CN104974261B - Recombinate anti-HER2/PS bispecific antibody, preparation method and application - Google Patents
Recombinate anti-HER2/PS bispecific antibody, preparation method and application Download PDFInfo
- Publication number
- CN104974261B CN104974261B CN201410129991.3A CN201410129991A CN104974261B CN 104974261 B CN104974261 B CN 104974261B CN 201410129991 A CN201410129991 A CN 201410129991A CN 104974261 B CN104974261 B CN 104974261B
- Authority
- CN
- China
- Prior art keywords
- her2
- bispecific antibody
- antibody
- cell
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention belongs to field of biotechnology, more specifically, the invention discloses a kind of anti-HER2/PS bispecific antibody of recombination, preparation method and applications.Anti- HER2/PS bispecific antibody of the invention can be in conjunction with HER2, moreover it is possible to which in conjunction with PS, bispecific antibody of the invention has good antitumous effect.
Description
Technical field
The present invention relates to antibody arts, more specifically, the invention discloses a kind of recombination bispecific antibodies, its preparation side
Method and its effect on solid tumor resisting.
Background technique
Apoptosis is a program strictly regulated and controled in body, efficiently removes the base that apoptotic cell is immune tolerance
Plinth.In apoptotic process, the phosphatidylserine of the cell membrane endosexine in normal cell (Phosphatidylserine,
PS it) overturns to cell membrane extexine.It is small that M2 type macrophage swallows apoptosis using this signal of cell surface PS Receptor recognition
Body, meanwhile, release tumor growth factor (tumor growth factor, TGF)-β, interleukin 10
A series of immunosupress programs of the inflammation inhibiting factor such as (interlukin10, IL-10) mediation [Gabrilovich D etc.,
Nature Review Immunology.2009,9:162-174].In recent years, it has been found that tumor vessel epithelial cell, tumour
The allochthon in source and tumour cell the turning up there is also PS in tumor microenvironment, and this turn up in receiving
It is more obvious after treatment or radiotherapy.The tumour cell that these PS turn up equally passes through the macrophage in enhancing tumor microenvironment to tool
Have a M2 type macrophage differentiation of immune suppression function, inhibit the M1 type macrophage with powerful cellkilling capacity generate from
And promote tumour growth [Ran S etc., Clinical Cancer Research.2005,11:1551-1562].Studies have shown that
Specificity discloses exploitation, CAS NO.648904-28- for the monoclonal antibody Bavituximab(U.S. Peregrine of people PS
3) growth of tumour is inhibited by a variety of different mechanism: 1) utilizing the cell-mediated toxic effect of antibody-dependant
The tumour source of (antibody dependent cell mediated cytotoxicity, ADCC) direct killing expression PS
Cell, especially tumor vessel epithelial cell；2) identification of the M2 type macrophage to PS is blocked, inhibits to be immunized in tumor microenvironment
The activation for developing to promote M1 type tumor-killing macrophage of inhibition strategy, removing tumour cell [Huang X etc.,
Cancer Research.2005,65:4408-4416].Bavituximab with docetaxel (Docetaxel) drug combination
Non-small cell lung cancer (non-small-cell lung carcinoma, NSCLC) second phase clinic in show fabulous treatment
Effect, compared to docetaxel, middle position Overall survival is improved 4.3 months, is based on this data, and U.S. FDA is included in quickly logical
Road.Meanwhile in the second line treatment of breast cancer Bavituximab and docetaxel combination by position Overall survival in patient from more
The mono- medicine of Xi Tasai is increased to 21.7 months for 11.4 months.
