression level in individual cells even in the same type of cell are searched for and the expression of these target genes It provides a use as a reference marker (control gene) for use as a comparison reference (reference, control) in level comparison. The target gene may be any gene whose expression level is to be measured. For example, the gene of interest may be a biomarker for predicting the efficacy of the previously selected anti-c-Met antibody and / or selection of an application target of the anti-c-Met antibody, in which case the reference marker is an anti-c- -It can be used as a comparative standard for predicting the efficacy of Met antibody and / or measuring the expression level of a target gene at the time of selection of application target of anti-c-Met antibody.

  In the measurement of the gene expression level of the target gene, if the gene used as a reference for comparison (reference, control) differs depending on the cell type, or the expression level in individual cells differs even in the same type of cell, the correct target gene It becomes difficult to measure the expression level. For this reason, it is important to select an appropriate reference marker in order to accurately measure the expression level of the target gene.

  In one embodiment, the reference marker is selected from endogenous genes essential for cell survival. For example, the reference marker may be one or more selected from the group consisting of EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARAC4, WDR90, and TUT1. Since the expression levels of RPL23A, TPT1, MATR3, SRSF3, and HNRNPC are maintained at a very constant level (see Example 1), in one embodiment, the reference marker is RPL23A, TPT1, MATR3, SRSF3, and NNRNPC One or more selected from the group consisting of: optionally, one or more selected from the group consisting of EEF1A1, HUWE1, SMARAC4, WDR90, and TUT1 may additionally be included, but is not limited thereto. . In one embodiment, the reference marker may include RPL23A, TPT1, MATR3, SRSF3, and HNRNPC. Alternatively, fiducial markers can include TPT1, EEF1M, TUT1, MATR3, and SMARCA4.

  The reference marker may be at least one selected from the group consisting of full-length DNA, cDNA, mRNA, and protein encoded thereby. At this time, the test target cells may be lung cancer cells, for example, lung adenocarcinoma, non-small cell lung cancer, and the like, but is not limited thereto. The genes that can be used as the reference marker are summarized in Table 2 below:

  In another embodiment, a method for determining (or evaluating) the expression level of a target gene using a reference marker as a comparison reference, wherein the reference marker is EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, A method is provided that is at least one selected from the group consisting of SMARCA4, WDR90, and TUT1. The method of determining (or evaluating) the expression level of a gene can include measuring the expression level of a target gene in a biological sample and comparing the expression level of the target gene with the expression level of a reference marker. The method of determining (or evaluating) the expression level of a gene may further comprise measuring the expression level of a reference marker. The expression level of a gene can be a cell, tissue isolated from a living body, or a gene (DNA or RNA) or protein extracted therefrom. The expression level can be measured by measuring the amount of the gene itself (for example, full-length DNA, cDNA, mRNA, etc.) or the amount of the protein encoded by the gene in a biological sample separated from the living body. In other embodiments, EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARAC4, WDR90, and TUT1 for determining (or evaluating) the expression level of a target gene in a biological sample isolated from a living body. One or more uses selected from the group consisting of:

  For example, the method of determining (or evaluating) the expression level of the gene comprises the steps of measuring the expression level of the target gene in the biological sample; and the expression level of the target gene as the expression level of the reference marker in the biological sample. A step of comparing can be included. At this time, the method may additionally include the step of measuring the expression level of the reference marker in the biological sample.

  The target gene is a target gene whose expression level is to be measured.

  Other embodiments include predicting anti-c-Met antibody efficacy (or subject responsiveness or sensitivity to anti-c-Met antibodies) to a subject comprising means for detecting the biomarker or a protein encoded by the biomarker and A composition for selection of an application target of an anti-c-Met antibody is provided. The anti-c-Met antibody efficacy prediction and / or anti-c-Met antibody composition for selection of the application target comprises the reference marker gene (full-length DNA, cDNA, or mRNA) or the protein encoded by the reference marker gene. It may additionally contain a detection molecule or formulation.

  Other embodiments include predicting anti-c-Met antibody efficacy (or subject responsiveness or sensitivity to anti-c-Met antibodies) to a subject comprising means for detecting the biomarker or a protein encoded by the biomarker and A kit for selecting an application target of anti-c-Met antibody is provided. The anti-c-Met antibody efficacy prediction and / or anti-c-Met antibody selection kit is for detecting the reference marker gene (full-length DNA, cDNA, or mRNA) or a protein encoded by the reference marker gene It may additionally contain molecules or compositions.

  In other embodiments, a reference marker composition (full-length DNA, cDNA, or mRNA) or an expression level of a reference marker composition or target gene comprising a molecule or composition for detection of a protein encoded by the reference marker gene is measured ( A kit for determining or evaluating) is provided. In one embodiment, when the target gene is the aforementioned biomarker, the composition or kit is used for anti-c-Met antibody efficacy prediction and / or anti-c-Met antibody application target selection for a subject. Can be done.

  The biomarker detection means or the reference marker detection means may be a means (for example, a detection molecule or a preparation) used in the aforementioned gene quantification or protein quantification method. For example, the biomarker detection means or reference marker detection means (detection molecule or preparation) is a primer, probe or aptamer that specifically binds (hybridizes) to the biomarker or reference marker gene, or It may be an antibody or aptamer that specifically binds to a protein encoded by the biomarker or reference marker gene, or a combination thereof. The primer is the full length of the biomarker gene (full length DNA, cDNA, or mRNA) or the reference marker gene (full length DNA, cDNA, or mRNA), or continuous 5-1000 bp in the base sequence of these genes, for example, 10 -500 bp, 20-200 bp, or 50-200 bp gene fragments can be detected, such as the full length of the gene or the consecutive 5'-100 bp of the 3'-end and 5'-end of the gene fragment, for example, , 5-50 bp, 5-30 bp, or having or consisting of a base sequence that can hybridize with a 10-25 bp site (eg, complementary). The probe or aptamer may have or consist of a nucleotide sequence having a size of, for example, 5 to 100 bp, 5 to 50 bp, 5 to 30 bp, or 10 to 25 bp, and the biomarker gene or the reference marker gene (full-length DNA , CDNA, or mRNA) having a base sequence capable of hybridizing (for example, complementary) to a continuous 5 to 100 bp, for example, 5 to 50 bp, 5 to 30 bp, or 10 to 25 bp site in the base sequence of May consist of: Said “hybridizable” means 80% or more, for example 90% or more, 95% or more, 98% or more, 99%, between the base sequence of the primer, probe or aptamer and the base sequence of the specific region of the gene. By the above or 100% sequence complementarity, it means that it can be complementarily bound to the gene specific region.

  Probes or primers that can be used for detection of the biomarker or reference marker in one embodiment are shown in Tables 3 to 5 below.

  In one embodiment, the probe that can be used for detection of the biomarker THSD7A may be one or more selected from the group consisting of SEQ ID NO: 109 to SEQ ID NO: 142, such as the probe of SEQ ID NO: 109, SEQ ID NO: 110 It may be one or more selected from the group consisting of a probe set comprising SEQ ID NO: 120, a probe set comprising SEQ ID NO: 121 to SEQ ID NO: 131, and a probe set comprising SEQ ID NO: 132 to SEQ ID NO: 142. The primer that can be used for the detection of the biomarker THSD7A can be, but is not limited to, the primer of SEQ ID NO: 270, the primer of SEQ ID NO: 271 or a primer pair containing them.

  The probe that can be used for the detection of the biomarker MET may be one or more selected from the group consisting of SEQ ID NO: 143 to SEQ ID NO: 154, for example, the probe of SEQ ID NO: 143, SEQ ID NO: 144 to SEQ ID NO: 154 It can be a probe set comprising, or a combination thereof. The primer that can be used for the detection of the biomarker MET may be, but is not limited to, the primer of SEQ ID NO: 272, the primer of SEQ ID NO: 273, or a primer pair containing them.

  The probe that can be used for detection of the biomarker RAB31 may be one or more selected from the group consisting of SEQ ID NO: 155 to SEQ ID NO: 177, for example, the probe of SEQ ID NO: 155, SEQ ID NO: 156 to SEQ ID NO: 166 And one or more selected from the group consisting of a probe set comprising SEQ ID NO: 167 to SEQ ID NO: 177. The primer that can be used for the detection of the biomarker RAB31 may be, but is not limited to, the primer of SEQ ID NO: 278, the primer of SEQ ID NO: 279, or a primer pair containing them.

  The probe that can be used for detection of the biomarker FAM126A may be one or more selected from the group consisting of SEQ ID NO: 178 to SEQ ID NO: 200 and SEQ ID NO: 225 to SEQ ID NO: 235, for example, the probe of SEQ ID NO: 178, It may be one or more selected from the group consisting of a probe set comprising SEQ ID NO: 179 to SEQ ID NO: 189, a probe set comprising SEQ ID NO: 190 to SEQ ID NO: 200, and a probe set comprising SEQ ID NO: 225 to SEQ ID NO: 235. The primer that can be used for the detection of the biomarker FAM126A can be, but is not limited to, the primer of SEQ ID NO: 274, the primer of SEQ ID NO: 275, or a primer pair containing them.

  The probe that can be used for detection of the biomarker PHC1 may be one or more selected from the group consisting of SEQ ID NO: 201 to SEQ ID NO: 212. For example, the probe of SEQ ID NO: 201, SEQ ID NO: 202 to SEQ ID NO: 212 It can be a probe set comprising, or a combination thereof. The primer that can be used for the detection of the biomarker PHC1 can be, but is not limited to, the primer of SEQ ID NO: 276, the primer of SEQ ID NO: 277, or a primer pair containing these.

  The probe that can be used for detection of the biomarker CHML may be one or more selected from the group consisting of SEQ ID NO: 213 to SEQ ID NO: 224, for example, the probe of SEQ ID NO: 213, SEQ ID NO: 214 to SEQ ID NO: 224 It can be a probe set comprising, or a combination thereof. The primer that can be used for detection of the biomarker CHML can be, but is not limited to, the primer of SEQ ID NO: 282, the primer of SEQ ID NO: 283, or a primer pair containing them.

  The probe that can be used for the detection of the biomarker ST8SIA4 may be one or more selected from the group consisting of SEQ ID NO: 236 to SEQ ID NO: 247, for example, the probe of SEQ ID NO: 236, SEQ ID NO: 237 to SEQ ID NO: 247, It can be a probe set comprising, or a combination thereof. The primer that can be used for the detection of the biomarker ST8SIA4 may be, but is not limited to, the primer of SEQ ID NO: 280, the primer of SEQ ID NO: 281 or a primer pair containing them.

  The probe that can be used for the detection of the biomarker CAV1 may be one or more selected from the group consisting of SEQ ID NO: 248 to SEQ ID NO: 259, for example, the probe of SEQ ID NO: 248, SEQ ID NO: 249 to SEQ ID NO: 259 It can be a probe set comprising, or a combination thereof. The primer that can be used for the detection of the biomarker CAV1 can be, but is not limited to, the primer of SEQ ID NO: 284, the primer of SEQ ID NO: 285, or a primer pair containing them.

