CN103937882A - Triplex PCR detection method for Songjiang perch microsatellite markers - Google Patents
Triplex PCR detection method for Songjiang perch microsatellite markers Download PDFInfo
- Publication number
- CN103937882A CN103937882A CN201410118158.9A CN201410118158A CN103937882A CN 103937882 A CN103937882 A CN 103937882A CN 201410118158 A CN201410118158 A CN 201410118158A CN 103937882 A CN103937882 A CN 103937882A
- Authority
- CN
- China
- Prior art keywords
- sjl
- pcr
- trachi dermus
- fasciatus heckel
- dermus fasciatus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This invention relates to a triplex PCR detection method for Songjiang perch microsatellite markers. The detection method comprises (1) extracting genomic DNA of Songjiang perch fin ray and diluting, (2) synthesizing a microsatellite primer; (3) optimizing a PCR reaction system and amplification procedures; (4) detecting a PCR product. According to the invention, a triplex PCR reaction system for parentage identification of Songjiang perch, analysis of genetic diversity and comparison of the genetic structure is established and the simultaneous detection of three microsatellite loci in a PCR reaction system is realized. The triplex PCR detection method disclosed by the invention is easy in operation and high in efficiency and can be applied in protecting endangered species, analyzing genetic structure of the population, constructing a genetic map and identifying germplasm of Songjiang perch.
Description
Technical field
The invention belongs to Trachi dermus Fasciatus Heckel field of molecular marker, particularly 3 of a kind of Trachi dermus Fasciatus Heckel microsatellite marker heavy PCR detection methods.
Background technology
Trachi dermus Fasciatus Heckel classification position is Rockfish shape order (Scorpaeniformes), Cottidae (Cottidae), trachidermus fasciatus genus (Trachidermus), a kind of famous and precious warm warm nature shallow water demersal fish, there is the habit of falling river migration, be one of " Chinese four your name fishes ".Be distributed widely in China coast, comprise the ground such as Xiamen of Fujian Province from Bohai and Yellow Seas to the East Sea, but topmost producing region is Yangtze River Delta, near the Trachi dermus Fasciatus Heckel that Songjiang, produce (modern District of Shanghai) is in history the most famous, therefore gain the name " trachidermus fasciatus ".At present, Trachi dermus Fasciatus Heckel has been put into China focused protection secondary hydrocoles.Yet; the domestic research for Trachi dermus Fasciatus Heckel at present focuses mostly on aspect its reproductive biology and developmental biology; the research of relevant genetics aspect is relatively less; for protecting better and utilize this rare resources that precious background information is provided, it is particularly necessary that the research that utilizes microsatellite marker to carry out Trachi dermus Fasciatus Heckel genetics aspect seems.
Micro-satellite (microsatellite) is called again short series connection and repeats (Short Tandem Repeats, STR), simple repeated sequence (Simple Sequence Repeats, SSR), be distributed in widely in Eukaryotic genome, every 50～150kb left and right just there will be once, and fish are repeated as the abundantest in CA, GT with dinucleotides especially.Because it is widely distributed, meet Mendelian's codominant inheritance, polymorphism information content is high, sudden change is fast, primer has highly versatile, be convenient to the advantages such as detection, become one of the main molecules mark of the QTL location etc. of structure, molecular evolution research, population genetics, pedigree analysis and genetic breeding, marker assisted selection and the economic characters of carrying out genetic linkage maps.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of 3 heavy PCR detection methods of Trachi dermus Fasciatus Heckel microsatellite marker; the method is simple and efficient to handle, efficiency is high, can in the protection of Trachi dermus Fasciatus Heckel endangered species, Genetic Constitution of Population analysis, genetic map construction, Idioplasm identification, be applied.