There are ErbB-2 (human epidermal by about 20%~25% patient with breast cancer
Growth factor, HER2) gene magnification or albumen overexpression [Jahanzeb M etc., Clinical Breast
Cancer.2008,8:324-333].Anti-HER 2 monoclonal antibody Trastuzumab(trade name: Herceptin) from 1998
Listing so far, be in always monoclonal antibody medicine sales volume first five.By the highly expressed breast cancer cell of direct killing HER2,
Trastuzumab significantly improve tumor patient prognosis [White C etc., Annual Review Medicine.2001,52:
125-145].But in the process, it inevitably swells since a large amount of cell surface PS is presented in dead cell and apoptotic cell
Tumor tolerance type immune response is induced.Therefore, the double spies that can specifically bind HER2 and two target spots of PS simultaneously are constructed
Heterogenetic antibody is realized while the tumour cell of direct killing cell surface HER2 or the PS positive, subsequent tumour is also inhibited to exempt from
The generation of epidemic disease tolerance, blocks tumor immune escape access, is always those skilled in the art's problem anxious to be resolved.
Summary of the invention
To solve the above-mentioned problems, the present inventor has carried out a large number of experiments, and having obtained one can block simultaneously
The bispecific antibody of HER2 and two target spots of PS, i.e., it is " recombinating anti-HER2/PS bispecific antibody " of the present invention, thus
Complete the present invention.
The invention discloses:
1. a kind of anti-HER2/PS bispecific antibody of recombination, it is characterised in that the antibody can be in conjunction with HER2, also
It can be in conjunction with PS.
2. the above-mentioned anti-HER2/PS bispecific antibody of recombination, which is characterized in that the anti-HER2/PS bispecific of recombination
Variable region of the antibody variable region amino acid sequence comprising anti-HER 2 monoclonal antibody and anti-PS variable region of mab amino acid
Sequence.
3. the above-mentioned anti-HER2/PS bispecific antibody of recombination, the bispecific antibody heavy chain variable amino acid sequence
As shown in SEQ ID NO:6, chain variable region amino acid sequence is as shown in SEQ ID NO:5.
4. the anti-HER2/PS bispecific antibody of recombination provided by the present invention, which is characterized in that the bispecific antibody
Heavy chain amino acid sequence is as shown in SEQ ID NO:2, and light-chain amino acid sequence is as shown in SEQ ID NO:4.
5. a kind of isolated nucleic acid molecules encode the above-mentioned any anti-HER2/PS bispecific antibody of 1-4.It is preferred that
Ground, the nucleic acid molecules heavy chain nucleotide sequence is as shown in SEQ ID NO:1, light chain nucleotide sequence such as SEQ ID NO:3 institute
Show.
6. a kind of carrier, containing nucleic acid molecules described in above-mentioned 5, the carrier can be pDR1, pcDNA3.1(+),
One of pDHFF and pCHO1.0, preferably pCHO1.0.
7. a kind of host cell contains carrier described in above-mentioned 6, it is preferable that the cell is eukaryocyte, more preferably
Ground, the cell are mammalian cell, and most preferably, the cell is Chinese hamster ovary (Chinese Hamster
Ovary, CHO) cell.
8. a kind of method for preparing above-mentioned anti-HER2/PS bispecific antibody, this method comprises:
A) under expression condition, host cell described in culture above-mentioned 7, to express anti-HER2/PS bispecific antibody；
B) the anti-HER2/PS bispecific antibody of isolated or purified a).
9. above-mentioned anti-HER2/PS bispecific antibody preparation method, comprising the following steps:
A) the heavy chain fusion gene and light chain fusion of anti-HER2/PS bispecific antibody are constructed；
B) by above-mentioned a) fusion gene cloning to carrier pCHO1.0, construction of expression vector pCHO1.0(anti-HER2/
PS)；
C) by above-mentioned pCHO1.0(anti-HER2/PS b)) expression vector transfection CHO cell, screening is subcloned,
The high-expression clone that screening obtains is expanded culture, anti-HER2/PS bispecific antibody is expressed；
D) isolated or purified c) the anti-HER2/PS bispecific antibody.
10. a kind of composition contains above-mentioned the 1-4 any antibody and pharmaceutically acceptable carrier.
11. any anti-HER2/PS bispecific antibody of above-mentioned 1-4 or above-mentioned 10 composition are anti-swollen in preparation
Purposes in tumor medicine.
12. above-mentioned 11 purposes further includes and other anti-tumor drugs is used in combination.