  The probe that can be used to detect the reference marker EEF1A1 may be the probe of SEQ ID NO: 262, but is not limited thereto. The primer that can be used for the detection of the reference marker EEF1A1 can be, but is not limited to, the primer of SEQ ID NO: 290, the primer of SEQ ID NO: 291, or a primer pair containing them.

  The probe that can be used to detect the reference marker RPL23A may be the probe of SEQ ID NO: 260, but is not limited thereto. The primer that can be used for the detection of the fiducial marker RPL23A may be, but is not limited to, the primer of SEQ ID NO: 286, the primer of SEQ ID NO: 287, or a primer pair including these.

  The probe that can be used to detect the reference marker TPT1 may be the probe of SEQ ID NO: 261, but is not limited thereto. The primer that can be used for the detection of the reference marker TPT1 can be, but is not limited to, the primer of SEQ ID NO: 288, the primer of SEQ ID NO: 289, or a primer pair containing them.

  The probe that can be used to detect the fiducial marker HUWE1 may be the probe of SEQ ID NO: 266, but is not limited thereto. The primer that can be used to detect the fiducial marker HUWE1 can be, but is not limited to, the primer of SEQ ID NO: 298, the primer of SEQ ID NO: 299, or a primer pair containing them.

  The probe that can be used to detect the fiducial marker MATR3 may be the probe of SEQ ID NO: 268, but is not limited thereto. The primer that can be used for the detection of the fiducial marker MATR3 can be, but is not limited to, the primer of SEQ ID NO: 302, the primer of SEQ ID NO: 303, or a primer pair including these.

  The probe that can be used to detect the reference marker SRSF3 may be the probe of SEQ ID NO: 263, but is not limited thereto. The primer that can be used for the detection of the reference marker SRSF3 may be, but is not limited to, the primer of SEQ ID NO: 292, the primer of SEQ ID NO: 293, or a primer pair containing them.

  The probe that can be used to detect the fiducial marker HNRNPC can be the probe of SEQ ID NO: 265, but is not limited thereto. The primer that can be used for the detection of the fiducial marker HNRNPC can be, but is not limited to, the primer of SEQ ID NO: 296, the primer of SEQ ID NO: 297, or a primer pair containing them.

  The probe that can be used to detect the fiducial marker SMARCA4 may be the probe of SEQ ID NO: 269, but is not limited thereto. The primer that can be used for detection of the fiducial marker SMARCA4 can be, but is not limited to, the primer of SEQ ID NO: 304, the primer of SEQ ID NO: 305, or a primer pair containing them.

  The probe that can be used to detect the fiducial marker WDR90 may be the probe of SEQ ID NO: 267, but is not limited thereto. The primer that can be used to detect the fiducial marker WDR90 may be, but is not limited to, the primer of SEQ ID NO: 300, the primer of SEQ ID NO: 301, or a primer pair including these.

  The probe that can be used to detect the fiducial marker TUT1 may be the probe of SEQ ID NO: 264, but is not limited thereto. The primer that can be used for the detection of the reference marker TUT1 can be, but is not limited to, the primer of SEQ ID NO: 294, the primer of SEQ ID NO: 295, or a primer pair containing them.

  Other embodiments include determining the presence and expression level of the biomarker in the biological sample and the efficacy of the anti-c-Met antibody against the subject (or the responsiveness of the subject to the anti-c-Met antibody or Sensitivity) A prediction method, a method for selecting (or identifying) an anti-c-Met antibody application target, or a method for providing information to an anti-c-Met antibody application target is provided. In the method, the step of measuring the presence / absence and the expression level of the biomarker can be performed by using the reference marker as a reference (control) for comparison.

  For example, in the case of CAV1, FAM126A, MET, RAB31, ST8SIA4, and / or THSD7A, when the expression level of these genes is high, treatment with an anti-c-Met antibody is effective or anti-c-Met It can be determined that the subject is suitable for application of the antibody. In the case of CMHL and / or PHC1, when the expression level is low, it can be determined that treatment with an anti-c-Met antibody is effective or suitable for application of an anti-c-Met antibody. it can.

  In one embodiment of the invention, the method comprises the steps of measuring the expression level of a biomarker in a biological sample; and comparing the expression level of the biomarker with the expression level of a reference marker in the biological sample, Is one or more genes selected from the group consisting of THSD7A, MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1, or an anti-c-Met antibody or antigen thereof, which is a protein encoded by the gene Methods are provided for collecting data for binding fragment efficacy or application selection.

  The evaluation of the expression level of the biomarker can be performed in comparison with the expression level of the reference marker. For example, the evaluation of the expression level of the biomarker and the efficacy of anti-c-Met antibody and / or determination of whether it is suitable for application of anti-c-Met antibody are determined by PCR (Polymerase Chain Reaction; for example, competitive PCR (Competitive PCR). ), Real-time PCR (RT-PCR), etc.), as described in Table 6 below.

  (ΔCt (threshold cycle): Ct value of reference marker (when two or more reference markers are measured, the average value thereof)-Ct value of biomarker).

  In Table 6, the reference marker means one or more selected from the group consisting of the aforementioned EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARAC4, WDR90, and TUT1.

  Anti-c-Met antibody efficacy prediction method, anti-c-Met antibody application target selection method, anti-c-Met antibody efficacy prediction method or anti-c-Met antibody application target selection method A step of measuring a standard reference value (see Table 6) for can be included. For example, the measurement of the standard reference value is performed by (i) a population known to be sensitive to anti-c-Met antibody (efficacy group) and a population known to be anti-c-Met antibody insensitive (non-efficacy). And (ii) averaging the biomarker ΔCt in each of the efficacy group and the non-efficacy group to provide a standard reference value. As described above, ΔCt is a predetermined expression in which a standard expression value is produced from an average of Ct values of one or more reference markers (EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90, and TUT1). The value obtained by subtracting the Ct value of the biomarker.

  The anti-c-Met antibody application target means a patient who is suitable for a therapeutic method using the anti-c-Met antibody, and includes all mammals, for example, primates such as humans and monkeys, mice, rats, and the like. It can be a rodent, for example a cancer patient. The biological sample used herein is isolated or artificially cultured from a patient (eg, a mammal including a human, a primate such as a monkey, a rodent such as a mouse or a rat), or the like. Cells, tissues, body fluids, etc., such as cancer cells or cancer tissues, or DNA or RNA extracted therefrom, or isolated proteins. The biological sample may be an unprocessed sample or a processed sample (eg, RRPE (formalin fixed paraffin embedded) sample).

  Alternatively, a “high expression level” or “low expression level” can be determined by comparing the expression level of a biomarker in a biological sample from a patient to the expression level of the biomarker in a reference sample. The reference sample is any cell or tissue in which the anti-c-Met antibody has no effect or has resistance to the anti-c-Met antibody (eg, anti-c-Met antibody insensitive group or anti-c-Met antibody resistant group). Anti-c-Met antibody non-efficacy group). For example, the reference samples are cell lines H1373 (ATCC, CRL-5866), HCC1806 (ATCC, CRL-2335), Caki-1 (ATCC, HTB-46), SKBR3 (ATCC, HTB-30), BT474 (ATCC, ATCC, HTB-20), HT-29 (ATCC, HTB-38), LoVo (ATCC, CCL-229), HCT116 (ATCC, CCL-247), SW620 (ATCC, CCL-227), Ls174T (ATCC, CL-188) ), And at least one selected from the group consisting of cells that have acquired resistance to the anti-c-Met antibody by repeated administration and / or continuous administration of the anti-c-Met antibody. Thus, a method for predicting the efficacy of an anti-c-Met antibody on a patient or for selecting (or identifying) a patient for application of an anti-c-Met antibody comprises the expression level of the biomarker in the biological sample and the reference sample. The method may further comprise comparing the expression level of the biomarkers of In this case, the method may further comprise the step of measuring the expression level of the biomarker in the reference sample. Said method is used when the expression level of the biomarker (at least one selected from the group consisting of CAV1, FAM126A, MET, RAB31, ST8SIA4, and THSD7A) is higher than that of the reference sample or the biomarker (CMHL, PHC1, Alternatively, when the expression level of the combination sample) is lower than that of the reference sample, the anti-c-Met antibody is effective for the biological sample or the patient from which the biological sample was obtained (isolated), or the biological sample or the organism. The patient from whom the sample was obtained (isolated) may further comprise the step of determining (predicting or selecting) that the sample is suitable for application of anti-c-Met antibody.

  The application target of the anti-c-Met antibody may be a cancer patient, the cancer may be a solid cancer or a hematological cancer, and may be a cancer associated with overexpression or abnormal activation of c-Met. The cancer can include not only primary cancer but also metastatic cancer. In one embodiment, the application target of the anti-c-Met antibody is squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, skin cancer, skin and intraocular black Tumor, direct cancer, cancer near the anus, esophageal cancer, small intestine cancer, endocrine cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, chronic and acute leukemia, lymphocyte lymphoma, hepatocellular carcinoma, gastric cancer, pancreatic cancer Glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver tumor, breast cancer, colon cancer, colon cancer, endometrial and uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, It is selected from one or more types of cancer patients selected from the group consisting of head and neck cancer, brain cancer, and osteosarcoma. In one embodiment, the application target of the anti-c-Met antibody is selected from the group consisting of lung cancer (eg, lung adenocarcinoma, non-small cell adenocarcino), etc. Selected from one or more cancer patients.

  The presence / absence of the biomarker and / or the expression level of the biomarker and / or the reference marker can be determined by an ordinary gene quantification method, for example, an ordinary microarray method using a probe or primer hybridizable with the gene, PCR (for example, , QPCR (quantitative PCT) or RT-PCR), FISH (fluorescent in situ hybridization), etc., but are not limited thereto. In one embodiment, the presence or absence of the biomarker and / or the expression level of the biomarker and / or reference marker can be measured by a conventional gene quantification method, for example, a polymerase chain reaction (PCR). In addition, the presence or absence of the biomarker can be confirmed by ordinary sequencing. In one embodiment, the primer is a continuous 5-1000 bp in the base sequence of the biomarker gene (full length DNA, cDNA, or mRNA) or the reference marker gene (full length DNA, cDNA, or mRNA), for example, 10 -500 bp, 20-200 bp, or 50-200 bp gene fragments, each of which can be detected at the 3'-end and 5'-end of the biomarker gene or the reference marker gene or these gene fragments, respectively. It may have a base sequence capable of hybridizing with a continuous 5 to 100 bp, for example, 5 to 50 bp, 5 to 30 bp, or 10 to 25 bp site (for example, complementary). The probe is a continuous 5-100 bp in the base sequence of the biomarker gene (full length DNA, cDNA, or mRNA) or the reference marker gene (full length DNA, cDNA, or mRNA), for example, 5-50 bp, 5 It may have a base sequence capable of hybridizing with a site of ˜30 bp or 10-25 bp (for example, complementary). The term “capable of hybridizing” means that the nucleotide sequence of the biomarker gene or the reference marker gene is 80% or more, for example, 90% or more, 95% or more, 98% or more, 99% or more, or 100% sequence complementarity. This means that complementary binding is possible.