3 heavy PCR detection methods of a kind of Trachi dermus Fasciatus Heckel microsatellite marker of the present invention, comprising:
(1) fin ray of clip Trachi dermus Fasciatus Heckel, extracts genomic dna;
(2) the forward and reverse primer of micro-satellite of synthetic different loci, primer sequence is as follows:
SJL-C47：F:GGAGGCGGATGATGTTGGA；
R:ACTGCGGTAATGTGCGTTTC；
SJL-B61：F:ACCAGTTCCATCCAGCAGTTG；
R:CCGACACGCTCACCGTATTTC；
SJL-D25：F:GAATGCGGGTTCAAGGTAG；
R:GGCACATAACGGCTTCACTG；
(3) use pcr amplification system and the amplification program optimized to carry out 3 heavy pcr amplifications to different Trachi dermus Fasciatus Heckel individualities;
(4) PCR product is carried out to polyacrylamide gel electrophoresis detection, determine individual genotype, obtain Trachi dermus Fasciatus Heckel genetic polymorphism collection of illustrative plates.
Pcr amplification system in described step (3) is 10 * Buffer5 μ L, 25mM MgCl
23 μ L, respectively containing 10mM dNTP1.0 μ L, 100ng/ μ L template 1 μ L, SJL-D25, SJL-B61, each 1 μ L of the forward and reverse primer of SJL-C47,5U/ μ L Taq archaeal dna polymerase 0.4 μ L, ddH
2o8.6 μ L.
In described 10 * Buffer, contain 200mM Tris-HCl pH8.825 ℃, 100mM KCl, 100mM (NH
4)
2sO
4, 1.0%Triton X-100.
Pcr amplification program in described step (3) is after 94 ℃ of sex change 5min, to carry out program below: 94 ℃ of sex change 30S, and 55 ℃ of annealing 30S, 65 ℃ are extended 1min, carry out 30 circulations, and last 65 ℃ are extended 7min.
Polyacrylamide gel electrophoresis in described step (4) detects and is specially: first use 2% agarose gel electrophoresis, having or not of EB dyeing grade-judging stopping pregnancy thing, then use 8% non-denaturing polyacrylamide gel 200V constant voltage electrophoresis 1.5 hours, 7.5% acetum is 15min fixedly, then with deionized water, wash glue 3 times, each 5min, then 0.15% silver nitrate solution silver dyes 30min, development 2-3min, finally fixing 5min.
1,2,3 the genotypic method of the definite individuality in described step (4) is: an allelotrope using each DNA fragmentation in electrophoretic band as this site is processed, and the allelotrope of each site amplification is defined as from big to small successively by the difference of its mobility: ..., k.Because microsatellite marker is codominant marker, at Single locus, homozygote is a band, and heterozygote is two bands, adds up each sample genotype.
In the present invention, the sequence of related 3 microsatellite locus (SJL-C47, SJL-B61, SJL-D25) is as shown in SEQ ID NO:1-3.
In Fig. 1: 1-6 is different Trachi dermus Fasciatus Heckel individuality; 3 intervals that microsatellite locus increases in Different Individual in figure, have been indicated simultaneously.Primer SJL-D25 amplification efficiency is minimum, in electrophoretogram, mays be seen indistinctly; Secondly be SJL-B61, electrophoretogram is relatively clear; SJL-C47 amplification efficiency is the highest, and the allelotrope in each site is all high-visible.Meanwhile, can find out that SJL-B61 only detects 1 allelotrope, Different Individual does not show polymorphism in this site yet, and other 2 sites have all detected the allelotrope that quantity does not wait in Different Individual.Label is that 1 individuality only detects an allelotrope at site SJL-C47, illustrates that this individuality is homozygote in this site, and all the other individualities all detect two allelotrope, show that 2 to No. 6 individualities are heterozygote at site SJL-C47; Equally, 6 Different Individual are also homozygote heterozygotes and deposit at site SJL-D25.
beneficial effect
The present invention has set up the 3 heavy PCR reaction systems of carrying out Trachi dermus Fasciatus Heckel paternity test, analysis of genetic diversity, genetic construction comparison; realized in a PCR reaction and detected 3 microsatellite locus simultaneously; simple and efficient to handle, efficiency is high, can in the protection of Trachi dermus Fasciatus Heckel endangered species, Genetic Constitution of Population analysis, genetic map construction, Idioplasm identification, be applied.
Accompanying drawing explanation
Fig. 1 is the heavy pcr amplification polyacrylamide gel electrophoresis figure of Trachi dermus Fasciatus Heckel 3.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read the content of the present invention's instruction, these equivalent form of values fall within the application's appended claims limited range equally.