In the present invention, any suitable carrier can be used, and can be pDR1, pcDNA3.1(+), pDHFF and
One of pCHO1.0(such as Fig. 2), it include the fusion dna sequence for being connected with suitable transcription and translation and adjusting sequence in expression vector.
In the present invention, available host cell is the cell containing above-mentioned carrier, can be eukaryocyte, such as mammal
Or insect host cell culture systems are used equally for the expression of fusion protein of the invention, COS, CHO, NS0, sf9 and sf21 etc.
It may be applicable to the present invention；Or the prokaryotic cell containing above-mentioned carrier, it can be DH5a, BL21 (DE3), one of TG1.
The preparation method of anti-HER2/PS bispecific antibody disclosed in the present invention is to cultivate above-mentioned under expression condition
Host cell, to express anti-HER2/PS bispecific antibody；Anti- HER2/PS bispecific described in isolated or purified is anti-
Body.It can be substantially uniform substance by fusion protein purification using the above method, such as on SDS-PAGE electrophoresis be single
Band.
The method that can use affinity chromatography isolates and purifies fusion protein disclosed by the invention, according to what is utilized
The characteristic of affinity column can be used conventional method such as high-salt buffer, change the methods of PH elution of bound on affinity column
Fusion protein polypeptide.
Above-mentioned anti-HER2/PS bispecific antibody disclosed by the invention obtains by the following method: Anti-HER 2
Trastuzumab(IgG1, κ) VLSequence and VHSequence pass through respectively different connector small peptides (such as: ASTKGP；TVAAP) and anti-
PS antibody Bavituximab(IgG1, κ) N-terminal be connected.More specifically, applicant of the present invention passes through many experiments, first
The V of Anti-HER 2 is expressed respectivelyHAnd VLThe heavy chain and light chain full-length gene of fragment gene and anti-PS antibody.On this basis
Using Overlap PCR by VHSegment is connect by connecting small peptide with the heavy chain of anti-PS antibody, VLSegment passes through another connection small peptide
It is connect with the light chain of anti-PS antibody, above-mentioned fused light chain and heavy chain gene is further then cloned into carrier for expression of eukaryon
PCHO1.0(is purchased from: Life Technology) in, it is built into carrier for expression of eukaryon pCHO1.0(anti-HER2/PS).By this
Then expression vector screens positive cell clone with puromycin and methotrexate by liposome transfection Chinese hamster ovary celI.It will sieve
It selects obtained high-expression clone to be expanded with serum free medium to cultivate, with the anti-HER2/PS of Protein A affinity column isolated or purified
Bispecific antibody.
Applicant of the present invention has carried out external, vivo biodistribution to above-mentioned anti-HER2/PS bispecific antibody and has tested.
Extracorporeal biology the experimental results showed that this antibody can well with HER2 and/or PS in combination with.Anti- HER2/PS bispecific is anti-
Body is 6.3 days in mouse intracorporal plasma half-life, shows that the structure height of anti-HER2/PS bispecific antibody of the invention is steady
It is fixed.
Applicant of the present invention carries out affinity detection, HER2 or PS target to above-mentioned anti-HER2/PS bispecific antibody
Mark cell-mediated toxic effect (the antibody dependent cell mediated of the antibody-dependant mediated
Cytotoxicity, ADCC), albumen pharmacokinetic studies, the experiment such as internal tumor suppression, the experimental results showed that, the present invention discloses
Anti- HER2/PS bispecific antibody can be in combination with cell membrane surface HER2 and PS, the signal transduction pathway that both block.
On the one hand, the powerful ADCC effect of anti-HER2/PS bispecific antibody of the invention has been mediated to height expression HER2 or cell table
The direct killing of the tumour cell of face PS；On the other hand, the anti-HER2/PS bispecific antibody is by neutralizing process of cell death
In the PS that turns up that persistently presents, prevent it in conjunction with M2 Macrophage Surface PS receptor, blocked apoptosis program to inhibition
The induction of type immune response, has resisted the generation of tumor immune escape.In addition, anti-HER2/PS bispecific antibody of the invention
There is bigger molecular weight than Trastuzumab or Bavituximab, half-life period is obviously prolonged, and experiment shows at equal dose
Under amount, Trastuzumab or Bavituximab, which is used alone, in anti-HER2/PS bispecific antibody ratio of the invention has more preferably
Antineoplaston effect.