  The presence and / or level of the biomarkers and reference markers can also be measured through quantification of the proteins they encode. For example, the protein encoded by the biomarker gene and the reference marker gene can be quantified through normal enzyme reaction using an antibody, aptamer or the like that specifically binds to the protein, fluorescence, luminescence and / or radiation detection. . Specifically, immunochromatography, immunohistochemical staining, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (enzyme immunoassay: RIA) Fluorescence immunoassay (FIA), luminescence immunoassay (LIA), Western blotting, microarray, flow cytometry, immunocytochemistry, immunocytochemistry (mm) (IHC), surface plasmon resonance (SPR), and the like. However, the method is not limited thereto.

  Another embodiment provides a method for suppressing c-Met, or a method for preventing and / or treating cancer, comprising administering an anti-c-Met antibody to the selected anti-c-Met antibody application target.

  The c-Met suppression method or cancer prevention and / or treatment method may additionally include a step of confirming the selected anti-c-Met antibody application target before the administration step. The step of confirming is a step of confirming the biological sample or patient selected by the above-described anti-c-Met antibody application target selection method, and the step described in the method of selecting the anti-c-Met antibody application target Or by confirming that the anti-c-Met antibody application target is selected by the method of selecting the anti-c-Met antibody application target according to the given information. .

  In one embodiment, the method for suppressing c-Met or the method for preventing and / or treating cancer includes the step of confirming an anti-c-Met antibody application target; and the anti-c-Met antibody application target of the anti-c-Met antibody. Administering an effective amount can be included. In another embodiment, the c-Met suppression method or the cancer prevention and / or treatment method selects presence / absence and / or level of the biomarker in a biological sample to select an anti-c-Met antibody application target. Administering an effective amount of the anti-c-Met antibody to the selected anti-c-Met antibody application target.

  In one embodiment, the anti-c-Met antibody may be any antibody that recognizes c-Met as an antigen or an antigen-binding fragment thereof. For example, the anti-c-Met antibody can be any antibody or antigen-binding fragment thereof that specifically binds to c-Met and induces internalization and degradation. The anti-c-Met antibody may recognize a specific site of c-Met, for example, a specific site in the SEMA domain as an epitope.

  In the present specification, unless otherwise stated, as the anti-c-Met antibody, not only a complete form of the anti-c-Met antibody but also an antigen-binding site of the antibody is used.

  The “c-Met protein” means a receptor tyrosine kinase that binds to hepatocyte growth factor. The c-Met protein may be derived from all species, for example from primates such as human c-Met (eg NP_000236), monkey c-Met (eg Macaca multitta, NP_001162100), etc. Or from rodents such as mouse c-Met (eg, NP — 02617.2), rat c-Met (eg, NP — 113705.1), and the like. The protein can include, for example, a polypeptide sequence encoded by the nucleotide sequence provided in GenBank Accession Number NM_000245, a polypeptide sequence encoded by GenBank Accession Number NM_000236, or an extracellular domain thereof. The receptor tyrosine kinase c-Met is involved in various mechanisms such as cancer development, cancer metastasis, cancer cell migration, cancer cell invasion, and neovascularization processes.

  C-Met, which is a receptor for hepatocyte growth factor (HGF), is divided into three parts: an extracellular site, a membrane permeation site, and an intracellular site. The extracellular site is divided into α-subunit and β-subunit. Is a form linked by disulfide bonds, and includes an SGF domain that is an HGF binding domain, a PSI domain (plexin-semaphorins-integrin homology domain), and an IPT domain (immunoglobulin-like folddrins and plexed landspin plexs in the form of plexinstrands. The SEMA domain of the c-Met protein may have the amino acid sequence of SEQ ID NO: 79, and is a domain that exists at the extracellular position of c-Met and corresponds to a site to which HGF binds. Specific regions in the SEMA domain, for example, regions having the amino acid sequence represented by SEQ ID NO: 71 corresponding to the 106th to 124th positions of the SEMA domain, are the second and third propellers in the epitope within the SEMA domain. This corresponds to a loop region between regions. This region can act as an epitope of the anti-c-Met antibody proposed in the present invention.

  The term “epitope” is an antigenic determinant and is taken to mean a portion of an antigen that is recognized by an antibody. According to one embodiment, the epitope is a site comprising 5 or more consecutive amino acids within the SEMA domain of the c-Met protein (SEQ ID NO: 79), for example within the SEMA domain of the c-Met protein (SEQ ID NO: 79). It may contain 5 to 19 consecutive amino acids located within SEQ ID NO: 71 corresponding to positions 106 to 124. The “continuous amino acid” is an amino acid that is continuous on the primary structure of the protein or an amino acid that is continuous on the three-dimensional structure (eg, secondary or tertiary structure) of the protein (in this case, not necessarily on the primary structure). Is not required to be continuous). For example, the epitope may be composed of 5 to 19 consecutive amino acids including SEQ ID NO: 73 (EEPSQ) in the amino acid sequence of SEQ ID NO: 71, for example, SEQ ID NO: 71, SEQ ID NO: 72, or SEQ ID NO: 73 A polypeptide having the amino acid sequence of

  The epitope having the amino acid sequence of SEQ ID NO: 72 corresponds to the outermost site in the loop region between the second and third propeller regions in the SEMA domain of c-Met protein, The epitope having the amino acid sequence of number 73 is the site to which the antibody or antigen-binding fragment according to one embodiment binds most specifically.

  Accordingly, the anti-c-Met antibody can specifically bind to an epitope comprising 5 to 19 consecutive amino acids including SEQ ID NO: 73 (EEPSQ) in the amino acid sequence of SEQ ID NO: 71. It may be an antibody or antigen-binding fragment that specifically binds to an epitope having the amino acid sequence of SEQ ID NO: 71, SEQ ID NO: 72, or SEQ ID NO: 73.

According to one embodiment, the anti-c-Met antibody may comprise any one of the following (i) to (iv);
(I) one or more heavy chain complementarity determining regions selected from the group consisting of the following CDR-H1 to CDR-H3, or a heavy chain variable region comprising the one or more heavy chain complementarity determining regions; CDR-H1 having the amino acid sequence of 4, amino acid sequence of SEQ ID NO: 5, amino acid sequence of SEQ ID NO: 2, or 8 to 19 consecutive amino acids containing the 3rd to 10th amino acids in the amino acid sequence of SEQ ID NO: 2 CDR-H2 having an amino acid sequence consisting of amino acids, and consecutive amino acids 6 to 13 including the amino acid sequence of SEQ ID NO: 6, the amino acid sequence of SEQ ID NO: 85, or the first to sixth amino acids in the amino acid sequence of SEQ ID NO: 85 CDR-H3 having an amino acid sequence consisting of amino acids
(Ii) one or more light chain complementarity determining regions selected from the group consisting of the following CDR-L1 to CDR-L3, or a light chain variable region comprising the one or more light chain complementarity determining regions; CDR-L1 having an amino acid sequence of 7, CDR-L2 having an amino acid sequence of SEQ ID NO: 8, and an amino acid sequence of SEQ ID NO: 9, an amino acid sequence of SEQ ID NO: 15, an amino acid sequence of SEQ ID NO: 86, or an amino acid of SEQ ID NO: 89 CDR-L3 having an amino acid sequence consisting of 9 to 17 amino acids including the first to ninth amino acids in the sequence
(Iii) A combination of the heavy chain complementarity determining region and the light chain complementarity determining region (iv) A combination of the heavy chain variable region and the light chain variable region.

  SEQ ID NOs: 4 to 9 are amino acid sequences represented by the following general formulas I to VI, respectively:

In the general formula I, Xaa ₁ is absent or Pro or Ser, and Xaa ₂ is Glu or Asp. In the general formula II, Xaa ₃ is Asn or Lys, Xaa ₄ is Ala or Val, Xaa ₅ is Asn or Thr,
In the general formula III, Xaa ₆ is Ser or Thr. In the general formula IV, Xaa ₇ is His, Arg, Gln or Lys, Xaa ₈ is Ser or Trp, Xaa ₉ is His or Gln, and Xaa ₁₀ is Lys or Asn. In the general formula V, Xaa ₁₁ is Ala or Gly, Xaa ₁₂ is Thr or Lys, and Xaa ₁₃ is Ser or Pro. In the general formula VI, Xaa ₁₄ is Gly, Ala or Gln, Xaa ₁₅ is Arg, His, Ser, Ala, Gly or Lys, and Xaa ₁₆ is Leu, Tyr, Phe or Met.

  In one embodiment, the CDR-H1 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24. The CDR-H2 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 25, and SEQ ID NO: 26. The CDR-H3 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85.

  The CDR-L1 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 106. The CDR-L2 may have an amino acid sequence selected from the group consisting of SEQ ID NO: 11, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36. The CDR-L3 has an amino acid sequence selected from the group consisting of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 37, SEQ ID NO: 86, and SEQ ID NO: 89. It can be.

  In one embodiment, the antibody or antigen-binding fragment is a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24 (CDR-H1), SEQ ID NO: 2 , A polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 25 and SEQ ID NO: 26 (CDR-H2), and selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 85 A heavy chain variable region comprising a polypeptide having the determined amino acid sequence (CDR-H3); and SEQ ID NO: 10, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, and SEQ ID NO: 106 Polypeptide having an amino acid sequence selected from the group (CDR-L1), SEQ ID NO: 11, SEQ ID NO: 4, a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 35 and SEQ ID NO: 36 (CDR-L2), and SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, It may comprise a light chain variable region comprising a polypeptide (CDR-L3) having an amino acid sequence selected from the group consisting of SEQ ID NO: 37, SEQ ID NO: 86, and SEQ ID NO: 89.

  According to one embodiment, in the anti-c-Met antibody or antigen-binding fragment, the heavy chain variable site is SEQ ID NO: 17, SEQ ID NO: 74, SEQ ID NO: 87, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93 or SEQ ID NO: 94, wherein the light chain variable region is SEQ ID NO: 306, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 75, SEQ ID NO: 88, SEQ ID NO: 95, sequence It may include the amino acid sequence of SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, or SEQ ID NO: 107.