Embodiment 1
1, Trachi dermus Fasciatus Heckel is got in Trachi dermus Fasciatus Heckel sample collecting and DNA preparation, clip fin ray is put into 95% alcohol preservation, the about 0.1g of clip fin ray rinses with distilled water, with filter paper, blot the centrifuge tube of putting into 1.5mL, add 465 μ L STE(150mmol/L NaCl, 50mmol/L Tris, 1mmol/L EDTA) damping fluid, the 10%SDS of 25 μ L, 10 μ L Proteinase Ks (20mg/mL) mix, 55 ℃ of digestion are spent the night, with phenol, each extracting of chloroform and phenol/chloroform once, isopyknic isopropanol precipitating, 12, the centrifugal 30min of 000r/min, precipitation is washed 2 times with 70% ethanol, with 50 μ L distilled waters, dissolve again, on 0.8% sepharose, detect quality and the concentration of DNA.
2, the forward and reverse primer of micro-satellite of the synthetic different loci of Trachi dermus Fasciatus Heckel microsatellite marker primer.
Primer sequence is as follows:
SJL-C47：F:GGAGGCGGATGATGTTGGA；
R:ACTGCGGTAATGTGCGTTTC；
SJL-B61：F:ACCAGTTCCATCCAGCAGTTG；
R:CCGACACGCTCACCGTATTTC；
SJL-D25：F:GAATGCGGGTTCAAGGTAG；
R:GGCACATAACGGCTTCACTG。
3, the heavy pcr amplification of Trachi dermus Fasciatus Heckel 3 uses the above pcr amplification system of having optimized and amplification program to carry out 3 heavy pcr amplifications to different Trachi dermus Fasciatus Heckel individualities.
The heavy pcr amplification system of Trachi dermus Fasciatus Heckel 3: 10 * Buffer (200mM Tris-HCl (pH8.825 ℃), 100mM KCl, 100mM (NH4)
2sO
4, 1.0%Triton X-100.) 5 μ L, MgCl
2(25mM) 3 μ L, dNTP (respectively containing 10mM) 1.0 μ L, template (100ng/ μ L) 1 μ L, SJL-D25, SJL-B61, each 1 μ L of the forward and reverse primer of SJL-C47, Taq archaeal dna polymerase (5U/ μ L) 0.4 μ L, ddH
2o8.6 μ L.
The heavy pcr amplification program of Trachi dermus Fasciatus Heckel 3: carry out program below after 94 ℃ of sex change 5min: 94 ℃ of sex change 30S, 55 ℃ of annealing 30S, 65 ℃ are extended 1min, carry out 30 circulations, and last 65 ℃ are extended 7min.
4, product detection pcr amplification product first carries out electrophoresis with 2% sepharose, in gel imaging system according to the brightness judgement amplified production of band having or not or amplification amount number, then with 8% native polyacrylamide gel electrophoresis, carry out the gene type of Different Individual.
4.1 prepare glue sheet glass
With Bind-Silane, process large sheet glass, gel is pasted with it; With Repel-Silane, process little sheet glass, make gel be easy to peel off.Conventionally two blocks of glass plates of separated placement are in order to avoid crossed contamination is delineated marks to distinguish undressed one side two glass plate outer rims.
1) with 95% ethanol, clean sheet glass.
2) process little glass plate: add 3ml Repel-Silane in the little glass plate one side of marking not, with paper handkerchief, it is evenly spread upon to whole surface.Drying at room temperature 5min wipes unnecessary Repeo-Silane with paper handkerchief, and deionized water soaks glass plate 60min.In deionized water, with paper handkerchief, clean glass plate three times, then make it airing, then with 95% ethanol, clean standby.
3) process large glass plate: in stink cupboard, prepare Bind-Silane, add 1 μ l Bind Silane and contain in 95% ethanol of 5% acetic acid (50 μ l acetic acid add 950 μ l ethanol) in 1ml.Abundant mixing makes limpid bright, is all added to the not one side of marking of large glass plate, with rag, evenly smears whole surface.Room temperature 5min volatilizes and uses 95% ethanol to clean and washes away unnecessary Bind-Silane for 3-4 time.
