CN104975078A - Method for detecting target siRNA pool in transgene plant - Google Patents
Method for detecting target siRNA pool in transgene plant Download PDFInfo
- Publication number
- CN104975078A CN104975078A CN201510252424.1A CN201510252424A CN104975078A CN 104975078 A CN104975078 A CN 104975078A CN 201510252424 A CN201510252424 A CN 201510252424A CN 104975078 A CN104975078 A CN 104975078A
- Authority
- CN
- China
- Prior art keywords
- rna
- dig
- utp
- target
- filter membrane
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention discloses a method for detecting the target siRNA pool in a transgene plant. The method comprises: adopting target gene DNA as a template to prepare a DIG-UTP labeled antisense RNA strand, wherein the reaction system comprises UTP, ATP, GTP, CTP, DIG-UTP, a RNA polymerase buffer, target DNA, RNA polymerase and deionized water, and a reaction is performed for 0-24 h at a temperature of 10-50 DEG C; removing the target DNA; precipitating RNA; centrifugating, discarding the supernatant, and dissolving the RNA precipitate to obtain a DIG-UTP labeled antisense RNA strand; and detecting the target siRNA pool in the transgene plant by adopting the DIG-UTP labeled antisense RNA strand as the probe through Northern hybridization. The method of the present invention has characteristics of high specificity, simple operation, low cost, and substantial target siRNA pool detection cost reducing.
Description
Technical field
The present invention relates to a kind of method detecting target siRNA pond in transgenic plant.
Background technology
Gene interfere is an important means of research plant gene function, and the accumulation (RNAi) of interference normal ribonucleic acid is a method of Gene interfere.RNAi is a kind of powerful experimental tool, utilizes the silence with the special target gene of double-stranded RNA (dsRNA) induced sequence of homology, suppresses or blocking gene is expressed.SiRNA (siRNA) is by dsRNA through shearing the 21-25 Nucleotide (nt) formed, and is the intermediate product in RNAi approach, is that RNAi plays the necessary factor of effect.Use Expressed in Transgenic Plant dsRNA, the dsRNA of expression can form target siRNA pond by Dicer and Rde-1 effect.
The formation detecting target siRNA pond in transgenic plant is significant for the interfering process of goal in research gene.At present, the method detecting target siRNA pond in transgenic plant mainly contains two kinds: 1. utilize containing radiophosphorus
32the DNA probe of P-dCTP; 2. detect target siRNA and can use synthesis small segment antisense single stranded RNA (ssRNA) (being usually less than 30nt), then use the method for chemically modified, holding at 5 ' or 3 ' of ssRNA increases digoxin (DIG) mark.But, the enforcement of these two kinds of methods has larger restriction: for method 1: there is strict restriction in country to use radio active material, and use radioactive probe to need complicated experimental installation and safeguard procedures, minority unit is only had to have the qualification of operation radio active material, cause the method large-scale promotion to use, entrust the unit with qualification to carry out detecting then expensive; For method 2: the method for chemically modified increases DIG and marks expensive, in target siRNA pond, there is a large amount of target siRNA, a small amount of antisense single stranded RNA is used easily to produce as probe mark effect of missing the target, if synthesize a large amount of antisense single stranded RNA, then because chemically modified increases the expensive and very difficult enforcement of method of DIG.
Summary of the invention
The object of the present invention is to provide a kind of method detecting target siRNA pond in transgenic plant, utilize DIG labeled rna probe to detect target siRNA pond in transgenic plant, the method has high degree of specificity, and simple to operate, cost is low, significantly reduces the testing cost in target siRNA pond.
The present invention realizes based on following theory and technology: the dsRNA of goal gene is the target siRNA of 21-25nt by random shearing in transgenic plant, and the target siRNA of these different IPs nucleotide sequences forms target siRNA pond.Each target siRNA positive-sense strand in the sense-rna chain that the present invention is amplified by target gene and target siRNA pond is all complementary, this sense-rna chain can combine with each target siRNA in Northern crossover process, specifically as shown in Figure 1, improve detection specificity and sensitivity.
To achieve these goals, technical scheme of the present invention is as follows:
Detect the method in target siRNA pond in transgenic plant, it comprises the steps:
(1) with the sense-rna chain that target gene DNA marks for Template preparation DIG-UTP:
1. reaction system comprises: UTP, ATP, GTP, CTP, DIG-UTP, RNA polymerase damping fluid, target dna, RNA polymerase, deionized water, and 10 ~ 50 DEG C are reacted 0 ~ 24 hour.
2. then, in reaction system, DNA enzymatic is added, the target dna in 10 ~ 50 DEG C of reaction removal reaction systems.
3. again, deionized water and lithium chloride solution is added, precipitated rna in-20 ~ 0 DEG C.
4. centrifugal, abandon supernatant, add deionized water dissolving RNA and precipitate, obtain the high purity target sense-rna chain containing multiple DIG-UTP mark.
(2) with DIG-UTP mark sense-rna chain for target siRNA pond in probe in detecting transgenic plant:
1. target gene RNA is carried out polyacrylamide gel, then, target gene RNA is relayed to nitrocellulose filter from polyacrylamide gel, dries filter membrane.
2. then, after the filter membrane prehybridization after drying, step 1 is added) the high purity target sense-rna chain of DIG-UTP mark that obtains, hybridized overnight.
3. again, filter membrane is cleaned, colour developing, exposure, imaging.
Preferably, a kind of method detecting target siRNA pond in transgenic plant, it comprises the steps:
(1) with the sense-rna chain that target gene DNA marks for Template preparation DIG-UTP:
1. reaction system: 50 ~ 200mM UTP, 50 ~ 200mM ATP, 50 ~ 200mM GTP, 50 ~ 200mM CTP, 5 ~ 20mM DIG-UTP, 10 × RNA polymerase damping fluid, 1 ~ 20 μ l target dna, 1 ~ 10 μ l RNA polymerase, 0 ~ 20 μ l deionized water, 25 ~ 45 DEG C, react 0 ~ 10 hour.