  In general, an animal-derived antibody produced by immunizing an immunized animal with a desired antigen may cause immune rejection when administered to a human for therapeutic purposes. In order to suppress such immune rejection, a chimeric antibody has been developed. A chimeric antibody is obtained by substituting an invariant site of an animal-derived antibody, which is considered to cause an anti-isotype reaction, with an invariable site of a human antibody using a genetic engineering method. Chimeric antibodies have a considerable improvement in anti-isotype responses compared to animal-derived antibodies, but the variable sites still have animal-derived amino acids and thus against potential anti-idiotypic responses. Contains side effects. Humanized antibodies have been developed to improve such side effects. It is made by grafting CDR sites that play an important role in antigen binding in the variable region of a chimeric antibody into a human antibody framework.

  The most important thing in CDR grafting technology for producing humanized antibodies is to select optimized human antibodies that best accept the CDR sites of animal-derived antibodies, and for this reason, the antibody database Use, crystal structure analysis, molecular modeling technology, etc. However, even if the CDR region of an animal-derived antibody is transplanted to the optimized human antibody skeleton (framework), there are amino acids that affect antigen binding while being located in the skeleton of the animal-derived antibody (framework). Therefore, since there are a considerable number of cases where the antigen binding strength is not preserved, it can be said that application of additional antibody engineering techniques for restoring the antigen binding strength is essential.

  According to one embodiment, the antibody may be a mouse-derived antibody, a mouse-human chimeric antibody, a humanized antibody, or a human-derived antibody. The antibody may be isolated from a living organism or not naturally occurring. The antibody can be recombinantly or synthetically produced.

A complete antibody is a structure having two full-length light chains and two full-length heavy chains, each light chain being linked to the heavy chain by a disulfide bond. The invariant site (Fc) of an antibody is divided into a heavy chain invariant site (C _H ) and a light chain invariant site (C _L ). Heavy chain invariant sites have gamma (γ), mu (μ), alpha (α), delta (δ) and epsilon (ε) types, with subclasses gamma 1 (γ1), gamma 2 (γ2), It has gamma 3 (γ3), gamma 4 (γ4), alpha 1 (α1) and alpha 2 (α2). The constant region of the light chain has kappa (κ) and lambda (λ) types.

The term “heavy chain” includes a variable site domain V _H comprising an amino acid sequence with sufficient variable site sequence to confer specificity to the antigen, three invariant site domains C _H1 , C _H2 and C _H3 is interpreted as meaning to include all full-length heavy chains including hinges, as well as fragments thereof. The term “light chain” also includes a full-length light chain comprising a variable site domain V _L comprising an amino acid sequence with sufficient variable site sequence to confer specificity to the antigen, and an invariant site domain C _L. As well as all the fragments thereof.

  The term “CDR (complementarity determining region)” means the amino acid sequence (complementarity determining region) of the hypervariable regions of immunoglobulin heavy and light chains. Each heavy and light chain can contain three CDRs (CDR-H1, CDR-H2, CDR-H3 and CDR-L1, CDR-L2, CDR-L3). The CDRs can provide the main contact residues in the antibody binding to an antigen or epitope. On the other hand, in the present specification, the terms “specifically bind” or “specifically recognize” have the same meaning as commonly known to those skilled in the art, and an antigen and an antibody specifically interact with each other. Means to perform an immunological reaction.

The term “antigen-binding fragment” means a portion of a polypeptide that contains a portion of an entire immunoglobulin structure that is capable of binding an antigen. In one embodiment, the antigen-binding fragment can be, but is not limited to, scFv, (scFv) ₂ , Fab, Fab ′ or F (ab ′) ₂ . The Fab in the antigen-binding fragment has a structure having a light chain and a heavy chain variable site, a light chain invariant site and a heavy chain first invariant site (C _H1 ). Have.

Fab ′ differs from Fab in that it has a hinge region containing one or more cysteine residues at the C-terminus of the heavy chain C _H1 domain.

The F (ab ′) ₂ antibody is produced while a cysteine residue in the hinge region of Fab ′ forms a disulfide bond. Fv is the smallest antibody fragment having only a heavy chain variable site and a light chain variable site, and recombination techniques for generating Fv fragments are widely known in the art.

  A double chain Fv (two-chain Fv) is a non-covalent bond in which a heavy chain variable region and a light chain variable region are linked, and a single chain Fv (single-chain Fv) is generally a heavy chain through a peptide linker. And a single-chain variable site can be covalently linked or directly linked at the C-terminus to form a dimer-like structure, similar to a double-chain Fv. The peptide linker may be a polypeptide consisting of 1 to 100 or 2 to 50 arbitrary amino acids, and the type of amino acid contained therein is not limited.

The antigen-binding fragment can be obtained using a protein hydrolase (for example, Fab can be obtained by cleaving whole antibody with papain, and F (ab ′) ₂ fragment can be obtained by cleaving with pepsin. Can be produced by genetic recombination technology.

  The term “hinge region” is a region contained in the heavy chain of an antibody that is present between the CH1 and CH2 regions and provides the flexibility of the antigen binding site within the antibody. It means an area that performs a function.

  When a non-human animal-derived antibody undergoes a chimerization process, an IgG1 hinge derived from a non-human animal is replaced with a human IgG1 hinge, but the length of a non-human animal-derived IgG1 hinge is shorter than that of a human IgG1 hinge. Short, the disulfide bond between the two heavy chains is reduced from three to two, and the rigidity of the hinge shows different effects. Thus, modification of the hinge region can increase the antigen binding efficiency of the humanized antibody. Amino acid deletion, addition or substitution methods for modifying the amino acid sequence of the hinge region are well known to those skilled in the art.

  Here, in one embodiment of the present invention, in order to enhance antigen binding efficiency, the anti-c-Met antibody or antigen-binding fragment has an amino acid sequence in which one or more amino acids are deleted, added, or substituted. It may include a modified hinge region. For example, the antibody comprises a hinge region having the amino acid sequence of SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103 or SEQ ID NO: 104, or a hinge region having the amino acid sequence of SEQ ID NO: 105 (unmodified human hinge region). May be included. More specifically, the hinge region may have the amino acid sequence of SEQ ID NO: 100 or SEQ ID NO: 101.

  In one embodiment, the anti-c-Met antibody may be a monoclonal antibody that specifically binds to an extracellular region of c-Met protein produced from a hybridoma cell with accession number KCLRF-BP-20020. (See Korean Published Patent Application No. 2011-0047698; the above document is included in this specification as a reference). The anti-c-Met antibody can include all antibodies defined in Korean Patent Publication No. 2011-0047698.

  The defined CDR sites of the anti-c-Met antibody or a site excluding the light chain variable region and the heavy chain variable region, for example, the light chain constant region and the heavy chain constant region are all subtype immunoglobulins (for example, It may be derived from IgA, IgD, IgE, IgG (eg, IgG1, IgG2, IgG3, IgG4, etc.), or IgM, eg, light chain and heavy chain constant sites.

According to one embodiment, the anti-c-Met antibody is
The amino acid sequence of SEQ ID NO: 62 (among these, the first to 17th amino acid sequences are signal peptides), the amino acid sequence of SEQ ID NO: 62 from 18th to 462, the amino acid sequence of SEQ ID NO: 64 (of which The amino acid sequence from the 1st to the 17th is a signal peptide) or the amino acid sequence from the 18th to the 461st of SEQ ID NO: 64, the amino acid sequence of the SEQ ID NO: 66 (among these, the amino acid sequence from the 1st to the 17th is A heavy chain comprising an amino acid sequence selected from the group consisting of the amino acid sequence of SEQ ID NO: 66 from the 18th to 460th amino acid sequence; and the amino acid sequence of SEQ ID NO: 68 (among these, the 1st to the 20th) The amino acid sequence up to is a signal peptide), starting from position 21 of SEQ ID NO: 68 40th amino acid sequence, amino acid sequence of SEQ ID NO: 70 (of which the 1st to 20th amino acid sequence is a signal peptide), 21st to 240th amino acid sequence of SEQ ID NO: 70, and SEQ ID NO: It may comprise a light chain comprising an amino acid sequence selected from the group consisting of 108 amino acid sequences.

For example, the anti-c-Met antibody is
A heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the 18th to 462th amino acid sequence of SEQ ID NO: 62 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the 21st to 240th amino acid sequence of SEQ ID NO: 68; An antibody comprising;
A heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or the 18th to 461th amino acid sequence of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the 21st to 240th amino acid sequence of SEQ ID NO: 68; An antibody comprising;
A heavy chain comprising the amino acid sequence of SEQ ID NO: 66 or the amino acid sequence of 18th to 460th of SEQ ID NO: 66 and a light chain comprising the amino acid sequence of SEQ ID NO: 68 or the 21st to 240th amino acid sequence of SEQ ID NO: 68; An antibody comprising;
A heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the 18th to 462th amino acid sequence of SEQ ID NO: 62 and a light chain comprising the amino acid sequence of SEQ ID NO: 70 or the 21st to 240th amino acid sequence of SEQ ID NO: 70; An antibody comprising;
A heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or the 18th to 461th amino acid sequence of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 70 or the 21st to 240th amino acid sequence of SEQ ID NO: 70; An antibody comprising: an amino acid sequence of SEQ ID NO: 66 or a heavy chain comprising an amino acid sequence of SEQ ID NO: 66 from 18 to 460 and a light chain comprising SEQ ID NO: 70 or an amino acid sequence of SEQ ID NO: 70 from 21 to 240 An antibody comprising the heavy chain comprising the amino acid sequence of SEQ ID NO: 62 or the 18th to 462th amino acid sequence of SEQ ID NO: 62 and the light chain comprising the amino acid sequence of SEQ ID NO: 108;
An antibody comprising a heavy chain comprising the amino acid sequence of SEQ ID NO: 64 or an amino acid sequence from 18th to 461 of SEQ ID NO: 64 and a light chain comprising the amino acid sequence of SEQ ID NO: 108; and the amino acid sequence of SEQ ID NO: 66 or SEQ ID NO: 66 And an antibody comprising a heavy chain comprising the 18th to 460th amino acid sequence and a light chain comprising the amino acid sequence of SEQ ID NO: 108.

  On the other hand, the polypeptide having the amino acid sequence of SEQ ID NO: 70 is a light chain consisting of a human kappa invariant site, and the polypeptide having the amino acid sequence of SEQ ID NO: 68 is a polypeptide having the amino acid sequence of SEQ ID NO: 70 No. 36 (according to Kabat numbering; position 62 of amino acid in SEQ ID NO: 68) is a polypeptide having a form in which histidine (His) is replaced by tyrosine (Tyr). The substitution can increase the amount of antibody produced according to an embodiment. The polypeptide having the amino acid sequence of SEQ ID NO: 108 is a polypeptide having the amino acid sequence of 21st to 240th excluding the 1st to 20th signal peptides in the amino acid sequence of SEQ ID NO: 68. The serine (Ser) in position 27e by Kabat numbering (according to Kabat numbering; the 32nd position in SEQ ID NO: 108; inside CDR-L1) is substituted with tryptophan (Trp). , The activity of the antibody according to one embodiment (for example, binding affinity for c-Met, c-Met degradation activity and Akt phosphorylation inhibiting activity, etc.) can be further enhanced.