4) clean and prepare 0.4mm spacer bar, application of sample comb and metal clip, the glass plate of handling well is placed on Horizontal glue-making mould, prepare glue.
4.2 preparation polyacrylamide gels
（8% Acr/Bis Gel/0.4mm）
Two acryloyl ammonium (19:1) 10ml of 40% methene
5×TBE 5ml
Deionized water 35ml
On heating magnetic stirring apparatus, urea is dissolved.After urea dissolves, with 0.2 μ m filter, filter coagulant liquid, pour into 100ml beaker.
Then add rapidly:
TEMED 25μl
10% ammonium persulphate 250 μ l
(fresh preparation)
1) with a 60ml syringe, carefully gel mixed solution drawn and added between two blocks of glass plates sealing the end and limit, allowing liquid upwards inject continuously until liquid level arrives glass plate top from bottom, avoiding Bubble formation.
2) between the two glass plates of top, insert rapidly application of sample comb, and with the fixing glass plate of metal clip.
3) room temperature makes gel polymerisation 1h.
4.3 prerunning
1) after gel polymerisation is good, remove metal clip, gel slab is fixed on Vertial electrophorestic tank.
2) groove up and down at Vertial electrophorestic tank adds respectively about 500ml0.5 * tbe buffer liquid.
3) carefully remove application of sample comb, with pipettor, carefully rush liquid loading slot.
4.4 polyacrylamide gel electrophoresis
1) 3 μ l amplified productions are added to (if the not enough 3ul of sample supplies 3ul with deionized water) in the Eppendorf tube that mark is good.
2) add 3 μ l methane amide load sample damping fluids (95% methane amide, 0.05% bromjophenol blue).
3) allelotrope object of reference is set, every part of 3 μ l allelotrope add 3 μ l methane amide load sample damping fluids.
4) after Gel Pre electrophoresis finishes, with pipettor, again rinse loading slot, then successively sample and ladder are added to gel loading slot from left to right.It is soft that attention action is wanted, and avoids sample drift.
5) constant voltage 200V electrophoresis is 1.5 hours.
4.5 silver medals dye
Precaution:
1) formaldehyde and Glacial acetic acid can cause skin and eyes grievous injury, should be in ventilation in order to avoid suck its Volatilized smell during use.And lab-gown, wear gloves and eye shield.
2) sodium carbonate, Sulfothiorine and Silver Nitrate also can cause skin and eye irritation reaction, during use, should take safeguard procedures.
4.5.1 reagent preparation
1) in stink cupboard, prepare stationary liquid: (1000ml)
Acetic acid 75ml
Deionized water 925ml
2) prepare silver-colored dye liquor (500ml):
Silver Nitrate 0.75g
Deionized water 500ml
Add 750 μ l formaldehyde with first 15 minutes, note opacus preservation.
3) preparing developer liquid (500ml):
Sodium carbonate solution 125ml (120g/L)
Hypo solution 500ul (4mg/ml)
Deionized water 500ml
4 ℃ of-8 ℃ of preservations, with within first 5 minutes, adding 750ul formaldehyde.
4.5.2 silver dyes step
1), after electrophoresis finishes, from electrophoresis chamber, take off gel glass plate, two sheet glass of careful separation, gel sticks on large glass plate.Large glass plate is put into silver gently and dye box.At silver, dye in each step operation, gel all should be placed on rotary shaker and make it slowly to shake.
2) add 500ml stationary liquid impregnation 15min, residue stationary liquid is stored in 4 ℃ and uses to the 7th step.
3) outwell stationary liquid, with deionized water, wash glue three times, each 500ml, altogether 5min.
4) outwell deionized water, add 500ml silver dye liquor.Opacus, impregnation 30min.
5) silver-colored dye liquor is poured in returnable.With deionized water, wash fast glue 10-20s
6) add 500ml developing solution.Opacus, impregnation 2-3min, until bands of a spectrum show.
7) outwell developing solution, add 500ml stationary liquid, impregnation 5min.
8) outwell stationary liquid, offset plate erect to 5min, or etc. glass plate dry.
9) treat gel drying, bands of a spectrum will be more clear.
Remarks:
1) when glass plate is removed gel, can scrape and pick gently with blade, if needed, when residual gel can soak 1h in 10%NaOH, thoroughly to remove, finally with 95% second alcohol and water, clean.