2. then, add DNA enzymatic in reaction system, 25 ~ 40 DEG C are reacted 0 ~ 1 hour, remove the target dna in reaction system.
3. deionized water and lithium chloride solution is added again, precipitated rna in-20 ~ 0 DEG C.
4. at 0 ~ 25 DEG C, high speed centrifugation more than 5 minutes, abandons supernatant, adds deionized water dissolving RNA and precipitates, and obtains the high purity target sense-rna chain containing multiple DIG-UTP mark.
(2) with DIG-UTP mark sense-rna chain for target siRNA pond in probe in detecting transgenic plant:
1. RNA is carried out polyacrylamide gel, use half-dried electricity to transfer from one department to another system, RNA is relayed to nitrocellulose filter from polyacrylamide gel, dries filter membrane.
2. filter membrane is put into hybridization solution, 55 ~ 65 DEG C of prehybridizations more than 10 minutes, filter membrane is taken out, immerse in fresh hybridisation solution, add step 1) the high purity target antisense RNA probes of DIG-UTP mark that obtains, 37 ~ 45 DEG C of hybridization more than 5 hours.
3. use low preciseness and high preciseness damping fluid to delay cleaning filter membranes successively, then, filter membrane is soaked in blocking-up liquid and antibody mixing solutions, use film washing liquid to embathe filter membrane.Finally use and detect liquid and nitrite ion immersion filter membrane, after colour developing, filter membrane is put into colour developing imaging system, exposure, takes and preserves imaging picture.
Preferred, a kind of method detecting target siRNA pond in transgenic plant, it comprises the steps:
(1) with the sense-rna chain that target gene DNA marks for Template preparation DIG-UTP:
1. reaction system: 1.7 μ l UTP (100mM), 1.7 μ l ATP (100mM), 1.7 μ l GTP (100mM), 1.7 μ l CTP (100mM), 1.0 μ l DIG-UTP (10mM), 2.0 μ l 10 × RNA polymerase damping fluids, 5.0 μ l target dnas, 2.0 μ lRNA polysaccharases, 3.2 μ l deionized waters, 37 DEG C, react 4 hours.
2. then, add 1 μ l DNA enzymatic in reaction system, 37 DEG C are reacted 15 minutes, remove the target dna in reaction system.
3. add deionized water and lithium chloride solution again, in-20 DEG C, precipitate 1 hour.
4. at 4 DEG C, centrifugal 15 minutes of 12000rpm.Abandon supernatant, add 50 μ l deionized water dissolving RNA and precipitate, obtain the high purity target sense-rna chain containing multiple DIG-UTP mark.
(2) with DIG-UTP mark sense-rna chain for target siRNA pond in probe in detecting transgenic plant:
1. RNA transfer: RNA is carried out polyacrylamide gel, uses half-dried electricity to transfer from one department to another system, is relayed to nitrocellulose filter, dries filter membrane by RNA from polyacrylamide gel.
2. filter membrane is put into hybridization solution, 58 DEG C of prehybridizations 30 minutes, filter membrane is taken out, immerse in fresh hybridisation solution, add step 1) the high purity target antisense RNA probes of DIG-UTP mark that obtains, 42 DEG C of hybridized overnight.
3. use low preciseness and high preciseness damping fluid to delay cleaning filter membranes successively, then, filter membrane is soaked in blocking-up liquid and antibody mixing solutions, use film washing liquid to embathe filter membrane.Finally use and detect liquid and nitrite ion immersion filter membrane, after colour developing, filter membrane is put into colour developing imaging system, exposure, takes and preserves imaging picture.
The invention provides a kind of RNA amplification test kit comprising the sense-rna chain that described DIG-UTP marks.
Again, a kind of RNA amplification test kit comprising the sense-rna chain that described DIG-UTP marks is detecting the application in transgenic plant in target siRNA pond.
In the present invention, step (1) is prepared selected reaction system and reaction conditions in the sense-rna chain of DIG-UTP mark and can be ensured to generate the total length target RNA containing DIG mark, and then effectively in conjunction with each siRNA in siRNA pond, and produce the most effective of RNA under this condition.
In step (2), 55 ~ 65 DEG C of prehybridizations can remove the RNA be not attached on filter membrane fully, improve the specificity of hybridization, make siRNA open double-strand.37 ~ 45 DEG C of hybridized overnight make probe and target siRNA fully contact and combine, and once combine, are not easy to be separated.
Beneficial effect of the present invention:
1. the present invention utilizes DIG labeling nucleic acid to obtain sense-rna chain and the RNA amplification test kit thereof of DIG-UTP mark, for detecting target siRNA pond in transgenic plant, "dead" in testing process, just can synthesize at general biology laboratory, and fewer than making the equipment that radioactive probe needs, low without the need to special safeguard procedures, cost.
2., compared with the method for chemically modified, sense-rna chain and the RNA amplification test kit of DIG-UTP mark can repeatedly use, and the method for this synthesize antisense rna chain makes cost significantly reduce.
3. specificity of the present invention is high, simple to operate.
Accompanying drawing explanation
Fig. 1 is the principle schematic of detection method.
Fig. 2 is the ethidium bromide staining figure using RNA total content in 1% agarose gel analytic sample in the embodiment of the present invention 3.
Fig. 3 is the Northern Blot detection figure corresponding to Fig. 2.
Fig. 4 is the ethidium bromide staining figure using tiny RNA total content in 15% polyacrylamide gel analytic sample in the embodiment of the present invention 5.
Fig. 5 is the Northern Blot detection figure using DIG-UTP antisense RNA probes in the embodiment of the present invention 5.
Fig. 6 is the Northern Blot detection figure using radioactive DNA probe in the embodiment of the present invention 6.
In Fig. 2 ~ Fig. 6, swimming lane 1 is No. 1 RNA sample (non-transgenic plant strain), corresponding No. 2 RNA sample (transgenic plant line) of swimming lane 2-3, No. 3 RNA sample (transgenic plant line).
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.
