CN104975014A - Primers and method for detecting 79th site, 208th site and 435th site of CDA gene - Google Patents

Abstract

The invention discloses primers and method for detecting the 79th site, 208th site and 435th site of a CDA gene. The primers comprise a forward primer, a reverse primer and a sequencing primer used for amplification of the 79th site, 208th site and 435th site of the CDA gene. The primers and the method disclosed by the invention are used for quickly detecting Lys27Gln, Ala70Thr and Thr145Thr of the CDA gene and provide a reference for a patient about using of difluorine nuclear anti-metabolism anti-tumor medicine gemcitabine.

Description

Detect primer and the method in CDA gene the 79th, 208 and 435 site

Technical field

The invention belongs to life science and biological technical field, particularly detect primer and the method in CDA gene the 79th, 208 and 435 site.

Background technology

Gemcitabine is a kind of difluoro core general class antimetabolic antitumour drug destroying cellular replication, be widely used in the first-line treatment of nonsmall-cell lung cancer clinically, for other the many solid tumors comprising carcinoma of the pancreas, carcinoma of gallbladder, mammary cancer and leiomyosarcoma etc., there is activity simultaneously.But the treatment window of this medicine is little, easily cause the untoward reaction based on bone marrow depression.There are some researches show, the monokaryon former times acid polymorphism in the gene order of coding cytidine deaminase CDA may affect the Plasma Concentration of gemcitabine, and then the untoward reaction affected after its medication and even curative effect.There are some researches show that CAD gene polymorphism sites comprises the sudden change A79C (i.e. Lys27Gln) in the 79th site, the sudden change G208A (i.e. Ala70Thr) in the 208th site and the sudden change C435T (i.e. Thr145Thr) in the 435th site.

Summary of the invention

The invention provides the primer detecting CDA gene the 79th, 208 and 435 site, adopt Sanger sequencing, can be used for the situation of rapid detection CDA gene the 79th, 208 and 435 site mutation.

An object of the present invention is to provide and detects CDA Gene A 79C (Lys27Gln), the primer in G208A (Ala70Thr) and C435T (Thr145Thr) site, comprise: amplification covers and detects CDA gene A79C (Lys27Gln), the forward and reverse primer in G208A (Ala70Thr) and C435T (Thr145Thr) site and sequencing primer; Its base sequence is:

CDA79-F：TGTAAAACGACGGCCAGTAGAGTGTGAAGCACACGTAGG；

CDA79-R：TGTAAAACGACGGCCAGTCTGCGCCTCTTCCTGTACATC；

CDA208-F：TGTAAAACGACGGCCAGTCTCTGCTCTCTTCTCAGGGT；

CDA208-R：TGTAAAACGACGGCCAGTGTTGGCTAAAGAGATGAATG；

CDA435-F：TGTAAAACGACGGCCAGTTCTCTCACGCCAGCTTTGCC；

CDA435-R：TGTAAAACGACGGCCAGTCTCAGGCTGGAGTGTAATCTG；

Order-checking-F:TGTAAAACGACGGCCAGT;

Order-checking-R:AACAGCTATGACCATG.

Further, the working concentration ratio of described forward and reverse primer is: CDA79-F:CDA79-R=1:1, CDA7208-F:CDA208-R=1:1, CDA435-F:CDA435-R=1:1.

Further, the working concentration ratio of described sequencing primer is: order-checking-F: order-checking-R=1:1.

Two of object of the present invention is to provide a kind of detection CDA gene A79C (Lys27Gln), and the method in G208A (Ala70Thr) and C435T (Thr145Thr) site, it comprises the steps:

(1) sample DNA is extracted;

(2) amplimer CDA79-F/CDA79-R is utilized, CDA208-F/CDA208-R, CDA435-F/CDA435-R increases respectively to the DNA in (1), obtain and detect CDA gene A79C (Lys27Gln), the amplified production in G208A (Ala70Thr) and C435T (Thr145Thr) site;

(3) utilize sequencing primer order-checking-F to carry out forward and backward sequencing with order-checking-R respectively to the amplified production in (2), obtain the gene order of described amplified production;

(4) gene order in (3) and wild-type CDA gene order are compared, determine whether mutational site exists;