2) treatment of nitric acid silver waste liquid adds used developing solution in returnable, spends the night, and makes silver ions precipitation, by filter, filters silver ions suspension, collects silver ions crystallization, outwells and filters supernatant liquor water flushing.
Claims (5)
1. 3 of Trachi dermus Fasciatus Heckel microsatellite marker weigh PCR detection methods, comprising:
(1) fin ray of clip Trachi dermus Fasciatus Heckel, extracts genomic dna;
(2) the forward and reverse primer of micro-satellite of synthetic different loci, primer sequence is as follows:
SJL-C47：F:GGAGGCGGATGATGTTGGA；
R:ACTGCGGTAATGTGCGTTTC；
SJL-B61：F:ACCAGTTCCATCCAGCAGTTG；
R:CCGACACGCTCACCGTATTTC；
SJL-D25：F:GAATGCGGGTTCAAGGTAG；
R:GGCACATAACGGCTTCACTG；
(3) use pcr amplification system and the amplification program optimized to carry out 3 heavy pcr amplifications to different Trachi dermus Fasciatus Heckel individualities;
(4) PCR product is carried out to polyacrylamide gel electrophoresis detection, determine individual genotype, obtain Trachi dermus Fasciatus Heckel genetic polymorphism collection of illustrative plates.
2. 3 of a kind of Trachi dermus Fasciatus Heckel microsatellite marker according to claim 1 heavy PCR detection methods, is characterized in that: the pcr amplification system in described step (3) is 10 * Buffer5 μ L, 25mM MgCl
23 μ L, respectively containing 10mM dNTP1.0 μ L, 100ng/ μ L template 1 μ L, SJL-D25, SJL-B61, each 1 μ L of the forward and reverse primer of SJL-C47,5U/ μ L Taq archaeal dna polymerase 0.4 μ L, ddH
2o8.6 μ L.
3. 3 of a kind of Trachi dermus Fasciatus Heckel microsatellite marker according to claim 2 heavy PCR detection methods, is characterized in that: in described 10 * Buffer, contain 200mM Tris-HCl pH8.825 ℃, 100mM KCl, 100mM (NH
4)
2sO
4, 1.0%TritonX-100.
4. 3 of a kind of Trachi dermus Fasciatus Heckel microsatellite marker according to claim 1 weigh PCR detection methods, it is characterized in that: the pcr amplification program in described step (3) is after 94 ℃ of sex change 5min, to carry out program below: 94 ℃ of sex change 30S, 55 ℃ of annealing 30S, 65 ℃ are extended 1min, carry out 30 circulations, last 65 ℃ are extended 7min.
5. 3 of a kind of Trachi dermus Fasciatus Heckel microsatellite marker according to claim 1 weigh PCR detection methods, it is characterized in that: the polyacrylamide gel electrophoresis in described step (4) detects and is specially: first use 2% agarose gel electrophoresis, having or not of EB dyeing grade-judging stopping pregnancy thing, then use 8% non-denaturing polyacrylamide gel 200V constant voltage electrophoresis 1.5 hours, 7.5% acetum is 15min fixedly, then with deionized water, wash glue 3 times, each 5min, then 0.15% silver nitrate solution silver dyes 30min, development 2-3min, finally fixing 5min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410118158.9A CN103937882A (en) | 2014-03-26 | 2014-03-26 | Triplex PCR detection method for Songjiang perch microsatellite markers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410118158.9A CN103937882A (en) | 2014-03-26 | 2014-03-26 | Triplex PCR detection method for Songjiang perch microsatellite markers |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103937882A true CN103937882A (en) | 2014-07-23 |
Family
ID=51185749
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410118158.9A Pending CN103937882A (en) | 2014-03-26 | 2014-03-26 | Triplex PCR detection method for Songjiang perch microsatellite markers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103937882A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086174A (en) * | 2016-06-15 | 2016-11-09 | 中国水产科学研究院北戴河中心实验站 | A kind of accurate discriminating recapture Bastard halibut is released the method for fish |
| CN106701931A (en) * | 2016-12-14 | 2017-05-24 | 中国水产科学研究院珠江水产研究所 | SNP (single nucleotide polymorphism) marker related to rapid growth of micropterus salmoide L. 'excellent bass No. 1' and application of SNP marker |
-
2014