  The anti-c-Met antibody can be formulated with a pharmaceutically acceptable carrier, and the carrier is usually used for drug formulation, and includes lactose, dextrose, sucrose, sorbitol, mannitol. , Starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, etc. Although it may be 1 or more types selected from the group which consists of, it is not limited to this.

  The anti-c-Met antibody can be administered orally or parenterally. In the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, endothelial administration, local administration, intranasal administration, intrapulmonary administration, intrarectal administration, or the like. When administered orally, proteins or peptides are digested, so the oral composition must be coated with an active agent or formulated to be protected from degradation in the stomach. Also, the anti-c-Met antibody can be administered by any device that can migrate to the target cells.

  The anti-c-Met antibody can be used for prevention and / or treatment of cancer. The cancer can be a solid cancer or a hematological cancer and can be associated with c-Met overexpression or activation. For example, the cancer may be, but is not limited to, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, peritoneal cancer, skin cancer, skin or intraocular melanoma, Direct cancer, cancer near the anus, esophageal cancer, small intestine cancer, endocrine adenocarcinoma, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, chronic or acute leukemia, lymphocyte lymphoma, hepatocellular carcinoma, gastrointestinal cancer, gastric cancer, pancreas Cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver tumor, breast cancer, colon cancer, colon cancer, endometrial or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer , One or more selected from the group consisting of head and neck cancer, brain cancer, osteosarcoma and the like.

  The preventive and / or therapeutic effect of the cancer not only suppresses the growth of cancer cells, but also suppresses migration, invasion, metastasis, etc., thereby preventing cancer from deteriorating. Including suppression effect. Moreover, the effect on not only primary cancer but also metastatic cancer is included.

  Hereinafter, the present invention will be described in more detail through examples and test examples. However, these examples and test examples are intended to illustrate the present invention and should not be construed as limiting the present invention.

<Reference Example 1: Production of anti-c-Met antibody>
1.1. Production of mouse antibody 'AbF46' against c-Met 1.1.1. Immunization of mice To obtain the immunized mice necessary for the development of hybridoma cell lines, 5 mice were treated with 100 μg of human c-Met / Fc fusion protein (R & D Systems) per mouse. An amount of complete Freund's adjuvant was mixed and injected into the abdominal cavity of 4-6 week old BALB / c mice (Japan SLC Co., Ltd.). Two weeks later, in the same manner as described above, the human c-Met / Fc fusion protein used as the antigen was mixed with 50 μg of half of the injected amount with the same amount of incomplete Freund's adjuvant, The mice were injected intraperitoneally. One week later, the last boosting was performed, and 3 days later, blood was collected from the tail of the mouse to obtain serum. Thereafter, the blood was diluted 1/1000 times with PBS, and it was confirmed that the titer of the antibody recognizing c-Met was increased by ELISA. Based on the results, mice with sufficient antibody levels were selected and the following cell fusion process was performed.

1.1.2. Cell fusion and production of hybridoma Three days before the cell fusion experiment, a mixture of human c-Met / Fc fusion protein and an equal amount of PBS in 50 μg PBS was injected into the peritoneal cavity of BALB / c mice (Japan SLC, Inc.). Immunized with an injection. After anesthetizing the immunized mouse, the spleen located on the left side of the body was removed. The extracted spleen was crushed with a mesh to separate cells, and mixed with a culture medium (DMEM, GIBCO, Invitrogen) to prepare a spleen cell suspension. The suspension was centrifuged to recover the cell layer. The obtained spleen cells 1 × 10 ⁸ and myeloma cells (Sp2 / 0) 1 × 10 ⁸ were mixed and then centrifuged to precipitate the cells. The centrifuged precipitate was gradually dispersed and treated with 45 (w / v)% polyethylene glycol (PEG) (1 ml) contained in the culture medium (DMEM) at 37 ° C. for 1 minute, and then the culture medium ( 1 ml of DMEM) was added. Thereafter, 10 ml of culture medium (DMEM) was added over 10 minutes and left in a 37 ° C. water bath for 5 minutes. Thereafter, the culture medium (DMEM) was adjusted to 50 ml and centrifuged again. The cell precipitate is resuspended in a selective medium (HAT medium) to about 1-2 × 10 ⁵ / ml, dispensed in 0.1 ml portions in a 96-well plate, and then in a 37 ° C. carbon dioxide incubator. By culturing, a hybridoma cell group was prepared.

1.1.3. Selection of hybridoma cells producing monoclonal antibody against c-Met protein To select hybridoma cells specifically reacting only with c-Met protein from the hybridoma cell group produced in Reference Example 1.1.2. Screening was performed by ELISA analysis using human c-Met / Fc fusion protein and human Fc protein as antigens.

  50 μl (2 μg / ml) of human c-Met / Fc fusion protein was added to each microtiter plate and allowed to adhere to the plate surface, and unreacted antigen was washed away. In order to screen out antibodies that bind to Fc that is not c-Met, human Fc protein was attached to the plate surface in the same manner as described above.

  The hybridoma cell culture solution obtained in Reference Example 1.1.2 was added to each of the prepared wells in an amount of 50 μl, allowed to react for 1 hour, and then phosphate buffer-twin 20 (TBST) solution. Thorough washing was performed, and the unreacted culture solution was removed. To this, goat anti-mouse IgG-horseradish peroxidase (goat anti-mouse IgG-HRP) was added and allowed to react at room temperature for 1 hour, and then thoroughly washed with TBST solution. Next, a substrate solution (OPD) of peroxidase was added and reacted, and the extent of the reaction was confirmed by measuring the absorbance at 450 nm with an ELISA reader.

  By confirming the extent of the reaction as described above, a hybridoma cell line that secretes an antibody that does not bind to human Fc but specifically specifically has a high binding force only to human c-Met protein was repeatedly selected. The hybridoma cell line obtained by repeated selection was limited-diluted to finally obtain a clone of one hybridoma cell line producing a monoclonal antibody. The final selection of monoclonal antibody-producing hybridomas was deposited on October 6, 2009 with the Korea Cell Line Research Foundation in Korea, Seoul, Jongno-gu and Renjian-dong, which are international depositors under the Budapest Treaty. KCLRF-BP-20020 was granted (see Korean Patent Publication No. 2011-0047698).

1.1.4. Production and purification of monoclonal antibody The hybridoma cells obtained in Reference Example 1.1.3 were cultured in a serum-free medium, and the monoclonal antibody was produced and purified from the culture solution.

  First, the hybridoma cells cultured in 50 ml of culture medium (DMEM) containing 10% (v / v) FBS are centrifuged, and the cell precipitate is washed twice or more with 20 ml of PBS to remove FBS. In this state, the cell precipitate was resuspended in 50 ml of culture medium (DMEM), and then cultured in a carbon dioxide incubator at 37 ° C. for 3 days.

  Thereafter, the cells producing the antibody were removed by centrifugation, and the culture medium in which the antibody was secreted was separated and stored at 4 ° C. or immediately collected and used for the separation and purification of the antibody. Using an AKTA purification apparatus (GE Healthcare) equipped with an affinity column (Protein G agarose column; Pharmacia, USA), the antibody was purified from 50 ml to 300 ml of the prepared culture solution. Thereafter, the upper layer solution was replaced with PBS using a protein aggregation filter (Amicon), and the purified antibody was stored and used in the following examples.

1.2. Production of chimeric antibody chAbF46 against c-Met In general, mouse antibodies are likely to show immunogenicity when injected into humans for therapeutic purposes. In order to solve this problem, the reference example 1.1. A chimeric antibody chAbF46 was prepared by substituting the constant region of the mouse antibody AbF46 prepared in step 1 except for the variable region related to antigen binding with the sequence of the human IgG1 antibody.

The nucleotide sequence corresponding to the heavy chain is composed of 'EcoRI-signal sequence-VH-NheI-CH-TGA-XhoI' (SEQ ID NO: 38), and the nucleotide sequence corresponding to the light chain is' EcoRI-signal sequence-VL-BsiWI. A gene was synthesized by designing each to be composed of -CL-TGA-XhoI '(SEQ ID NO: 39). Thereafter, a DNA section (SEQ ID NO: 38) having a nucleotide sequence corresponding to the heavy chain in pOptiVEC ^™ -TOPO TA Cloning Kit contained in OptiCHO ^™ Antibody Express Kit (Cat no. 12762-019) of Invitrogen, A DNA section (SEQ ID NO: 39) having a nucleotide sequence corresponding to the light chain in pcDNA ^™ 3.3-TOPO TA Cloning Kit (Cat no. 8300-01) was analyzed by EcoRI (NEB, R0101S) and XhoI (NEB), respectively. The vector containing the heavy chain and the vector containing the light chain were respectively constructed for the expression of the chimeric antibody by cloning using the restriction enzyme (R0146S).

Each of the constructed vectors was amplified using Qiagen Maxiprep kit (Cat no. 12562), and transient expression was performed using Freestyle ^™ MAX 293 Expression System (Invitrogen). The cell line used was 293F cells and was cultured in a suspension culture system using FreeStyle ^™ 293 Expression Medium as a medium. One day before transient expression, cells were prepared at a concentration of 5 × 10 ⁵ cells / ml. After 24 hours, when the number of cells reached 1 × 10 ⁶ cells / ml, transient expression was performed. Transfection was performed by the liposomal reagent method using Freestyle ^™ MAX reagent (Invitrogen), DNA was prepared in a ratio of heavy chain DNA: light chain DNA = 1: 1 in a 15 ml tube, and OptiPro ^™ SFM ( Invitrogen) 2 ml (A) and another 15 ml tube with 100 μl Freestyle ^™ MAX reagent and 2 ml OptiPro ^™ SFM (B). Thereafter, (A) and (B) were mixed and incubated for 15 minutes, and then the mixed solution was gradually poured into the cells prepared one day ago. After the transduction was completed, the cells were cultured for 5 days in a 37 ° C., 80% humidity, 8% CO ₂ , 130 rpm incubator.

Then, after culturing in DMEM medium supplemented with 10% (v / v) FBS at 37 ° C. and 5% CO ₂ for 5 hours, in DMEM medium not supplemented with FBS for 48 hours at 37 ° C. Culturing was performed under conditions of 5% CO ₂ .

  The cultured cells were centrifuged, 100 ml of each supernatant was taken and purified using AKTA Prime (GE Healthcare). A Protein A column (GE Healthcare, 17-0405-03) was provided on AKTA Prime, and the culture solution was flowed at a flow rate of 5 ml / min, followed by elution with an IgG elution buffer (Thermo Scientific, 21004). . The obtained eluate was buffer exchanged with PBS, and finally the chimeric antibody AbF46 (hereinafter referred to as chAbF46) was purified.