In the following example if no special instructions, the method described in " Molecular Cloning: A Laboratory guide (third edition) " (Science Press, 2002) is.In the following example, the synthesis of primed DNA and DNA sequencing entrust Shanghai Sheng Gong biotechnology limited-liability company to carry out.Chemical reagent (Trizol, various damping fluid, chloroform etc.), molecular biology kits and enzyme are bought from bio tech ltd of Nan Tian, Hangzhou.Glass used, plastics, hardware are sterilized aseptic after can spending the night with 0.1%DEPC water soaking, wherein glass, hardware also can be dry roasting 6 hours with 180 DEG C, to remove contaminated RNA enzyme.
The preparation of embodiment 1 transgenic plant
In order to prove the versatility of detection method in plant and gene in the present invention, in the present embodiment, plant Arabidopsis thaliana is Expressed in Transgenic Plant dsRNA in mode, dsRNA gene is pattern gene green fluorescent protein (GFP) gene, and GFP sequence is as shown in SEQ ID No:1.
Agrobacterium-mediated Transformation T-DNA carrier builds based on pCambia 1300 carrier (Cambia company), and specific experiment step is as follows:
1) DNA fragmentation that can be used for expressing GFP dsRNA is obtained
The nucleotide sequence of GFP fragment amplifies from pEGFP-N1 carrier (Clontech company), primer two ends design restriction enzyme site:
GFPSF-BamH1:5'GTGGGATCC atgagtaaaggagaagaact, 5 ' end is designed BamHI site
GFPSR-EcoR1:5'GTGGAATTC tttgtatagttcatccatgc, 5 ' end is designed EcoRI site
GFPSF-Sac1:5'GTGGAGCTC atgagtaaaggagaagaact, 5 ' end is designed SacI site
GFPSR2-EcoR1:5'GTGGAATTC gccattctttggtttgtctc, 5 ' end is designed EcoRI site
Be pair of primers by GFPSF-BamH1 and GFPSR-EcoR1, with pEGFP-N1 carrier for template increases, purifying carried out to PCR primer and obtains DNA fragmentation, then carry out BamH1/EcoR1 enzyme and to cut and purifying obtains the DNA fragmentation after purifying, called after GFP-sense.
Be pair of primers by GFPSF-Sac1 and GFPSR2-EcoR1, with pEGFP-N1 carrier for template increases, purifying is carried out to PCR primer and obtains DNA fragmentation, then carry out Sac1/EcoR1 enzyme and to cut and purifying obtains the DNA fragmentation after purifying, called after GFP-anti-sense.
PUCmT carrier (being purchased from Shanghai biotechnology company limited) is carried out enzyme with BamH1 and Sac1 cut and purifying acquisition DNA fragmentation, called after TBS.
GFP-sense, GFP-anti-sense are connected with TBS, are proceeded to by connection product in clone strain e. coli tg1, qualification obtains plasmid T-dsGFP.Plasmid T-dsGFP is carried out BamH1 and Sac1 enzyme cut, obtain nucleotide fragments dsGFP.
2) promotor that can be used for building and terminator nucleotides fragment is obtained.
35S promoter (its sequence is as shown in SEQ ID NO:2) and terminator (its sequence is as shown in SEQ ID NO:3) obtain from pCambia 1300 carrier, the primer of use respectively:
35PF-Hind:5'GCGAAGCTTgcacgacactctcgtctact, 5 ' end is designed HindIII site
35PR-BamH:5'GTGGGATCCagctcgagagagatagatttg, 5 ' end is designed BamHI site
35TF-Sac1:5'GTGGAGCTCtccttcgcaagacccttcct, 5 ' end is designed SacI site;
35TR-Kpn1:5'GTGGGTACCtggattttagtactggattt, 5 ' end is designed KpnI site.
Be pair of primers by 35PF-Hind and 35PR-BamH, with pCambia 1300 carrier for template increases, purifying is carried out to the PCR primer amplified and obtains DNA fragmentation, then carry out Hind3/BamH enzyme and cut and purifying DNA fragmentation after obtaining purifying, called after 35P.
Be pair of primers by 35TF-Sac1 and 35TR-Kpn1, with pCambia 1300 carrier for template increases, purifying is carried out to the PCR primer amplified and obtains DNA fragmentation, then carry out Sac1/Kpn1 enzyme and to cut and purifying obtains the DNA fragmentation after purifying, and called after 35T.
3) dsGFP and 35T fragment is spliced
PUCmT carrier is carried out enzyme with BamH1 and Kpn1 cut and purifying acquisition DNA fragmentation, called after TBK.DsGFP, 35T are connected with TBK, are proceeded to by connection product in clone strain e. coli tg1, qualification obtains plasmid T-dsGFP-T.Plasmid T-dsGFP-T is carried out BamH1 and Kpn1 enzyme and cut acquisition nucleotide fragments dsGFP-T.
4) T-DNA vector construction
PCambia 1300 carrier is carried out enzyme with HindIII and KpnI and cuts acquisition nucleotide fragments 1300-HK, 1300-HK, 35P are connected with dsGFP-T, proceeded to by connection product in clone strain e. coli tg1, qualification obtains the plasmid 1300-35-dsGFP containing T-DNA carrier that can be used for Agrobacterium Plant Transformation.
Plasmid 1300-35-dsGFP is proceeded in agrobacterium strains LBA4044, carry out Plant Transformation with this Agrobacterium.The conversion of Arabidopis thaliana entrusts duplex bio tech ltd, Wuhan to carry out, and obtains transgenic arabidopsis seed.
The extraction of total serum IgE in embodiment 2 transgenic plant
The method of Trizol is used to extract transgenic arabidopsis total tissue RNA.This example concrete operation step is as follows:
1) transgenic arabidopsis tissue and liquid nitrogen are added in mortar, fully grind.
2) by grinding after powder 50mg move in 2ml centrifuge tube, in centrifuge tube, add 1mL Trizol, after thermal agitation mixes 30 seconds, put immediately on ice place 15 minutes, 4 DEG C 12000r/ minute centrifugal 15 minutes.
3) step 2 is got) aqueous phase (being positioned at upper strata) of gained, add equal-volume phenol/chloroform (1:1) mixing, thermal agitation 10 minutes, centrifugal 15 minutes of 4 DEG C of 12000rpm.