- 2014-03-26 CN CN201410118158.9A patent/CN103937882A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| GUIJING REN ET AL: "Development and characterization of fourteen microsatellite loci in a threatened catadromous fish Trachidermus fasciatus", 《CONSERVATION GENET RESOUR》 * |
| 丁炜东等: "草鱼种质相关SRAP及SCAR的分子标记", 《动物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086174A (en) * | 2016-06-15 | 2016-11-09 | 中国水产科学研究院北戴河中心实验站 | A kind of accurate discriminating recapture Bastard halibut is released the method for fish |
| CN106701931A (en) * | 2016-12-14 | 2017-05-24 | 中国水产科学研究院珠江水产研究所 | SNP (single nucleotide polymorphism) marker related to rapid growth of micropterus salmoide L. 'excellent bass No. 1' and application of SNP marker |
| CN106701931B (en) * | 2016-12-14 | 2020-09-18 | 中国水产科学研究院珠江水产研究所 | SNP marker related to rapid growth of Micropterus salmoides 'Youbei No. 1' and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102939381B (en) | Nucleic acid is extracted from wax embedded samples | |
| CN109706236A (en) | A method of utilizing micrococcal nuclease plant identification genome open chromatin site | |
| CN108277287B (en) | Molecular marker, kit and distinguishing method for distinguishing black-dragon-river triangular bream from megalobrama fish | |
| CN109161603A (en) | The microsatellite marker primer and genetic sex identification method of channel catfish gunther sex-linked | |
| CN105525012B (en) | A kind of method for identifying molecules of peanut hybridization kind | |
| CN103320425B (en) | Rapid extraction method of shellfish deoxyribonucleic acid (DNA) for large-scale and high-throughput genotyping | |
| CN108315465A (en) | A kind of and cowpea salt tolerant correlated traits close linkage InDel molecular labelings and its primer and application | |
| CN101914529B (en) | Cynoglossus semilaevis gunther sex-linked microsatellite marker and genetics sex testing method | |
| CN103937882A (en) | Triplex PCR detection method for Songjiang perch microsatellite markers | |
| CN107254542B (en) | Watermelon flesh color character major gene locus and InDel molecular marker and application thereof | |
| CN108950054A (en) | A kind of InDel molecular marker and primer thereof and application with cowpea salt tolerant correlated traits close linkage | |
| CN107475243A (en) | A kind of method for improveing phenol extracted total RNA | |
| CN106399500B (en) | A kind of molecular identification method of Big Salangid and neosalanx taihuensis | |
| CN110551826A (en) | Microsatellite primer, kit and identification method for identifying crocus tridacna, tridacna and first filial generation thereof | |
| CN110699462B (en) | Tridacron oyster microsatellite locus and identification primer | |
| CN108220456A (en) | It is a kind of to identify Hong Kong oyster, Kumamoto oyster and its EST-SSR primers and identification method that hybridize first filial generation | |
| CN111850138A (en) | Molecular marker, kit and method for distinguishing triangular bream and megalobrama amblycephala in Heilongjiang and hybrid thereof | |
| Zhou et al. | Direct fluorescent primers are superior to M13-tailed primers for Pinus taeda microsatellites | |
| CN103614374B (en) | Platysternon megacephalum microsatellite marked specific primer and detection method thereof | |
| CN101967519A (en) | Method for identifying fx151 genetic variation map by using litopenaeus vannamei boone fx151 microsatellite DNA marker | |
| CN102277438B (en) | Method for detecting EcSSR1024 microsatellite DNA marker in exopalaemon carinicauda | |
| CN108570509A (en) | A kind of detection method of exopalaemon carinicauda EC16 SNP markers | |
| Singh et al. | The chromosomal localisation of satellite DNA in Ptyas mucosus (Ophidia, Colubridae) | |
| CN110452998A (en) | The method for carrying out yellow crucian carp genetic analysis using mitochondrion DNA control area | |
| CN104313149A (en) | Molecular marker suitable for detecting radish leaf margin lobe trait and application of molecular marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140723 |