1.3. Production of humanized antibody huAbF46 from chimeric antibody chAbF46 1.3.1. Humanization of heavy chains (Heavy chain humanization)
For the design of the two domains, H1-heavy and H3-heavy, it was first purified in Reference Example 1.2 through Ig Blast (http://www.ncbi.nlm.nih.gov/igblast/). The human germline gene with the highest homology with the VH gene of the mouse antibody AbF46 was analyzed. As a result, it was confirmed that VH3-71 had 83% homology at the amino acid level, CDR-H1, CDR-H2, and CDR-H3 of mouse antibody AbF46 were defined by Kabat numbering, and CDR of mouse antibody AbF46 was defined. The part was designed to be introduced into the VH3-71 framework. At this time, amino acids 30 (S → T), 48 (V → L), 73 (D → N), and 78 (T → L) were originally mutated into the amino acid sequence of mouse AbF46 antibody. It was. Thereafter, H1 additionally mutates amino acids 83 (R → K) and 84 (A → T), and finally H1-heavy (SEQ ID NO: 40) and H3-heavy (SEQ ID NO: 41). ) Was built.

  As a result of examining the framework sequence of the human antibody for the design of H4-heavy, the sequence of the mouse framework sequence of the AbF46 antibody is very similar to that of the mouse, and at the same time, the most stable VH3 subtype known so far. Was used to introduce CDR-H1, CDR-H2, and CDR-H3 of the mouse antibody AbF46 defined by Kabat numbering. Thereby, H4-heavy (SEQ ID NO: 42) was constructed.

1.3.2. Humanization of light chain (Light chain humanization)
Mouse antibodies through Ig Blast (http://www.ncbi.nlm.nih.gov/igblast/) for two designs, H1-light (SEQ ID NO: 43) and H2-light (SEQ ID NO: 44) The human gonad gene having the highest homology with the AbF46 VL gene was analyzed. As a result, it was confirmed that VK4-1 had 75% homology at the amino acid level, CDR-L1, CDR-L2, and CDR-L3 of mouse antibody AbF46 were defined by Kabat numbering, and CDR of mouse antibody AbF46 was determined. The part was designed to be introduced into the VK4-1 framework. At this time, H1-light reversely mutated three amino acids of 36 (Y → H), 46 (L → M), and 49 (Y → I), and H2-light is the 49th amino acid. (Y → I) Only one was constructed by reverse mutation.

  For the design of H3-light (SEQ ID NO: 45), the human gonad gene having the highest homology with the VL gene of mouse antibody AbF46 through Blast (http://www.ncbi.nlm.nih.gov/igblast/) In addition to the above VK4-1, VK2-40 was selected from the results of the analysis. The mouse antibodies AbF46VL and VK2-40 were confirmed to have 61% homology at the amino acid level, and the CDR-L1, CDR-L2, and CDR-L3 of the mouse antibody AbF46 were defined by Kabat numbering, and the mouse antibody AbF46 Was designed so that the CDR portion of was introduced into the framework of VK4-1. At this time, H3-light was constructed by reverse-mutating three amino acids of No. 36 (Y → H), No. 46 (L → M), and No. 49 (Y → I).

  As a result of examining the framework sequence of human antibody for the design of H4-light (SEQ ID NO: 46), the mouse defined by Kabat numbering using the Vk1 subtype known to be the most stable in the past. CDR-L1, CDR-L2, and CDR-L3 of antibody AbF46 were introduced. At this time, H4-light was constructed by additionally reverse-mutating three amino acids of No. 36 (Y → H), No. 46 (L → M), and No. 49 (Y → I).

Thereafter, a DNA segment (H1-heavy; SEQ ID NO :) having a nucleotide sequence corresponding to the heavy chain in pOptiVEC ^™ -TOPO TA Cloning Kit contained in Invitrogen's OptiCHO ^™ Antibody Express Kit (Cat no. 12762-029) 47, H3-heavy; SEQ ID NO: 48, H4-heavy; SEQ ID NO: 49), and DNA section (H1-light; SEQ ID NO: 49) having pcDNA ^TM 3.3-TOPO TA Cloning Kit with the nucleotide sequence corresponding to the light chain. 50, H2-light; SEQ ID NO: 51, H3-light; SEQ ID NO: 52, H4-light; SEQ ID NO: 53), EcoRI (NEB, R0101) and XhoI (NEB, R014), respectively. With S) restriction enzyme, by cloning, were constructed vector for expression of humanized antibody.

Each of the constructed vectors was amplified using Qiagen Maxiprep kit (Cat no. 12562), and transient expression was performed using Freestyle ^™ MAX 293 Expression System (Invitrogen). The cell line used was 293F cells and was cultured in a suspension culture system using FreeStyle ^™ 293 Expression Medium as a medium. One day before transient expression, cells were prepared at a concentration of 5 × 10 ⁵ cells / ml. After 24 hours, when the number of cells reached 1 × 10 ⁶ cells / ml, transient expression was performed. Transduction was performed by the liposomal reagent method using Freestyle ^™ MAX reagent (Invitrogen). Specifically, DNA was prepared in a ratio of heavy chain DNA: light chain DNA = 1: 1 in a 15 ml tube, mixed with 2 ml of OptiPro ^™ SFM (Invitrogen) (A), and Freestyle ^™ MAX reagent 100 μl in another 15 ml tube. And OptiPro ^™ SFM (2 ml) were mixed (B), (A) and (B) were mixed and incubated for 15 minutes, and then the mixture was gradually poured into the cells prepared one day ago. After the transduction was completed, the cells were cultured for 5 days in a 37 ° C., 80% humidity, 8% CO ₂ , 130 rpm incubator.

  The cultured cells were centrifuged and 100 ml of each supernatant was taken and purified using AKTA Prime (GE Healthcare). A protein A column (GE Healthcare, 17-0405-03) was provided on AKTA Prime, and the culture solution was flowed at a flow rate of 5 ml / min, followed by elution with an IgG elution buffer (Thermo Scientific, 21004). This was buffer exchanged with PBS, and finally the humanized antibody AbF46 (hereinafter referred to as huAbF46) was purified. On the other hand, the combination of the heavy chain and light chain of the humanized antibody huAbF46 used in the following examples is H4-heavy (SEQ ID NO: 42) and H4-light (SEQ ID NO: 46).

1.4. Generation of scFv library of huAbF46 antibody A gene for generating scFv of huAbF46 antibody was designed using the heavy chain variable region and light chain variable region of huAbF46 antibody. Each heavy chain variable region and light chain variable region was in the form of 'VH-linker-VL', and the linker was designed to have an amino acid sequence of 'GLGGGLGGGSGGGGSGGSSGVGS' (SEQ ID NO: 54). A polynucleotide (SEQ ID NO: 55) encoding the scFv of the huAbF46 antibody thus designed was synthesized by requesting from Bionicia, and a vector for expressing it was shown in SEQ ID NO: 56.

  Thereafter, the resulting product expressed from the vector was analyzed and confirmed to exhibit a binding force specific to c-Met.

1.5. Generation of library genes for affinity maturation 1.5.1. Selection of target CDRs and generation of primers Six complementarity determining regions (CDRs) for affinity maturation of the huAbF46 antibody were defined by 'Kabat numbering' from the generated mouse antibody AbF46. Each CDR is as shown in Table 1 below.

  Primers were prepared as follows for introduction of random sequences of antibody CDRs. In the conventional random sequence introduction method, N codons are used so that the same proportion of bases (25% A, 25% G, 25% C, 25% T) are introduced into the site to be mutated. . In this example, in order to introduce a random base into the CDR of the huAbF46 antibody, 85% of the first and second nucleotides in the three wild-type nucleotides encoding the amino acids of each CDR are stored as they are, and the rest A method of introducing 3% of each of the three bases was adopted. In addition, the primer was designed so that the third nucleotide was introduced identically (33% G, 33% C, 33% T).

1.5.2. Preparation of huAbF46 antibody library and confirmation of binding ability to c-Met The antibody library gene was constructed by introducing a random sequence of CDR using primers prepared by the method as described in Reference Example 1.5.1. I went. Using a polynucleotide containing the scFv of the huAbF46 antibody as a template, two PCR sections were prepared, and this was subjected to the overlapping extension polymerase chain reaction (overlap extension PCR) method to mutate only the desired CDRs of the huAbF46 antibody. A library was constructed that targeted each of the six CDRs produced by securing the scFv library gene.

  The library prepared in this manner confirms the binding strength of wild type and each library to c-Met, and each library has a tendency that the binding strength to c-Met is largely reduced compared to the wild type. However, some mutations that maintain the binding ability to c-Met were confirmed.

1.6. Selection of antibodies with improved affinity from the prepared library After the library was improved in binding power to c-Met from the constructed library, the gene sequence of scFv was analyzed from each individual clone. The secured gene sequences are as shown in Table 8 below, and this was converted to an IgG form. Of the following clones, four types of antibodies produced from L3-1, L3-2, L3-3, and L3-5 were selected for subsequent experiments.

1.7. Conversion of the selected antibody to IgG The polynucleotide encoding the heavy chain of the four selected antibodies has the structure of 'EcoRI-signal sequence-VH-NheI-CH-XhoI' (SEQ ID NO: 38). Designed. In the case of the heavy chain of the huAbF46 antibody, since the amino acid of the antibody was not changed during affinity maturation, the heavy chain of the huAbF46 antibody was used as it was. However, the hinge region was replaced with a U6-HC7 hinge (SEQ ID NO: 57) that is not a hinge of human IgG1. Each light chain was synthesized by designing a gene so that it had the structure of 'EcoRI-signal sequence-VL-BsiWI-CL-XhoI'. Polynucleotides (SEQ ID NO: 58 to SEQ ID NO: 61), which were selected after affinity maturation and encoded including the light chain variable sites of the four antibodies, were synthesized by requesting from Bionicia. Thereafter, a DNA section (SEQ ID NO: 38) having a nucleotide sequence corresponding to the heavy chain in pOptiVEC ^™ -TOPO TA Cloning Kit contained in OptiCHO ^™ Antibody Express Kit (Cat no. 12762-019) of Invitrogen, pcDNA ^™ 3.3-TOPO TA Cloning Kit (Cat no. 8300-01) having a nucleotide sequence corresponding to the light chain (DNA segment containing CDR-L3 derived from L3-1: SEQ ID NO: 58, L3) -2-derived CDR-L3 DNA section: SEQ ID NO: 59, L3-3-derived CDR-L3-containing DNA section: SEQ ID NO: 60, L3-5-derived CDR-L3-derived DNA section: SEQ ID NO: 61) To EcoRI (N A vector for expression of an affinity matured antibody was constructed by cloning using EB, R0101S) and XhoI (NEB, R0146S) restriction enzymes.