The present invention discloses above-mentioned anti-HER2/PS bispecific antibody, can be with pharmaceutically acceptable carrier together group
At pharmaceutical preparations composition to more stably play curative effect, these preparations can guarantee that anti-HER2/PS disclosed by the invention is bis-
The conformation integrality of the amino acid core sequence of specific antibody, while the polyfunctional group for going back protected protein matter prevents its degradation
(including but not limited to cohesion, deamination or oxidation).It under normal conditions, usually can be under the conditions of 2 DEG C -8 DEG C for liquid preparation
Preservation is at least stablized 1 year, for lyophilized preparation, is stablized in 30 DEG C of holdings at least six months.The anti-HER2/PS bispecific
The preparations, preferably water needle or lyophilized preparation such as antibody preparation can commonly be suspended for pharmaceutical field, water needle, freeze-drying, for the present invention
The water needle or lyophilized preparation of disclosed above-mentioned anti-HER2/PS bispecific antibody, pharmaceutically acceptable auxiliary material include but not
Be limited to: one or a combination set of surfactant, solution stabilizer, isotonic regulator and buffer, wherein surfactant includes
But it is not limited to: nonionic surface active agent such as Polyoxyethylene Sorbitol Fatty Acid Esters (polysorbas20 or 80)；Poloxamer(is such as
Poloxamer188)；Triton；Lauryl sodium sulfate (SDS)；Sodium Laurylsulfate；Myristyl, sub- oil base or octadecyl
Sarcosine；Pluronics；MONAQUATTMDeng additional amount should make the granulating trend of anti-HER2/PS bispecific antibody most
It is small.Solution stabilizer includes but is not limited to one or a combination set of to be exemplified below: carbohydrate, for example, reducing sugar and nonreducing sugar；
Amino acids, for example, monosodium glutamate or histidine；Alcohols, such as: trihydroxylic alcohol, advanced sugar alcohol, propylene glycol, polyethylene glycol etc.,
The additional amount of solution stabilizer should make the preparation those skilled in the art eventually formed think to reach in stable time
Keep stable state.Isotonic regulator includes but is not limited to one or a combination set of sodium chloride, mannitol.Buffer includes but unlimited
In: one or a combination set of TRIS, histidine buffering liquid, phosphate buffer.
Above-mentioned preparation is the composition comprising anti-HER2/PS bispecific antibody, to animal administration including people
Afterwards, antitumous effect is obvious.Specifically, effectively to the prevention of tumour and/or treatment, it can be used as anti-tumor drug use.
Signified tumour of the invention, including but not limited to: gland cancer, leukaemia, lymthoma, melanoma, sarcoma, tumor group
The source knitted include but is not limited to adrenal gland, gall-bladder, bone, marrow, brain, mammary gland, bile duct, gastrointestinal tract, heart, kidney, liver,
Lung, muscle, ovary, pancreas, parathyroid gland, penis, prostate, skin, salivary gland, spleen, testis, thymus gland, thyroid gland and son
Palace.Other than above-mentioned tumour, it may also be used for tumour of central nervous system such as spongiocyte diversity tumor, astrocytoma etc.,
Furthermore the tumour of eye includes basal-cell carcinoma, squamous cell carcinoma, melanoma etc., further includes endocrine disrupting effects, in nerve
Excretory system tumour, gastrointestinal tract pancreatic endocrine system tumor, genital system and head and neck neoplasm etc..Here no longer one by one
It enumerates.It is preferred that breast cancer.
The so-called anti-tumor drug of the present invention, refers to the drug for inhibiting and/or treating tumour, may include with tumour
The delay of related symptoms development and/or the reduction of these severity of symptom are grown, it further comprises already present tumour
It grows the mitigation of simultaneous phenomenon and prevents the appearance of other symptoms, further include reducing or preventing transfer.