4) step 3 is got) aqueous phase (being positioned at upper strata) of gained, add equal-volume chloroform, thermal agitation 10 minutes, more the same centrifugal (4 DEG C 12000rpm centrifugal 15 minutes).
5) step 4 is got) aqueous phase (being positioned at upper strata) of gained, repeating step 3)+step 4).
6) step 5 is got) aqueous phase (being positioned at upper strata) of gained adds Virahol (or primary isoamyl alcohol) mixing of isopyknic precooling, places 20 minutes for subzero 20 DEG C, more the same centrifugal (4 DEG C, centrifugal 15 minutes of 12000rpm).
7) step 6 is got) precipitation of gained washes twice with 70% ethanol, and under room temperature dry 10 minutes, be dissolved in dissolve RNA, packing in the deionization steaming water 50ml of DEPC process ,-20 DEG C were frozen.
8) RNA quality and Concentration Testing.Get 2 μ l steps 7) extract the RNA of gained, detect the light absorption value of itself 260nm and 280nm, be respectively 260nm numerical value (OD260)=5.1,280nm numerical value (OD280)=2.6, OD260/OD280=1.96.According to RNA purity rubric, OD260/OD280 is high purity RNA between 1.8-2.0, therefore the present embodiment obtains high purity RNA.According to RNA concentration (μ g/mL) calculation formula: OD260 value × 40ng/ μ l, the RNA concentration that the present embodiment obtains is 204ng/ μ l, meets follow-up test standard.
The detection of dsRNA in embodiment 3 transgenic plant
In order to determine that in plant, dsRNA expresses, the method for Northern hybridization is used to detect the generation of dsRNA in plant.
Use the method for embodiment 2 to extract 1 strain non-transgenic crop and the total serum IgE of the blade of the different strain transgenic plant of 2 strain, number and be respectively No. 1 RNA (non-transgenic), No. 2 RNA (transgenosis), No. 3 RNA (transgenosis).
Concrete operation step is as follows:
1) in centrifuge tube, by 10 μ l No. 1 RNA sample, No. 2 RNA sample, No. 3 RNA sample respectively with 5 μ lRNA sample-loading buffer mixings, No. 1, No. 2 and No. 3 RNA load solution are obtained.
2) centrifuge tube is covered tightly, dsRNA, after 5 minutes, at once with sample being placed on 10 minutes on ice, is become single stranded RNA by RNA load solution 90 DEG C of incubations.By centrifugal for RNA load solution 10000rpm, in 5 seconds, all liquid in pipe is settled down at the bottom of pipe.
3) record 1% Agarose horizontal gel, analyze total RNA content in RNA load solution.1 × the TBE adding 50ml in triangular flask is damping fluid and 5g agarose, heats in microwave oven, and after agarose dissolves, add the ethidium bromide solution of 50 μ l0.5mg/ml, poured into by agarose solution in glue plate, cooled and solidified forms 1% agarose gel.Electrophoresis chamber for RNA electrophoresis need be cleaned with detergent solution, rinses with water, dry with ethanol, then fills 3%H
2o
2, after room temperature places 10 minutes, with the water cleaning down electrophoresis chamber through DEPC process.1-3 RNA sample is added to gel 1-3 well, gel is immersed in 1 × TBE electrophoresis liquid, carries out electrophoresis with 3-4V/cm voltage.After electrophoresis terminates, under ultraviolet lamp, take RNA stained photographs (as shown in Figure 2).Each swimming lane RNA band is clear in fig. 2, and profile is obvious, does not have traction fuzzy in a large number.This illustrates that RNA is not degraded in RNA load solution, and sample RNA band brightness in 3 swimming lanes is consistent, illustrates that the applied sample amount of RNA in the sample in 3 swimming lanes is consistent.
4) by step 3) in gel after electrophoresis move in a glass dish, repair the nonuseable part of gel with sharp cutter, in the gel upper left corner, (well one end is upper) cuts one jiao, using the mark as gel orientation in following operating process.
5) in glass dish, pour 20ml depurination damping fluid (0.2M HCl) into, room temperature shakes 20 minutes.
6) remove the depurination damping fluid in glass dish, pour 20ml denaturation buffer (50mM NaOH, 1.5M NaCl) into, room temperature shakes 20 minutes.
7) remove the denaturation buffer in glass dish, pour 20ml neutralization buffer (1M Tris, 1.5M NaCl, pH 7.4) into, room temperature shakes 20 minutes.
8) use synthetic glass as platform, place it on plastics square box, above synthetic glass, put the filter paper of a Whatman 3MM.In plastics square box, pour 20 × SSC (3M NaCl, 0.3M sodium citrate, pH 7.0) into, make liquid level a little less than platform surface, when the 3MM filter paper above platform is after capillary action is wetting, drive all bubbles out of with glass stick.
9) nitrocellulose filter is floated over deionized water surface, till filter membrane is drenched from bottom to top, subsequently filter membrane is moved in 20 × SSC and soak 5 minutes, cut filter membrane one jiao with clean scalpel blade, make it corresponding with the corner cut of gel.
10) gel is placed in Whatman 3MM filter paper central authorities, drives all bubbles out of with glass stick.Above gel, place gentle nitrocellulose filter, and both corner cuts are overlapped.An edge of filter membrane should just above the edge of gel top well one line.
11) soak two Whatman 3MM filter paper onesize with gel with 2 × SSC solution (use deionized water 20 × SSC is diluted 10 times), gentle is placed on above moistening nitrocellulose.Bubble is driven out of with glass stick.The paper handkerchief one folded (5-8cm is high) being slightly less than 3MM filter paper is placed on the top of Whatman 3MM filter paper, puts one piece of sheet glass, with the weight compacting sheet glass of 500g above paper handkerchief.Like this, under capillary action, RNA is transferred to filter membrane from gel, and transfer continues to carry out 18 hours.
12) step 11) terminate after, paper handkerchief above removing nitrocellulose filter and Whatman 3MM filter paper, take out nitrocellulose filter, soaked by filter membrane in 2 × SSC solution, taking out filter membrane after 5 minutes lies on a Whatman 3MM filter paper, and 120 DEG C dry roasting 30 minutes.