Wherein said primer sequence is:

CDA79-F：TGTAAAACGACGGCCAGTAGAGTGTGAAGCACACGTAGG；

CDA79-R：TGTAAAACGACGGCCAGTCTGCGCCTCTTCCTGTACATC；

CDA208-F：TGTAAAACGACGGCCAGTCTCTGCTCTCTTCTCAGGGT；

CDA208-R：TGTAAAACGACGGCCAGTGTTGGCTAAAGAGATGAATG；

CDA435-F：TGTAAAACGACGGCCAGTTCTCTCACGCCAGCTTTGCC；

CDA435-R：TGTAAAACGACGGCCAGTCTCAGGCTGGAGTGTAATCTG；

Order-checking-F:TGTAAAACGACGGCCAGT;

Order-checking-R:AACAGCTATGACCATG.

The present invention also aims to provide a kind of test kit detecting CDA gene the 79th, 208 and 435 site, described test kit comprises sample DNA extraction agent; Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative controls and blank product, wherein detection system PCR reaction solution comprises 3 couples of amplimer CDA79-F/CDA79-R, CDA208-F/CDA208-R, CDA435-F/CDA435-R, order-checking system comprises sequencing primer order-checking-F and order-checking-R, comprising:

CDA79-F：TGTAAAACGACGGCCAGTAGAGTGTGAAGCACACGTAGG；

CDA79-R：TGTAAAACGACGGCCAGTCTGCGCCTCTTCCTGTACATC；

CDA208-F：TGTAAAACGACGGCCAGTCTCTGCTCTCTTCTCAGGGT；

CDA208-R：TGTAAAACGACGGCCAGTGTTGGCTAAAGAGATGAATG；

CDA435-F：TGTAAAACGACGGCCAGTTCTCTCACGCCAGCTTTGCC；

CDA435-R：TGTAAAACGACGGCCAGTCTCAGGCTGGAGTGTAATCTG；

Order-checking-F:TGTAAAACGACGGCCAGT;

Order-checking-R:AACAGCTATGACCATG.

Further, described detection system PCR reaction solution also comprises 2 × PCR Buffer; DNTPs; KOD FX DNAPolymerase.

Further, described order-checking system also comprises order-checking refined solution, EDTA, dehydrated alcohol, 75% ethanol, HIDI and Bigdye Terminator V3.1.

Further, described order-checking refined solution comprises shrimp alkaline phosphotase and exonuclease I.

The invention has the beneficial effects as follows: the present invention devises amplification and covers the forward and reverse primer detecting CDA gene the 79th, 208 and 435 site, and the reverse primer sequences having added the forward primer sequence of the sequencing primer of a segment length 18bp and the sequencing primer of long 16bp in pcr amplification upstream primer front end and downstream primer front end respectively of novelty.Introduced described sequencing primer sequence all can be brought in the later product two ends of such amplification, when carrying out sequencing reaction subsequently, all amplified productions can use identical sequencing primer just can complete heterogeneic forward and reverse order-checking, save testing cost significantly.Carry out pcr amplification to censorship sample, adopt Sanger sequencing, sex change after carrying out forward and reverse sequencing reaction amplification, purifying to PCR primer, direct Sequencing can detect the catastrophe in CDA gene the 79th, 208 and 435 site all sidedly.By adjusting the reaction conditions such as concentration, annealing temperature of forward and reverse primer, amplification efficiency can be made to reach best.

Utilize expansion primer of the present invention and sequencing primer on the other hand, can increase and comprise the 79th, 208 and 435 sites, by the analysis of sequencing result, CDA gene the 79th, 208 and 435 locus gene catastrophe can be got information about very much, not by CDA transgenation variation and the impact not having mutantional hotspot, all mutational sites to be detected can be covered; There is very high specificity and accuracy; Adopt PCR method amplifying target genes and its gene pleiomorphism of order-checking detection, have highly sensitive, simple to operate, low cost and other advantages.

Accompanying drawing explanation

Fig. 1 sample 1CDA gene the 79th site forward sequencing result figure.

Fig. 2 sample 2CDA gene the 79th site forward sequencing result figure.