Anti- HER2/PS bispecific antibody and combinations thereof is given when to animal administration including people in the present invention
Age and weight of the pharmaceutical quantities because of patient, disease traits and seriousness and administration route and it is different, can be with reference to zoopery
As a result with various situations, total dosage is no more than a certain range.The dosage being specifically injected intravenously is 1~1800mg/ days.
Anti- HER2/PS bispecific antibody disclosed by the invention and combinations thereof can also be with other antineoplastic joints
Administration, for the treatment of tumour, these antineoplastics include but is not limited to: 1, cytotoxic drug (1) acts on DNA chemistry knot
The drug of structure: alkylating agent such as nitrogen mustards, nitrous urinate class, methane sulfonic acid esters；Platinum-like compounds such as cis-platinum, carboplatin and oxalic acid platinum
Deng；Mitomycin (MMC)；(2) influence nucleic acid synthesis drug: dihydrofolate reductase inhibitor such as methopterin (MTX) and
Alimta etc.；Thymus nucleoside synthetase inhibitors such as fluorouracil (5FU, FT-207, capecitabine) etc.；Purine nucleosides closes
At enzyme inhibitor such as Ismipur (6-MP) and 6-TG etc.；Ribonucleotide reductase inhibitor such as hydroxycarbamide (HU) etc.；DNA
Poly enzyme inhibitor such as cytarabine (Ara-C) and gemzar (Gemz) etc.；(3) act on the drug of transcribed nucleic acid: selectivity is made
For DNA profiling, inhibit DNA dependenc RNA polymerase, so that the drug for inhibiting RNA to synthesize is such as: actinomycin D, daunorubicin,
Adriamycin, Epi-ADM, aclacinomycin, mithramycin etc.；(4) mainly act on tubulin synthesis drug: taxol,
Taxotere, vinblastine, vinorelbine, Podophyllum emodi var chinense alkali class, homoharringtonine；(5) other Cytotoxic drugs: L-Asparaginasum is main
Inhibit the synthesis of protein；2, steroids antiestrogenic: tamoxifen, Droloxifene, Exemestane etc.；Aromatizing enzyme inhibits
Agent: aminoglutethimide, Lactel be grand, Letrozole, auspicious Ningde etc.；Antiandrogen: its ammonia RH-LH agonist/antagonist of fluorine: Zoladex,
Enatone etc.；3, biological response modifiers: main that tumour interferon is inhibited by body's immunity；Interleukin 2；Chest
Gland peptides；4, monoclonal antibody: Mabthera (MabThera)；Cetuximab(C225)；Bevacizumab(Avastin)；5,
Other include that some current mechanism are unknown and need the drug further studied；Cell-differentiation inducers such as retinoids；Cell withers
Die inducer.Anti- HER2/PS bispecific antibody disclosed by the invention and combinations thereof can with above-mentioned anti-tumor drug it
One or combinations thereof drug combination.
Detailed description of the invention
The anti-HER2/PS bispecific antibody structural schematic diagram of Fig. 1
Fig. 2 pCHO1.0 structural schematic diagram
The anti-HER2/PS bispecific antibody of Fig. 3 is directed to and HER2 binding force experimental result
The binding force experimental result of Fig. 4 anti-HER2/PS bispecific antibody and PS
The anti-HER2/PS bispecific antibody of Fig. 5 is directed to the ADCC effect experiment result of HER2 target antigen
Inhibit the activity experiment result of BT-474 growth in the anti-HER2/PS bispecific antibody body of Fig. 6
Specific embodiment
Following embodiment, experimental example are that the present invention is further detailed, and be should not be construed as limiting the invention.
Embodiment does not include detailed descriptions of conventional methods, such as the method that those draw for carrier construction and matter, will encode albumen
Gene is inserted into the method for such carrier and matter drawing or plasmid is introduced method as the method for host cell for ability
Personnel in domain with ordinary skill are well-known, and are all described in many publications, including Sambrook,
J., Fritsch, E.F.and Maniais, T.(1989) Molecular Cloning:A Laboratory Manual, 2nd
Edition, Cold spring Harbor Laboratory Press.