13) the GFP probe of preparation containing DIG mark
According to interference base because GFP designs primer, carry out pcr amplification, primer sequence is specific as follows:
GFP-F:ATGAGTAAAGGAGAAGAACT
GFP-R:TTTGTATAGTTCATCCATGC
PCR reaction system is: 50 μ l 2 х exo+ polymerase (PFU) Mix, 4 μ l GFP-F (10 μMs), 4 μ l GFP-R (10 μMs), 1 μ l GFP DNA, 41 μ l deionized water (ddH
2o), cumulative volume 100 μ l; PCR response procedures is: 1.95 DEG C, 10 minutes; 2.95 DEG C, 40 seconds; 3.52 DEG C, 40 seconds; 4.68 DEG C, 2 minutes; 5. step 2 ~ 4, circulate 25 times; 6.68 DEG C, 10 minutes; 7.16 DEG C, preserve.Pcr amplification goes out the DNA sequence dna of GFP, and uses PCR primer Purification Kit and obtain the DNA of GFP, and DNA is diluted to 100ng/ μ l.With this DNA for template, the GFP probe that 100 μ l contain DIG mark prepared by use Roche DIG label probe synthetic agent box.
14) by step 12) filter membrane immerse in 10ml DIG Easy Hyb solution (Roche NorthernBlot test kit), 42 DEG C of prehybridizations 30 minutes.Filter membrane is taken out and immerses in fresh 10ml DIG Easy Hyb solution, add step 13) the GFP probe 10 μ l for preparing, 42 DEG C of hybridized overnight.
15) at room temperature, the filter membrane of above-mentioned hybridized overnight is embathed 2 times, each 15 minutes in the low preciseness damping fluid of 20ml (2 × SSC, 0.1%SDS).Filter membrane is taken out, at 65 DEG C, in 20ml height preciseness damping fluid (0.1 × SSC, 0.1%SDS), embathes 2 times, each 15 minutes.Filter membrane is taken out, at room temperature, in 20ml film washing liquid (0.1M maleic acid, 0.15M NaCl, pH 7.5,0.3%Tween), embathes 2 times, each 5 minutes.Filter membrane is taken out, at room temperature, blocks in liquid (Roche NorthernBlot test kit) at 15mL and hatch 30 minutes.Filter membrane is taken out, at room temperature, blocks in liquid and 10 μ lDIG antibody (Roche NorthernBlot test kit) mixing solutionss at 5ml and soak 30 minutes.Filter membrane is taken out, at room temperature, in 20ml film washing liquid (0.1M maleic acid, 0.15M NaCl, pH 7.5,0.3%Tween), embathes 2 times, each 15 minutes.Filter membrane is taken out, at room temperature, detects in liquid (0.1M Tris-HCl, 0.1M NaCl, pH 9.5) at 15mL and soak 5 minutes.Filter membrane is taken out, at 37 DEG C, soaks 10 minutes in 1ml CSPD ready-to-use (Roche NorthernBlot test kit).
16) by step 15) in filter membrane put into chemoluminescence colour developing imaging system (model: sky energy Tanon-6600), expose 2 minutes, take and preserve imaging picture (as shown in Figure 3).
In the present embodiment, sample total serum IgE is attached on filter membrane, if sample comprises the dsRNA of GFP, GFP DNA probe with DIG mark can be fixed on filter membrane with the dsRNA specific binding of GFP, finally in chemoluminescence colour developing imaging system, demonstrates black stripe.If sample does not have the dsRNA of GFP, the GFP DNA probe with DIG mark cannot be attached to nonspecific RNA, just cannot be fixed on filter membrane, finally in chemoluminescence colour developing imaging system, does not show band.
As shown in Figure 3, No. 1 RNA sample sample does not have black stripe, and the dsRNA not having GFP in No. 1 RNA sample is described, this fact being non-transgenic Arabidopis thaliana with No. 1 RNA sample conforms to; No. 2 and No. 3 RNA sample have black stripe, and the dsRNA containing GFP in No. 2 and No. 3 RNA sample is described, illustrate that No. 2 and No. 3 transgenic arabidopsis have expressed the dsRNA of GFP.
The expression amount of dsRNA in plant is relevant with the insertion point of T-DNA in Plant Genome, in Fig. 3, the black stripe of No. 3 samples is obviously large than the band of No. 2 samples, illustrates that the content of the dsRNA of GFP in No. 3 samples is greater than the content of the dsRNA of GFP in No. 2 samples.
Embodiment 4 preparation comprises the sense-rna chain of DIG-UTP
With step 13 in embodiment 3) the 100ng/ μ l GFP DNA that obtains is for template, and preparation comprises the antisense GFP RNA chain of DIG-UTP, and concrete steps are as follows:
1) following reaction system is used: 1.7 μ l UTP (100mM), 1.7 μ l ATP (100mM), 1.7 μ l GTP (100mM), 1.7 μ l CTP (100mM), 1.0 μ l DIG-UTP (10mM), 2.0 μ l 10 × RNA polymerase damping fluid (100mM NaCl, 5mM DTT, pH7.4), 5.0 μ l GFP DNA, 2.0 μ l RNA polymerase, 3.2 μ l deionized waters, 37 DEG C, react 4 hours.In this reaction system, DIG-UTP part can replace conventional UTP, obtains the GFP sense-rna containing multiple DIG-UTP mark.
2) in step 1) add 1 μ l DNA enzymatic in system, 37 DEG C of reactions 15 minutes, remove the DNA in reaction system.Add 15 μ l deionized waters and 15 μ l lithium chloride solutions, in-20 DEG C, precipitate 1 hour.
3) at 4 DEG C, centrifugal 15 minutes of 12000rpm.Abandon supernatant, add 50 μ l deionized water dissolving RNA and precipitate.