Embodiment

Below in conjunction with specific embodiments and the drawings, set forth the present invention further.Should be noted that, unaccounted normal condition and method in embodiment, usually according to the conventional employing method of affiliated field experimenter: such as, " the fine works molecular biology experiment guide " the 4th edition of Ao Sibai and James Kingston chief editor, or the step of advising according to manufacturer and condition.

Embodiment 1

Detect the primer in CDA gene the 79th, 208 and 435 site, comprising: amplification covers the forward and reverse primer detecting CDA gene the 79th, 208 and 435 site; The forward and reverse primer wherein measuring the 79th site is respectively CDA79-F and CDA79-R, and the primer measuring the 208th site is respectively CDA208-F and CDA208-R, and the primer measuring the 435th site is CDA435-F and CDA435-R.The base sequence of described expansion primer specifically comprises:

CDA79-F	TGTAAAACGACGGCCAGTAGAGTGTGAAGCACACGTAGG
		CDA79-R	TGTAAAACGACGGCCAGTCTGCGCCTCTTCCTGTACATC
CDA208-F	TGTAAAACGACGGCCAGTCTCTGCTCTCTTCTCAGGGT
		CDA208-R	TGTAAAACGACGGCCAGTGTTGGCTAAAGAGATGAATG
CDA435-F	TGTAAAACGACGGCCAGTTCTCTCACGCCAGCTTTGCC
		CDA435-R	TGTAAAACGACGGCCAGTCTCAGGCTGGAGTGTAATCTG

Described primer also comprises forward and reverse primer order-checking-F and order-checking-R of order-checking, and its base sequence is

Order-checking-F:TGTAAAACGACGGCCAGT

Order-checking-R:AACAGCTATGACCATG.

In the detection, first utilize above-mentioned forward and reverse primer pair to cover the DNA fragmentation detecting CDA gene the 79th, 208 and 435 site to increase, obtain amplified production, then utilize above-mentioned sequencing primer to check order to amplified production, obtain the gene order of amplified production.

Detect the test kit in CDA gene the 79th, 208 and 435 site, comprising: tissue DNA extraction agent box (such as using the extraction test kit of sky root biology); Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative controls and blank product, wherein

Detection system PCR reaction solution comprises: 2 × PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U/ μ l); The upstream and downstream primer of testing goal gene.

Order-checking system comprises: order-checking refined solution, EDTA (125mmol), dehydrated alcohol, 75% ethanol, HIDI (height deionized formamide), sequencing primer: order-checking-F (3.2 μm) and order-checking-R (3.2 μm), and CDA_S-F34 (3.2 μm) and CDA_S-R34 (3.2 μm), and Bigdye Terminator V3.1 (buying from Applied Biosystems company of the U.S.), the refined solution that wherein checks order comprises shrimp alkaline phosphotase (SAP) 0.6U and exonuclease I (EXONI) 1.2U.

Detection system PCR reaction solution is formulated as follows:

Positive reference substance: the solution containing CDA sequence.

Negative controls: without the solution of CDA sequence.

Blank product: 2 μ l physiological saline or do not add any material.

Embodiment 2

The operating process of blood DNA extraction agent box (sky root is biological):

(1) genomic dna in extracting blood:

1) extract 500uL blood and add 1000uL erythrocyte cracked liquid, put upside down mixing, room temperature places 5 minutes, and period puts upside down mixing several times again.The centrifugal 5min of 3000rpm, sucks supernatant, leaves leukocyte cell pellet, adds 200uL damping fluid GA, and vibration is to thoroughly mixing.

2) 20 μ l Proteinase K Solution are added, mixing.

3) add 200 μ l damping fluid GB, fully put upside down mixing, place 10 minutes for 70 DEG C, solution strain is limpid, and brief centrifugation is to remove the globule of cap wall.

4) add 200 μ l dehydrated alcohols, fully vibration mixing 15 seconds, now may occur flocks, brief centrifugation is to remove the globule of cap wall.

5) all add in an adsorption column CB3 (adsorption column puts into collection tube) by previous step gained solution and flocks, centrifugal 30 seconds of 12,000rpm (13,400 × g), outwells waste liquid, is put back in collection tube by adsorption column CB3.