The gene constructed and expression of the anti-HER2/PS bispecific antibody of embodiment 1
The sequence of anti-human HER2 monoclonal antibody trastuzumab (IgG1, κ) is from KEGG gene pool
(NO.D03257), the constant-region sequences analysis for comparing human IgG1's antibody obtains VH and VL genetic fragment.Meanwhile according to who.int
Anti-human PS the monoclonal antibody Bavituximab(IgG1, κ announced) amino acid sequence (WHO Drug Information,
Vol.21, No.1,2007.p7), by Sheng Gong bioengineering Co., Ltd full genome synthesizing ribonucleotide sequence after codon optimization
Column.Using Overlapping PCR method by the VH genetic fragment of Trastuzumab by connector (ASTKGP) with
The N-terminal of Bavituximab heavy chain merges；VL genetic fragment is melted by connector (TVAAP) and the N-terminal of Bavituximab light chain
It closes.Linker fragment is respectively from the N-terminal sequence of human IgG1 CH1 or C κ.The primer of heavy chain Overlapping PCR is (ariyoshi
Primer 1:GAAGTGCAGCTGGTGGAAAGCGG；Antisense primer 1:CTCTGCTGCAGCTGCACTTCCGGGCCTTTGGTGCTC
GCCACCAGGGTGCCCTGGCCCCAATAA；Sense primer 2:GGGGCCAGGGCACCCTGGTGGCGAGCACCAAAGGCCCG
GAAGTGCAGCTGCAGCAGAGCGGCC；Antisense primer 2:TTTGCCCGGGCTCAGGCTCAGGC).Light chain Overlapping
The primer of PCR is (sense primer 1:GATATTCAGATGACCCAGAGCCC；Antisense primer 1:CTCTGGGTCATCTGAATAT
CCGGCGCCGCCACGGTCACTTTGGTGCCCTGGCCAAAGGTC；Sense primer 2:TTGGCCAGGGCACCAAAGTGACCG
TGGCGGCGCCGGATATTCAGATGACCCAGAGCCCGA；Antisense primer 2:GCATTCGCCGCGGTTAAAGCTTT).SEQ
It is anti-that ID NO:1, SEQ ID NO:2, SEQ ID NO:1, SEQ ID NO:6 respectively illustrate the anti-PS/HER2 bispecific of gained
Body heavy chain nucleotide sequence, heavy chain amino acid sequence and heavy chain variable amino acid sequence；SEQ ID NO:3,SEQ ID NO:
4, SEQ ID NO:5 respectively illustrates light chain nucleotide sequence, the light-chain amino acid sequence of the anti-PS/HER2 bispecific antibody of gained
With chain variable region amino acid sequence.Attached drawing 1 illustrates anti-HER2/PS bispecific antibody structural schematic diagram, and (wherein, VH1 is
Former Trastuzumab weight chain variabl area sequence, VH2 are the weight chain variabl area sequence of original Bavituximab, and CH1-CH2-CH3 is
The heavy chain constant region sequence of former Bavituximab, VL1 are original Trastuzumab light-chain variable sequence, and VL2 is original
The light-chain variable sequence of Bavituximab, CL are the constant light chain sequences of original Bavituximab).PCR product is cloned
To pCHO1.0 expression vector (being purchased from Life technologies company), sequence verification confirmation obtains correct clone, just
True cloning vector indicates are as follows: pCHO1.0(anti-HER2/PS).In addition, people HER2 gene (NM_001005862.2) is conventional
In addition synthesized after human IgG1's Fc sequence by Sheng Gong bioengineering Co., Ltd, with same method respectively by HER2-Fc,
For Trastuzumab and Bavituximab full gene cloning into pCHO1.0, correct cloning vector is respectively labeled as pCHO1.0
(anti-HER2) and pCHO1.0(anti-PS).