Each of the constructed vectors was amplified using Qiagen Maxiprep kit (Cat no. 12562), and transient expression was performed using Freestyle ^™ MAX 293 Expression System (Invitrogen). The cell line used was 293F cells and was cultured in a suspension culture system using FreeStyle ^™ 293 Expression Medium as a medium. One day before transient expression, cells were prepared at a concentration of 5 × 10 ⁵ cells / ml. After 24 hours, when the number of cells reached 1 × 10 ⁶ cells / ml, transient expression was performed. Transduction was performed by the liposomal reagent method using Freestyle ^™ MAX reagent (Invitrogen). Specifically, DNA was prepared in a ratio of heavy chain DNA: light chain DNA = 1: 1 in a 15 ml tube, mixed with 2 ml of OptiPro ^™ SFM (Invitrogen) (A), and Freestyle ^™ MAX reagent 100 μl in another 15 ml tube. And OptiPro ^™ SFM (2 ml) were mixed (B), (A) and (B) were mixed and incubated for 15 minutes, and then the mixture was gradually poured into the cells prepared one day ago. After the transduction was completed, the cells were cultured for 5 days in a 37 ° C., 80% humidity, 8% CO ₂ , 130 rpm incubator.

  The cultured cells were centrifuged and 100 ml of each supernatant was taken and purified using AKTA Prime (GE Healthcare). A protein A column (GE Healthcare, 17-0405-03) was provided on AKTA Prime, and the culture solution was flowed at a flow rate of 5 ml / min, followed by elution with an IgG elution buffer (Thermo Scientific, 21004). This was buffer-exchanged with PBS, and finally four mature antibodies with affinity (hereinafter referred to as huAbF46-H4-A1 (derived from L3-1), huAbF46-H4-A2 (derived from L3-2), huAbF46-H4). -A3 (derived from L3-3) and huAbF46-H4-A5 (derived from L3-5)) were purified.

1.8. Production of huAbF46-H4-A1 in which the invariant site and / or the hinge region is substituted Among the four antibodies selected in Reference Example 1.7, the binding affinity to c-Met is the highest, and phosphorylation of Akt A hinge region or invariant site and an antibody in which the hinge region was substituted were prepared for huAbF46-H4-A1 that was determined to have the lowest degree of oxidation and degradation of c-Met.

  huAbF46-H4-A1 heavy chain variable site, U6-HC7 hinge and heavy chain consisting of human IgG1 constant site, and huAbF46-H4-A1 light chain variable site and light chain consisting of human kappa constant site The antibody consisting of was named huAbF46-H4-A1 (U6-HC7). consisting of the heavy chain variable site of huAbF46-H4-A1, the heavy chain consisting of the human IgG2 hinge and the human IgG1 constant site, and the light chain consisting of the light chain variable site of huAbF46-H4-A1 and the human kappa constant site The antibody was named huAbF46-H4-A1 (IgG2 hinge). consisting of the heavy chain variable site of huAbF46-H4-A1, the heavy chain consisting of the human IgG2 hinge and the human IgG2 invariant site, and the light chain consisting of the light chain variable region of huAbF46-H4-A1 and the human kappa invariant site The antibody was named huAbF46-H4-A1 (IgG2 Fc). On the other hand, in order to increase the production amount of the three types of antibodies, all the 36th histidines (His) in the light chain consisting of human kappa invariant sites were replaced with tyrosine (Tyr).

In order to produce the three types of antibodies, a polynucleotide (SEQ ID NO: 63) encoding a polypeptide (SEQ ID NO: 62) consisting of a heavy chain variable region of huAbF46-H4-A1, a U6-HC7 hinge region and a human IgG1 constant region. ), A polynucleotide (SEQ ID NO: 65) encoding a polypeptide (SEQ ID NO: 64) consisting of a heavy chain variable region of huAbF46-H4-A1, a human IgG2 hinge region and a human IgG1 constant region, heavy chain of huAbF46-H4-A1 Polynucleotide (SEQ ID NO: 67) encoding a polypeptide consisting of a variable site, a human IgG2 hinge region and a human IgG2 constant region (SEQ ID NO: 66), light chain of huAbF46-H4-A1 in which histidine at number 36 is replaced with tyrosine Polype consisting of variable sites and human kappa constant sites Plastid (SEQ ID NO: 68) encoding polynucleotide (SEQ ID NO: 69) was synthesized by requesting the Bioneer Corporation. Thereafter, a DNA segment having a base sequence corresponding to the heavy chain in pOptiVEC ^™ -TOPO TA Cloning Kit contained in Invitrogen's OptiCHO ^™ Antibody Express Kit (Cat no. 12762-019) is used as pcDNA ^™ 3.3. -A DNA section having a nucleotide sequence corresponding to the light chain was inserted into TOPO TA Cloning Kit (Cat no. 8300-01) to construct a vector for expression of the antibody.

Each of the constructed vectors was amplified using Qiagen Maxiprep kit (Cat no. 12562), and transient expression was performed using Freestyle ^™ MAX 293 Expression System (Invitrogen). The cell line used was 293F cells and was cultured in a suspension culture system using FreeStyle ^™ 293 Expression Medium as a medium. One day before transient expression, cells were prepared at a concentration of 5 × 10 ⁵ cells / ml. After 24 hours, temporary expression was performed when the number of cells reached 1 × 10 ⁶ cells / ml. Transduction was performed by the liposomal reagent method using Freestyle ^™ MAX reagent (Invitrogen), and DNA was prepared in a ratio of heavy chain DNA: light chain DNA = 1: 1 in a 15 ml tube and OptiPro ^™ SFM (Invitrogen) Mix with 2 ml (A), mix 100 ml of Freestyle ^™ MAX reagent and 2 ml of OptiPro ^™ SFM in another 15 ml tube, mix (A) and (B), incubate for 15 minutes, and then 1 day before The mixed solution was gradually added to the cells prepared in (1). After the transduction was completed, the cells were cultured for 5 days in a 37 ° C., 80% humidity, 8% CO ₂ , 130 rpm incubator.

  The cultured cells were centrifuged and 100 ml of each supernatant was taken and purified using AKTA Prime (GE Healthcare). A protein A column (GE Healthcare, 17-0405-03) was provided on AKTA Prime, and the culture solution was flowed at a flow rate of 5 ml / min, followed by elution with an IgG elution buffer (Thermo Scientific, 21004). This was buffer-exchanged into PBS, and finally three kinds of antibodies (huAbF46-H4-A1 (U6-HC7), huAbF46-H4-A1 (IgG2 hinge), huAbF46-H4-A1 (IgG2 Fc)) were purified. . Among these, huAbF46-H4-A1 (IgG2 Fc) is selected as a representative of the anti-c-Met antibody according to the present invention and used in the following examples. For convenience, the antibody is used as the anti-c-Met antibody L3-1Y / It was named IgG2.

<Reference Example 2. Preparation of xenograft model and test sample>
Fourteen mouse xenograft models in which a patient-derived tumor tissue (NSCLC, NSCLC, non-small cell lung cancer) was transplanted intraperitoneally were obtained from Oncotest (Germany).

  A candidate drug final form (L3-1Y / IgG2) (n = 10 for each model) and vehicle (n = 10 for each model) are administered to the 14 mouse xenograft models, and the size of the tumor tissue is determined. The presence or absence of reactivity to the antibody was measured.

Once the tumor size in the mouse xenograft model has grown to 500 mm ³ or more, L3-1Y / IgG2 (in the case of control, PBS buffer was administered) is administered once a week in an amount of 5 mg / kg. The experiment was conducted for a total of 6 weeks, and the experiment was interrupted when the tumor size reached 2000 mm ³ or more.

Tumor size (mm ³ ) is calculated by volume using the formula of major axis × minor axis × minor axis × 1/2, and efficacy group discrimination is based on ANOVA analysis, rejecting only hypotheses with a p-value of 0.05 or less I went there. That is, the ANOVA test was conducted on the hypothesis that the tumor size distribution did not change in the group that received the drug compared to the group that did not receive the drug. Discriminated from the group.

  The evaluation results for the presence or absence of reactivity (efficacy) of each mouse xenograft model to L3-1Y / IgG2 treatment are shown in Table 9 below:

  The tumor tissue of the mouse that had already been experimented was removed, and a part of the tumor tissue was prepared as a FFPE (Formalin Fixed Paraffin Embedded, formalin-fixed paraffin-embedded) block, and Qiagen RNeasy Mini Kit (Cat. 74104) and the total RNA was extracted according to the manufacturer's protocol.

  The fabricated FFPE block was used to measure surface-expressed c-MET by standard protocol provided by the manufacturer using Ventana MET IHC (Immunohistochemistry) (Roche; see US2013089541 A1). The extracted total RNA was used for the c-MET mRNA expression experiment by real-time PCR (RT-PCR) (MET sense primer: CCTTGAACAGAACATCG (SEQ ID NO: 272); MET anti-sense primer: CCATGTTTCATGTTAGGGTA (SEQ ID NO: 273)).

  The results obtained using the Ventana MET IHC method are shown in FIG. According to this method, if the IHC score (score) is 2 to 3, it can be judged as an efficacy group. However, as confirmed in FIG. 1, LXFA297, LXFA983, and LXFA1041 classified into the non-efficacy group also have IHC scores of 2 to 3, and the IHC method has high accuracy in selecting the effective group and the non-efficacy group. (Accuracy: about 50%). The “accuracy” is a value calculated in the same manner as “Accuracy” described later, and is multiplied by 100 and converted to 100%.

  On the other hand, FIG. 2 shows the RT-PCR results of the six models (LXFA297, LXFA983, LXFA1041, LXFA623, LXFA526, and LXFA1647) determined as the efficacy group in FIG. In FIG. 2, the Y axis is the Ct value measured by RT-PCR, the X axis is the IHC score, ♦ indicates a non-efficacy group, and ● indicates an efficacy group. As can be seen from FIG. 2, according to the results of RT-PCR, all the non-efficacy groups had Ct values of 0 or more, whereas all the efficacy groups had Ct values lower than 0. Therefore, according to the results of RT-PCR, the efficacy group and the non-efficacy group can be more accurately distinguished as compared with the case of the conventional IHC method (accuracy: about 71% to about 93%). If the results of RT-PCR are mainly used and the IHC score is applied supplementarily, a more accurate distinction can be made as to whether anti-c-Met antibodies are effective (eg, Ct of RT-PCR). When the value is lower than 0 and the IHC score is 2 to 3, it is selected as an efficacy group).

<Example 1: Selection of biomarker>
Using the xenograft sample (14 preclinical samples; Reference Example 2) for the efficacy test of the anti-c-Met antibody L3-1Y / IgG2 prepared in Reference Example 1, anti-c-Met The gene expression level was measured in each of the efficacy group and the non-efficacy group for the antibody L3-1Y / IgG2. The gene expression difference (Δlog2 (exp)) between each group was measured using the result of the obtained gene expression level, and genes having a large difference were selected.

  The gene expression difference was determined by performing a microarray experiment using Affymatrix human u133 plus 2.0 (Affymetrix), and using a microarray analysis console provided by the manufacturer, a log2 value (probe intensity, probe strength) for each probe. Was used as a reference. The probes used at this time are as shown in Table 10:

  Based on the difference in the expression level between the efficacy group and the non-efficacy group, selection was performed in order from the largest difference.