4) RNA quality and Concentration Testing: get 2 μ l steps 3) extract the RNA of gained, detect the light absorption value of itself 260nm and 280nm, be respectively: 260nm numerical value (OD260)=2.6,280nm numerical value (OD280)=1.4, OD260/OD280=1.85.According to RNA purity rubric, OD260/OD280 is high purity RNA between 1.8-2.0, therefore obtains high purity RNA in the present embodiment.According to RNA concentration (μ g/mL) calculation formula: OD260 value × 40ng/ μ l, the RNA concentration obtained in the present embodiment is 104ng/ μ l, meets follow-up test standard.
In the present embodiment, obtain the high purity GFP sense-rna containing multiple DIG-UTP mark, called after GFP-DIG-antiRNA.
Embodiment 5 take GFP-DIG-antiRNA as target siRNA pond in probe in detecting transgenic plant
Use the transgenic plant total serum IgE sample obtained in 30 μ l embodiments 3: No. 1 RNA, No. 2 RNA, No. 3 RNA, detect the content in target siRNA pond, concrete operation step is as follows:
1) be damping fluid with 1 × TBE, make 15% polyacrylamide gel.Electrophoresis chamber for RNA electrophoresis need be cleaned with detergent solution, rinses with water, dry with ethanol, then fills 3% (volume %) H
2o
2, after room temperature places 10 minutes, with the water cleaning down electrophoresis chamber through DEPC process.No. 1, No. 2 and No. 3 total serum IgE samples are added to 15% polyacrylamide glue gel well respectively, gel is immersed in 1 × TBE electrophoresis liquid (0.09mol/L Tris-boric acid, 0.002mol/L EDTA), carries out electrophoresis with 30-45mA electric current.
2), after electrophoresis terminates, polyacrylamide gel to be immersed in the ethidium bromide solution comprising 0.5ug/ml 5 minutes.RNA stained photographs (as shown in Figure 4) is taken under ultraviolet lamp.No. 1 in the diagram, No. 2 and No. 3 RNA bands clear, profile is obvious, not have traction fuzzy in a large number, illustrates that RNA is not degraded in RNA load solution, and in 3 samples, the brightness of RNA band unanimously, illustrates that the applied sample amount of RNA in 3 samples is consistent.
3) use half-dried electricity to transfer from one department to another to unite (model: BioRad Trans-Blot), RNA is relayed to nitrocellulose filter from polyacrylamide gel.Turn in journey at electricity, use 0.25 × tbe buffer liquid (1 × TBE electrophoresis liquid dilutes 4 times), 100mA electric current turns 1 hour.
4) take out nitrocellulose filter, take out filter membrane and lie on a Whatman 3MM filter paper after filter membrane is soaked 5 minutes in 2 × SSC solution, 120 DEG C dry roasting 30 minutes.
5) by step 4) in filter membrane immerse in 10ml DIG Easy Hyb solution (Roche NorthernBlot test kit), 58 DEG C of prehybridizations 30 minutes.
6) filter membrane is taken out in the fresh 10ml DIG Easy Hyb solution of immersion, add the GFP-DIG-antiRNA probe 10 μ l of preparation in embodiment 3,42 DEG C of hybridized overnight.
7) at room temperature, by step 6) in filter membrane in the low preciseness damping fluid of 20ml (2 × SSC, 0.1%SDS), embathe 2 times, each 15 minutes.Filter membrane is taken out, at 65 DEG C, in 20ml height preciseness damping fluid (0.1 × SSC, 0.1%SDS), embathes 2 times, each 15 minutes.Filter membrane is taken out, at room temperature, in 20ml film washing liquid (0.1M maleic acid, 0.15M NaCl, pH 7.5,0.3%Tween), embathes 2 times, each 5 minutes.Filter membrane is taken out, at room temperature, blocks in liquid (Roche NorthernBlot test kit) at 15mL and hatch 30 minutes.Filter membrane is taken out, at room temperature, blocks in liquid and 10 μ lDIG antibody (Roche NorthernBlot test kit) mixing solutionss at 5ml and soak 30 minutes.Filter membrane is taken out, at room temperature, in 20ml film washing liquid (0.1M maleic acid, 0.15M NaCl, pH 7.5,0.3%Tween), embathes 2 times, each 15 minutes.Filter membrane is taken out, at room temperature, detects in liquid (0.1M Tris-HCl, 0.1M NaCl, pH 9.5) at 15mL and soak 5 minutes.Filter membrane is taken out, at 37 DEG C, soaks 10 minutes in 1ml CSPD ready-to-use (Roche NorthernBlot test kit).
8) by step 7) in filter membrane put into chemoluminescence colour developing imaging system (model: sky energy Tanon-6600), expose 2 minutes, take and preserve imaging picture (as shown in Figure 5).
In the present embodiment, sample total serum IgE is attached on filter membrane, if sample comprises the siRNA pond of GFP, the antisense RNA probes of the DIG-UTP of GFP can be fixed on (as shown in Figure 1) on filter membrane with the siRNA pond specific binding of GFP, finally in chemoluminescence colour developing imaging system, demonstrates black stripe.If sample does not have the siRNA pond of GFP, the antisense RNA probes of the DIG-UTP of GFP cannot be attached to nonspecific siRNA pond, just cannot be fixed on filter membrane, finally in chemoluminescence colour developing imaging system, does not show band.
As shown in Figure 5, No. 1 RNA sample does not have black stripe, and the siRNA pond not having GFP in No. 1 RNA sample is described, this fact being non-transgenic Arabidopis thaliana with No. 1 RNA sample conforms to; No. 2 and No. 3 RNA sample have black stripe, RNA pond containing GFP in No. 2 and No. 3 samples is described, result illustrates that No. 2 and No. 3 transgenic arabidopsis generate the siRNA pond of GFP, and therefore, the probe of the present invention's design can detect these siRNA ponds specifically.
Embodiment 6 uses radio active material
32p verifies
This experiment uses radio active material
32p verifies the accuracy of embodiment 5 result.This example concrete operation step is as follows:
1)-5): with step 1 in embodiment 5)-5) identical.