By above-mentioned pCHO1.0(anti-HER2/PS), pCHO1.0(HER2-Fc), pCHO1.0(anti-HER2) and
PCHO1.0(anti-PS) carrier is transiently transfected respectively to 293 cell line of human embryonic kidney cell and (is purchased from: ATCC company), cultivates number
After it, Protein A affinity column (being purchased from Pharmacia company) the antibody purification albumen from cells and supernatant is utilized.
Albumen is quantitatively carried out by BCA (Bicinchoninic acid) method.It is anti-to purify obtained anti-HER2/PS bispecific
Body, Trastuzumab and Bavituximab antibody samples are for further analysis below and research.
Experimental example 2SDS-PAGE and Western-blot detect anti-HER2/PS bispecific antibody
Anti- HER2/PS bispecific antibody, Trastuzumab and Bavituximab after purification is respectively non-reduced
(6%) and under the conditions of reduction (12%) with polyacrylamide gel electrophoresis its purity and molecular size range are detected, passed through simultaneously
Western-blot further identifies its property and molecular weight.Western-blot method is as follows: the glue after electrophoresis is passed through electricity
The method of transfer is transferred on pvdf membrane, and the goat anti-human igg (H+L) of HRP label is added after closing, and PBST is washed twice, last DAB
Method colour developing.Polyacrylamide gel electrophoresis and Western-blot be as the result is shown: under the reducing conditions, Trastuzumab and
Bavituximab is rendered as the heavy chain and light chain of molecular size range about 50KDa and 25KDa, and anti-HER2/PS of the invention is bis-
Specific antibody is rendered as molecular size range about 63KDa(heavy chain) and 36KDa(light chain).Under non reducing conditions, all antibody are equal
A band is presented, their size is respectively 149KDa(Trastuzumab), 148KDa(Bavituximab) and 192KDa(it is anti-
HER2/PS bispecific antibody).Meanwhile under non reducing conditions, using anti-Fc antibody or anti-κ antibody (be purchased from:
Sigma), and the presence (such as independent heavy chain, independent light chain or heavy chain complexes etc.) of aberrant molecules fragment is not detected.
The identification of embodiment 3 anti-HER2/PS bispecific antibody and HER2 binding ability
The combination of anti-HER2/PS bispecific antibody and HER2 are detected by Biacore3000.By expression and purification
After HER2-Fc is coated on the chip of Biacore3000 with various concentration, its affinity is detected.Anti- HER2/PS bispecific is anti-
Body is similar to its female antibody trastuzumab to the affinity of HER2, is specifically shown in Table 1.
Table 1, affinity of the anti-HER2/PS bispecific antibody to HER2
Anti- HER2/PS bispecific antibody passes through the increasing of breast carcinoma cell strain BT-474 to the In vitro biological activity of HER2
Experiment is grown to be detected.BT-474 cell (is purchased from Chinese Academy of Sciences's type culture classical collection committee cell bank).Cell recovery
Afterwards with RPMI1640 complete medium culture to logarithmic growth phase, with 6 × 104The density of/ml is prepared into single cell suspension, and 100
The hole μ l/ is inoculated into 96 orifice plates, meanwhile, be added the diluted anti-HER2/PS bispecific antibody of same volume various concentration and
3 multiple holes are arranged in Trastuzumab (10ng/ml~100ng/ml), each concentration gradient.After culture 7 days, MTT method is utilized
Detect the proliferation of cell.Experimental result is as shown in figure 3, anti-HER2/PS bispecific antibody of the invention inhibits HER2 to mediate
The proliferation of BT-474 cell is suitable with female antibody trastuzumab.