6) in adsorption column CB3, add 500 μ l damping fluid GD (please first check whether before use and added dehydrated alcohol), centrifugal 30 seconds of 12,000rpm (13,400 × g), outwells waste liquid, adsorption column CB3 is put into collection tube.

7) in adsorption column CB3, add 700 μ l rinsing liquid PW (please first check whether before use and added dehydrated alcohol), centrifugal 30 seconds of 12,000rpm (13,400 × g), outwells waste liquid, adsorption column CB3 is put into collection tube.

8) in adsorption column CB3, add 500 μ l rinsing liquid PW, centrifugal 30 seconds of 12,000rpm (13,400 × g), outwells waste liquid.

9) put back in collection tube by adsorption column CB3, centrifugal 2 minutes of 12,000rpm (13,400 × g), outwells waste liquid.Adsorption column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.

10) proceeded to by adsorption column CB3 in a clean centrifuge tube, the unsettled dropping 100 in the middle part to adsorption film μ l elution buffer TE, room temperature places 2-5 minute, 12, centrifugal 2 minutes of 000rpm (13,400 × g), by solution collection in centrifuge tube.

(2) reagent configuration: by detecting people's number configuration detection system PCR reaction solution each X μ l, every person-portion 18 μ l packing:

X=18 μ l reaction solution × (n part sample+1 part of positive control+1 part of negative control+1 part of blank)

N is for detecting number of samples.

(3) application of sample: add each 2 μ l DNA in 3 detection system PCR reaction solutions; Positive control and negative control directly add 2 μ l positive reference substance and negative controls; Blank adds 2 μ l physiological saline or does not add any material.

(4) increase: detect and carry out on Standard PCR instrument, available instrumentation comprises ABI veriti (Applied Biosystems company of the U.S.) etc.Reaction conditions is as follows:

(5) sanger order-checking:

Get 9 μ l PCR primer and 2 μ l purification system.Purifying is carried out according to following program:

1 μ l purified product is mixed according to following system with order-checking-R (3.2 μm) with the sequencing primer :-F that checks order (3.2 μm) respectively:

Sequencing reaction program:

Precipitation link:

In the product completing sequencing reaction, add the EDTA of 2 μ l 125mmol, leave standstill 5min; Add 15ml dehydrated alcohol, whirlpool mixes; The centrifugal 30min of 3700rpm; Be inverted centrifugal 15sec, add 50ml70% ethanol, whirlpool mixes; The centrifugal 15min of 3700rpm; Be inverted centrifugal 15sec, be placed on 95 DEG C of metal baths; Denatured test is carried out after adding 10 μ l HIDI.Denaturation program:

After denaturation program terminates, upper sequenator (ABI3730) checks order.

(7) result judges: sequencing result and wild-type reference sequence are compared, report according to actual catastrophe to result.

Embodiment 3

Get clinical breast cancer clinical samples 4 parts, detect this 4 increment and originally whether there is CDA transgenation.Genome, reagent preparation detecting is extracted by method described in embodiment 2.Every increment product add 2 μ l in detection system PCR reaction solution.Do the positive simultaneously, negative, each portion of blank.Detect with regular-PCR instrument, the time is 160 minutes.

Sample number	Catastrophe
		1	Have no sudden change
2	A79C
		3	Have no sudden change
4	Have no sudden change

The forward sequencing result in the 79th site of sample 1 sequence, as schemed as indicated with 1, is wild-type.79th site forward sequencing result of sample 2 sequence as shown in Figure 2, is heterozygous mutant.

208,435 sites of sample 1, sample 2, sample 3 and sample 4 are through order-checking comparison, and have no sudden change, above-mentioned site is wild-type.

As can be seen from detected result, primer of the present invention can detect CDA gene the 79th, 208 and 435 site, and sequencing result entirely accurate.Primer of the present invention can amplify CDA gene the 79th, 208 and 435 site accurately, no matter is wild-type or saltant type.The detection of positive sample is shown that primer of the present invention and method and test kit can detect CDA transgenation.