  The obtained results are shown in the following Table 11 (in the following table, the larger the ΔexpFold, the larger the expression difference between the efficacy group and the non-efficacy group):

  As confirmed from Table 11 above, the difference in expression between the efficacy group and the non-efficacy group was shown to be larger in the order of THSD7A, MET, RAB31, FAM126A, PHC1, CHML, ST8SIA4, and CAV1.

  The 8 genes were selected as biomarkers for detecting anti-c-Met antibody efficacy.

<Example 2: Selection of reference marker>
Gene expression between cells using microarray data (GEO: gene expression omnibus; http://www.ncbi.nlm.nih.gov/geo/) of a total of 120 lung cancer adenocarcinomas A gene with less fluctuation was selected.

  For the NSCLC tumor-derived total RNA obtained from GEO, the log2 (int) value for each probe was determined using affymetrix U133 plus 2.0 (Affymetrix), and CV (coefficient of variation, fluctuation among the above 120 samples. The gene with the smallest coefficient was listed. A gene having a log2 (int) value distribution similar to the target gene (eight biomarkers selected in Example 1) was selected. The primers used at this time are summarized in Table 12 below:

  The obtained results are shown in FIGS. As shown in FIG. 3, ten genes with little gene expression fluctuation, ie, EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARAC4, WDR90, and TUT1 were selected as reference markers.

Variations in the 10 selected reference markers and differences in classification performance were measured and compared to a conventional internal control gene (Oncyte DX ^™ ; see FIG. 4).

  The probes and primers used for the 10 selected reference markers are summarized in Table 13 and Table 14 below, respectively:

  Using the 14 NSCLC mRNA samples extracted from 14 xenograft models of Reference Example 2 in the above method, the Ct values varied with respect to the 10 selected reference markers and the conventional internal control gene. Was measured.

The obtained results are shown in FIG. 5 (conventional control gene) and FIG. 6 (selected reference marker). As shown in FIG. 5 and FIG. 6, the average CV value of the 10 reference markers selected in the present invention is about 11.770, and the conventional control gene (Oncyte DX ^™ ) (average CV = 15. It was confirmed that it was significantly lower than 40335). Among the ten reference markers, five genes, RPL23A, TPT1, MATR3, SRSF3, and HNRNPC, had particularly small variation in expression level (average of five genes CV = 8.39).

<Example 3: Selection of efficacy group of anti-c-Met antibody using selected biomarker and reference marker>
The selected biomarkers and reference markers were applied to the mouse xenograft model prepared in Reference Example 2 to test the selection accuracy of these efficacy groups / non-efficacy groups.

  That is, PCR was performed on the total RNA extracted from the tumor tissue of the mouse xenograft model using the probes shown in Table 15 and the primers shown in Table 16 under the conditions shown in Table 17, and the 8 biomarkers and 5 Ct values of the reference markers (TPT1, EEF1M, TUT1, MATR3 and SMARAC4) were obtained.

  At this time, the determination of the efficacy group and the non-efficacy group was according to Table 18 below:

In Table 18,
Standard reference values for CAV1, FAM126A, MET, RAB31, RAB31, ST8SIA4, and THSD7A: [Min (efficacy value (ΔCt)) + Max (non-efficacy value (ΔCt))] / 2;
Standard reference values for CMHL and PHC1: [Min (non-efficacy value (ΔCt)) + Max (efficacy value (ΔCt))] / 2;
ΔCt: {average Ct of five reference markers (TPT1, EEF1M, TUT1, MATR3 and SMARAC4)} — {Ct of the relevant biomarker};
Min (efficacy value (ΔCt)): ΔCt minimum value of the efficacy group;
Max (non-efficacy value (ΔCt)): ΔCt maximum value of non-efficacy group;
Min (non-efficacy value (ΔCt)): ΔCt minimum value of non-efficacy group;
Max (efficacy value (ΔCt)): ΔCt maximum value of the efficacy group).

  ΔCt calculated for each biomarker is compared to the values in Table 18 above, and for CAV1, FAM126A, MET, RAB31, RAB31, ST8SIA4, and THSD7A, the ΔCt value for each biomarker is higher than the value in Table 18 It was judged as an efficacy group. In the case of CMHL and PHC1, when the ΔCt value for each biomarker was lower than the values in Table 18, it was determined as the efficacy group.

  Table 19 below shows the accuracy and “ΔFold” value obtained by determining the efficacy group and the non-efficacy group for the 14 mouse xenograft models prepared in Reference Example 2 by the method described above.

  In Table 19, “Accuracy” and “ΔFold” have the following meanings, respectively.

  Accuracy: Accuracy of antibody efficacy prediction obtained using each biomarker is closer to 1 (corresponding to 100%), and accuracy is higher. It is a value obtained by the following formula.

  ΔFold: ΔCt between control group and non-efficacy group (control gene (reference marker) Ct (when the number of reference markers is 2 or more, it means “average Ct value of reference marker”))-target gene (biomarker ) Ct) difference. The mRNA expression value range which can distinguish a non-efficacy group and a non-reaction group is shown.

  As shown in Table 19, by using the biomarker selected by the present invention and the reference marker, the efficacy group and the non-efficacy group of the anti-c-Met antibody can be classified with an accuracy of about 60% or more, for example, about 80% or more. Judgment is possible.

Claims (13)

A composition for predicting the efficacy of an anti-c-Met antibody or antigen-binding fragment thereof against non-small cell lung cancer or selecting an application target, comprising a biomarker detection molecule or preparation that is THSD7 A. For M ET, RAB31, FAM126A, PHC1 , CHML, further comprising a detection molecule or preparation of the biomarkers are over ST8SIA4 and 1 selected from the group consisting of CAV1 more kinds, non-small cell lung cancer according to claim 1 A composition for predicting the efficacy of an anti-c-Met antibody or an antigen-binding fragment thereof or selecting an application target. The composition for predicting the efficacy of anti-c-Met antibody or antigen-binding fragment thereof for non-small cell lung cancer according to claim 1, further comprising a molecule or preparation for detecting a biomarker that is MET. The composition for predicting the efficacy of anti-c-Met antibody or antigen-binding fragment thereof against non-small cell lung cancer according to claim 1, further comprising a molecule or preparation for detecting a biomarker which is RAB31. The composition for predicting the efficacy of anti-c-Met antibody or an antigen-binding fragment thereof against non-small cell lung cancer according to claim 1, further comprising a molecule or preparation for detecting a biomarker which is FAM126A. The anti-c-Met antibody or antigen-binding fragment thereof for non-small cell lung cancer according to claim 1, further comprising a molecule or preparation for detecting a biomarker that is MET and a biomarker that is RAB31. Composition for. The efficacy of the anti-c-Met antibody or antigen-binding fragment thereof against non-small cell lung cancer according to claim 1, further comprising a molecule or preparation for detecting a biomarker that is MET, a biomarker that is RAB31, and a biomarker that is FAM126A. Composition for prediction or selection of application target. It further comprises a molecule or formulation for detection of a biomarker that is MET, a biomarker that is RAB31, a biomarker that is FAM126A, a biomarker that is PHC1, a biomarker that is CHML, a biomarker that is ST8SIA4, and a biomarker that is CAV1 A composition for predicting the efficacy of an anti-c-Met antibody or an antigen-binding fragment thereof against non-small cell lung cancer according to claim 1 or selecting an application target. EEF1A1, RPL23A, TPT1, HUWE1, MATR3, SRSF3, HNRNPC, SMARCA4, WDR90 and a detector molecule or preparation of one or more reference markers selected from the group consisting of TUT1 additionally, according to claim 1-8 A composition for predicting the efficacy of an anti-c-Met antibody or an antigen-binding fragment thereof against non-small cell lung cancer according to any one of the above or selecting an application target. The detection molecule or preparation is a primer, probe or aptamer that can hybridize with the biomarker or reference marker, or an antibody or aptamer that specifically binds to the protein encoded by the biomarker or reference marker, or these The composition for anti-c-Met antibody or the antigen binding fragment thereof anti-c-Met antibody against non-small cell lung cancer according to claim 9 , which is a combination, or composition for selection of application target. The detection molecule or preparation is one or more probes selected from SEQ ID NOs: 109 to 269, one or more primers selected from SEQ ID NOs: 270 to 305, or a combination thereof. Item 11. A composition for predicting the efficacy or selecting an application target of an anti-c-Met antibody or antigen-binding fragment thereof against non-small cell lung cancer according to any one of Items 1 to 10 . The anti-c-Met antibody or antigen-binding fragment thereof specifically binds to an epitope comprising 5 to 19 consecutive amino acids comprising SEQ ID NO: 73 (EEPSQ) of the amino acid sequence of SEQ ID NO: 71. A composition for predicting the efficacy of an anti-c-Met antibody or an antigen-binding fragment thereof against non-small cell lung cancer according to any one of 1 to 11 , or selecting an application target. The anti-c-Met antibody or antigen-binding fragment thereof against non-small cell lung cancer according to claim 12 , wherein the c-Met antibody or antigen-binding fragment thereof includes any one of the following (i) to (iv): Composition for predicting efficacy or selecting application target;
(I) one or more heavy chain complementarity determining regions selected from the group consisting of the following CDR-H1 to CDR-H3, or a heavy chain variable region comprising the one or more heavy chain complementarity determining regions;
CDR-H1 having the amino acid sequence of SEQ ID NO: 4
CDR-H2 having the amino acid sequence of SEQ ID NO: 5, the amino acid sequence of SEQ ID NO: 2, or the amino acid sequence consisting of 8 to 19 consecutive amino acids including the 3rd to 10th amino acids in the amino acid sequence of SEQ ID NO: 2
CDR-H3 having the amino acid sequence of SEQ ID NO: 6, the amino acid sequence of SEQ ID NO: 85, or the amino acid sequence consisting of 6 to 13 consecutive amino acids including the first to sixth amino acids in the amino acid sequence of SEQ ID NO: 85
(Ii) one or more light chain complementarity determining regions selected from the group consisting of the following CDR-L1 to CDR-L3, or a light chain variable region comprising the one or more light chain complementarity determining regions;
CDR-L1 having amino acid sequence of SEQ ID NO: 7
CDR-L2 having the amino acid sequence of SEQ ID NO: 8
An amino acid sequence consisting of 9 to 17 amino acids including the amino acid sequence of SEQ ID NO: 9, amino acid sequence of SEQ ID NO: 15, amino acid sequence of SEQ ID NO: 86, or amino acids 1 to 9 in the amino acid sequence of SEQ ID NO: 89 CDR-L3 having
(Iii) A combination of the heavy chain complementarity determining region and the light chain complementarity determining region (iv) A combination of the heavy chain variable region and the light chain variable region.