6) prepare GFP's
32p probe: use embodiment 3 step 13) the 100ng/ μ l GFP DNA for preparing is template, 95 DEG C of sex change 5 minutes, ice bath 5 minutes.Reaction system is following (uses Promega, Prime-a-Gene Labeling test kit): 0.5 μ ldATP (100mM), 0.5 μ l dTTP (100mM), 0.5 μ l dGTP (100mM), 0.5 μ l dCTP (100mM), 2.0 μ lBSA (10mg/ml), 10 μ l 5 × buffer, 1.0 μ l Klenow enzymes (5u/ μ l), 5.0 μ l
32p-dCTP, 5.0 μ l GFP DNA (100ng/ μ l), 25 μ l deionized waters; React 1 hour under room temperature, 95 DEG C of sex change 5 minutes, ice bath 5 minutes, obtain GFP-
32p probe.
7) filter membrane is taken out in the fresh 10ml DIG Easy Hyb solution of immersion, add GFP-
32p probe 10 μ l, 42 DEG C of hybridized overnight.
8) at room temperature, by step 7) in filter membrane in the low preciseness damping fluid of 20ml (2 × SSC, 0.1%SDS), embathe 2 times, each 15 minutes.Filter membrane is taken out, at 55 DEG C, in 20ml height preciseness damping fluid (0.1 × SSC, 0.1%SDS), embathes 2 times, each 15 minutes.
9) by filter membrane rinsed with deionized water 1 minute, moisture content on film is sucked with filter paper.With thin plastic paper, film is wrapped, be placed in magazine, in darkroom, press X-ray.Magazine radioautograph 3 days, preserves imaging picture (as shown in Figure 6).
In Fig. 6, band is due in probe
32p luminescence develops the color and occurs.In the present embodiment, sample total serum IgE is attached on filter membrane.If sample comprises the siRNA pond of GFP, GFP-
32p probe can be fixed on filter membrane with the siRNA pond specific binding of GFP, finally in darkroom, demonstrates black stripe.If sample does not have the siRNA pond of GFP, GFP-
32p probe cannot be attached to nonspecific siRNA pond and just cannot be fixed on filter membrane, finally in darkroom, does not show band.
As shown in Figure 6, No. 1 RNA sample does not have black stripe, and the siRNA pond not having GFP in No. 1 RNA sample is described; No. 2 and No. 3 sample RNA product have black stripe, and the RNA pond containing GFP in No. 2 and No. 3 samples is described, this result illustrates that No. 2 and No. 3 transgenic arabidopsis generate the siRNA pond of GFP, identical with embodiment 5.Demonstrating the present invention utilizes the method in DIG labeled rna probe in detecting target siRNA pond feasible and accurate.
Claims (5)
1. detect the method in target siRNA pond in transgenic plant, it is characterized in that, comprise the steps:
1) with the sense-rna chain that target gene DNA marks for Template preparation DIG-UTP:
1. reaction system comprises: UTP, ATP, GTP, CTP, DIG-UTP, RNA polymerase damping fluid, target dna, RNA polymerase, deionized water, and 10 ~ 50 DEG C are reacted 0 ~ 24 hour;
2. then, in reaction system, DNA enzymatic is added, the target dna in 10 ~ 50 DEG C of reaction removal reaction systems;
3. again, deionized water and lithium chloride solution is added, precipitated rna in-20 ~ 0 DEG C;
4. centrifugal, abandon supernatant, add deionized water dissolving RNA and precipitate, obtain the high purity target sense-rna chain containing multiple DIG-UTP mark;
2) with DIG-UTP mark sense-rna chain for target siRNA pond in probe in detecting transgenic plant:
1. target gene RNA is carried out polyacrylamide gel, then, target gene RNA is relayed to nitrocellulose filter from polyacrylamide gel, dries filter membrane;
2. then, after the filter membrane prehybridization after drying, step 1 is added) the high purity target sense-rna chain of DIG-UTP mark that obtains, hybridized overnight;
3. again, filter membrane is cleaned, colour developing, exposure, imaging.
2. detect the method in target siRNA pond in transgenic plant as claimed in claim 1, it is characterized in that, comprise the steps:
1) with the sense-rna chain that target gene DNA marks for Template preparation DIG-UTP:
1. reaction system: 50 ~ 200mM UTP, 50 ~ 200mM ATP, 50 ~ 200mM GTP, 50 ~ 200mM CTP, 5 ~ 20mM DIG-UTP, 10 × RNA polymerase damping fluid, 1 ~ 20 μ l target dna, 1 ~ 10 μ l RNA polymerase, 0 ~ 20 μ l deionized water, 25 ~ 45 DEG C, react 0 ~ 10 hour;
2. then, add DNA enzymatic in reaction system, 25 ~ 40 DEG C are reacted 0 ~ 1 hour, remove the target dna in reaction system;
3. deionized water and lithium chloride solution is added, precipitated rna in-20 ~ 0 DEG C;
4. at 0 ~ 25 DEG C, centrifugal more than 5 minutes, abandon supernatant, add deionized water dissolving RNA and precipitate, obtain the high purity target sense-rna chain containing multiple DIG-UTP mark;
2) with DIG-UTP mark sense-rna chain for target siRNA pond in probe in detecting transgenic plant:
1. RNA is carried out polyacrylamide gel, use half-dried electricity to transfer from one department to another system, RNA is relayed to nitrocellulose filter from polyacrylamide gel, dries filter membrane;
2. then, filter membrane is put into hybridization solution, 55 ~ 65 DEG C of prehybridizations more than 10 minutes, filter membrane is taken out, immerse in fresh hybridisation solution, add step 1) the high purity target antisense RNA probes of DIG-UTP mark that obtains, 37 ~ 45 DEG C of hybridization more than 5 hours;
3. again, use low preciseness and high preciseness damping fluid to delay cleaning filter membranes successively, then filter membrane is soaked in blocking-up liquid and antibody mixing solutions, use film washing liquid to embathe filter membrane; Finally use and detect liquid and nitrite ion immersion filter membrane, after colour developing, filter membrane is put into colour developing imaging system, exposure, takes and preserves imaging picture.