SEQUENCE LISTING

 

<110> Nanchang company limited of Ai Dikang Clinical Laboratory institute

 

<120> detects primer and the method in CDA gene the 79th, 208 and 435 site

 

<130>

 

<160> 8

 

<170> PatentIn version 3.3

 

<210> 1

<211> 39

<212> DNA

<213> artificial sequence

 

<400> 1

tgtaaaacga cggccagtag agtgtgaagc acacgtagg 39

 

 

<210> 2

<211> 39

<212> DNA

<213> artificial sequence

 

<400> 2

tgtaaaacga cggccagtct gcgcctcttc ctgtacatc 39

 

 

<210> 3

<211> 38

<212> DNA

<213> artificial sequence

 

<400> 3

tgtaaaacga cggccagtct ctgctctctt ctcagggt 38

 

 

<210> 4

<211> 38

<212> DNA

<213> artificial sequence

 

<400> 4

tgtaaaacga cggccagtgt tggctaaaga gatgaatg 38

 

 

<210> 5

<211> 38

<212> DNA

<213> artificial sequence

 

<400> 5

tgtaaaacga cggccagttc tctcacgcca gctttgcc 38

 

 

<210> 6

<211> 39

<212> DNA

<213> artificial sequence

 

<400> 6

tgtaaaacga cggccagtct caggctggag tgtaatctg 39

 

 

<210> 7

<211> 18

<212> DNA

<213> artificial sequence

 

<400> 7

tgtaaaacga cggccagt 18

 

 

<210> 8

<211> 16

<212> DNA

<213> artificial sequence

 

<400> 8

aacagctatg accatg 16

 

 

Claims (4)

1. detect the primer in CDA gene the 79th site, the 208th site and the 435th site, it is characterized in that, comprising: amplification covers forward and reverse primer and the sequencing primer in CDA gene the 79th, 208 and 435 site; Its base sequence is:

CDA79-F：TGTAAAACGACGGCCAGTAGAGTGTGAAGCACACGTAGG；

CDA79-R：TGTAAAACGACGGCCAGTCTGCGCCTCTTCCTGTACATC；

CDA208-F：TGTAAAACGACGGCCAGTCTCTGCTCTCTTCTCAGGGT；

CDA208-R：TGTAAAACGACGGCCAGTGTTGGCTAAAGAGATGAATG；

CDA435-F：TGTAAAACGACGGCCAGTTCTCTCACGCCAGCTTTGCC；

CDA435-R：TGTAAAACGACGGCCAGTCTCAGGCTGGAGTGTAATCTG；

Order-checking-F:TGTAAAACGACGGCCAGT;

Order-checking-R:AACAGCTATGACCATG.

2. primer as claimed in claim 1, it is characterized in that, the working concentration ratio of described forward and reverse primer is: CDA79-F:CDA79-R=1:1, CDA7208-F:CDA208-R=1:1, CDA435-F:CDA435-R=1:1.

3. primer as claimed in claim 1, it is characterized in that, the working concentration ratio of described sequencing primer is: order-checking-F: order-checking-R=1:1.

4. detect the method in CDA gene the 79th site, the 208th and the 435th site, it comprises the steps:

(1) sample DNA is extracted;

(2) utilize amplimer CDA79-F/CDA79-R, CDA208-F/CDA208-R, CDA435-F/CDA435-R increase respectively to the DNA in (1), obtain the amplified production detecting CDA gene the 79th, 208 and 435 site;

(3) utilize sequencing primer order-checking-F to carry out forward and backward sequencing with order-checking-R respectively to the amplified production in (2), obtain the gene order of described amplified production;

(4) gene order in (3) and wild-type CDA gene order are compared, determine whether mutational site exists;

Wherein said primer sequence is:

CDA79-F：TGTAAAACGACGGCCAGTAGAGTGTGAAGCACACGTAGG；

CDA79-R：TGTAAAACGACGGCCAGTCTGCGCCTCTTCCTGTACATC；

CDA208-F：TGTAAAACGACGGCCAGTCTCTGCTCTCTTCTCAGGGT；

CDA208-R：TGTAAAACGACGGCCAGTGTTGGCTAAAGAGATGAATG；

CDA435-F：TGTAAAACGACGGCCAGTTCTCTCACGCCAGCTTTGCC；

CDA435-R：TGTAAAACGACGGCCAGTCTCAGGCTGGAGTGTAATCTG；

Order-checking-F:TGTAAAACGACGGCCAGT;

Order-checking-R:AACAGCTATGACCATG.