3. detect the method in target siRNA pond in transgenic plant as claimed in claim 1 or 2, it is characterized in that, comprise the steps:
1) with the sense-rna chain that target gene DNA marks for Template preparation DIG-UTP:
1. reaction system: 1.7 μ l 100mM UTP, 1.7 μ l 100mM ATP, 1.7 μ l 100mM GTP, 1.7 μ l 100mMCTP, 1.0 μ l 10mM DIG-UTP, 2.0 μ l 10 × RNA polymerase damping fluids, 5.0 μ l target dnas, 2.0 μ lRNA polysaccharases, 3.2 μ l deionized waters, 37 DEG C, react 4 hours;
2. then, add DNA enzymatic in reaction system, 37 DEG C are reacted 15 minutes, remove the target dna in reaction system;
3. again, add deionized water and lithium chloride solution, in-20 DEG C, precipitate 1 hour;
4. at 4 DEG C, centrifugal 15 minutes of 12000rpm, abandons supernatant, adds deionized water dissolving RNA and precipitates, and obtains the high purity target sense-rna chain containing multiple DIG-UTP mark.
2) with DIG-UTP mark sense-rna chain for target siRNA pond in probe in detecting transgenic plant:
1. RNA is carried out polyacrylamide gel, use half-dried electricity to transfer from one department to another system, RNA is relayed to nitrocellulose filter from polyacrylamide gel, dries filter membrane;
2. then, filter membrane is put into hybridization solution, 58 DEG C of prehybridizations 30 minutes, filter membrane is taken out, immerse in fresh hybridisation solution, add step 1) the high purity target antisense RNA probes of DIG-UTP mark that obtains, 42 DEG C of hybridized overnight;
3. again, use low preciseness and high preciseness damping fluid to delay cleaning filter membranes successively, then, filter membrane is soaked in blocking-up liquid and antibody mixing solutions, use film washing liquid to embathe filter membrane; Finally use and detect liquid and nitrite ion immersion filter membrane, after colour developing, filter membrane is put into colour developing imaging system, exposure, takes and preserves imaging picture.
4. one kind comprises the RNA amplification test kit of the sense-rna chain of DIG-UTP mark described in any one of claim 1-3.
5. RNA amplification test kit as claimed in claim 4 is detecting the application in transgenic plant in target siRNA pond.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510252424.1A CN104975078A (en) | 2015-05-18 | 2015-05-18 | Method for detecting target siRNA pool in transgene plant |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510252424.1A CN104975078A (en) | 2015-05-18 | 2015-05-18 | Method for detecting target siRNA pool in transgene plant |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104975078A true CN104975078A (en) | 2015-10-14 |
Family
ID=54272042
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510252424.1A Pending CN104975078A (en) | 2015-05-18 | 2015-05-18 | Method for detecting target siRNA pool in transgene plant |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104975078A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1961081A (en) * | 2004-04-07 | 2007-05-09 | 埃克斯魁恩公司 | Methods for quantification of microRNA and small interfering RNA |
-
2015
- 2015-05-18 CN CN201510252424.1A patent/CN104975078A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1961081A (en) * | 2004-04-07 | 2007-05-09 | 埃克斯魁恩公司 | Methods for quantification of microRNA and small interfering RNA |
Non-Patent Citations (3)
| Title |
|---|
| KAZUNORI ET AL: "A Simple and Rapid Method to Detect Plant siRNAs Using Nonradioactive Probes", 《PLANT MOLECULAR BIOLOGY REPORTER》 * |
| ROCHE: "DIG RNA Labeling Kit(SP6/T7)", 《WWW.ROCHO-APPLIED-SCIENCE.COM》 * |
| 温宗华 等: "地高辛标记斑马鱼cd99l2基因RNA探针的制备", 《南方医科大学学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109251963B (en) | Method and kit for detecting mycoplasma pollution in cell culture solution at constant temperature | |
| US8115058B2 (en) | Rice promoters for regulation of plant expression | |
| Josefsen et al. | Northern blotting analysis | |
| Xu et al. | Overexpression of the transcription factor MdbHLH33 increases cold tolerance of transgenic apple callus | |
| WO2003007699A2 (en) | Transcription factors of cereals | |
| Zhou et al. | Sequence-specific interaction between S1F, a spinach nuclear factor, and a negative cis-element conserved in plastid-related genes. | |
| Carbonell et al. | Design, synthesis, and functional analysis of highly specific artificial small RNAs with antiviral activity in plants | |
| He et al. | Molecular characterization of a stress-response bZIP transcription factor in banana | |
| López-Gomollón | Detecting sRNAs by Northern blotting | |
| Martin et al. | Simple purification of small RNAs from seeds and efficient detection of multiple microRNAs expressed in Arabidopsis thaliana and tomato (Lycopersicon esculentum) seeds | |
| CN104975078A (en) | Method for detecting target siRNA pool in transgene plant | |
| Mette et al. | Analysis of double-stranded RNA and small RNAs involved in RNA-mediated transcriptional gene silencing | |
| Bleys et al. | Down-regulation of endogenes mediated by a transitive silencing signal | |
| CN106754891A (en) | A kind of RNA antisenses purification process | |
| US20050032156A1 (en) | Identification and characterization of phosphate transporter genes | |
| CN105985956B (en) | A kind of adverse circumstance induced expression GhiWRKY40 promoters and its application | |
| CN105985957B (en) | A kind of adverse circumstance induced expression Ghi10424 promoters and its application | |
| Green et al. | Mapping RNA with nuclease S1 | |
| Archer et al. | Trypanosomes as a model to investigate mRNA decay pathways | |
| CN103937882A (en) | Triplex PCR detection method for Songjiang perch microsatellite markers | |
| Sagripanti | The genome of simian hemorrhagic fever virus | |
| CN117625628B (en) | ProPgJOX2 promoter for enhancing stress resistance of ginseng and application thereof | |
| CN113234748B (en) | RXR yeast transcription activation system and labeled sediment toxicology experiment method thereof | |
| Watakabe et al. | Non-destructive bioluminescence detection system for monitoring defense gene expression in tobacco BY-2 cells | |
| CN110512026B (en) | Biotin labeling method for detecting H7N9 subtype avian influenza virus genome vRNA-vRNA interaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151014 |