Identification of the anti-HER2/PS bispecific antibody of embodiment 4 to PS target
The affinity of anti-HER2/PS bispecific antibody and PS are detected by ELISA.It is public purchased from Sigma in PS(
Department) be separately added into coated 96 orifice plate various concentration (0.016nM-33nM) anti-HER2/PS bispecific antibody and
Bavituximab, 37 DEG C are incubated for 2 hours, are then combined reaction using mountain sheep anti mouse IgG-HRP, and 37 DEG C are incubated for 1 hour,
It is added 37 DEG C of TMB developing solution to react 10 minutes, then uses 2MH2SO4Color development stopping surveys A490Value.Experimental result is as shown in figure 4, anti-
HER2/PS bispecific antibody and mother antibody Bavituximab are suitable to the binding ability of PS.Anti- HER2/PS bispecific antibody with
Female antibody Bavituximab has changed compared to overall structure, but its anti-HER2/PS bispecific antibody that do not have an impact is to PS antigen
The identification of epitope.
Expression of 5 antibody gene of embodiment in Chinese hamster ovary celI
PCHO1.0(anti-HER2/PS) carrier is transfected to CHO-S cell line (Life by liposome method
Technologies Products), then positive cell clone is screened with puromycin and methotrexate.Utilize human IgG
Antibody concentration in ELISA detection culture solution supernatant: the goat anti-human igg Fc antibody (being purchased from Sigma) of 5 μ g/ml is coated in ELISA
Plate, 4 DEG C overnight, and 2% 37 DEG C of bovine serum albumin(BSA) is closed 2 hours.Culture solution supernatant or 37 DEG C of standard items (human IgG1) incubations are added
It 2 hours, is detected using HRP- goat anti-human igg (PIERCE).The high-expression clone serum free medium that screening is obtained
Expand culture, with the anti-HER2/PS bispecific antibody of the affine column separating purification of Protein A.
The ADCC effect of the anti-HER2/PS bispecific antibody of embodiment 6
The ADCC effect that the HER2 of anti-HER2/PS bispecific antibody is mediated is measured by BT-474 cell line.1.5×
104BT-474 cell (be purchased from Chinese Academy of Sciences's type culture classical collection committee cell bank) in 96 orifice plates with various concentration
The bispecific antibody of (μ of 7.8ng/ml~64 g/ml) is incubated for 10 minutes, and female antibody trastuzumab is as control.Effector cell
Peripheral blood mononuclear cells is isolated from Fresh human peripheral's blood by Ficoll density gradient centrifugation, and with 3 × 105The concentration in/hole
It is added to experimental port.37 DEG C be incubated for 4 hours after pass through lactic dehydrogenase (Lactate dehydrogenase, LDH) cytotoxicity
Detection kit (Promega Products) detection killing situation.As a result as shown in figure 5, anti-HER2/PS of the invention is bis- special
Property antibody maintain the ADCC activity of its female antibody trastuzumab, cellkilling capacity and Trastuzumab are without conspicuousness
Difference.Since PS is mainly expressed on apoptotic cell, for PS target spot ADCC experiment will be unable to distinguish be cell itself
Apoptosis or ADCC effect caused by apoptosis, and this bispecific antibody with mother's HER2 antibody rather than the Fc piece of mother's PS antibody
Duan Weiqi Fc, existing control will be unable to objectively evaluate change of the bispecific antibody structure change to the ADCC effect for PS target spot
Change.Based on the above reasons, we do not carry out testing for the external ADCC of PS target spot.
The heteroplastic transplantation model of 7 human breast cancer cell line BT-474 of embodiment
The good BT-474 cell of growth conditions (being purchased from Chinese Academy of Sciences's type culture classical collection committee cell bank) is used
0.25%(w/v) trypsase and the of short duration digestion of 0.02%EDTA, with 1 × 10 after washing resuspension6Cell/mouse be inoculated in 6-8 weeks it is female
The right side of property nude mice is subcutaneous.When tumour is long to >=200mm3When, 30 more consistent tumor bearing nude mices of tumor size are divided at random
At five groups, start to give anti-HER2/PS bispecific antibody treatment, unrelated Isotype antibody IgG1 (being purchased from Sigma company),
Trastuzumab, Bavituximab, Trastuzumab+Bavituximab are as control.Five kinds of antibody with 10mg/kg,
The mode being injected intravenously once a week is administered.Mouse treatment is observed continuously six weeks after starting, and measures gross tumor volume weekly, swells
The calculation of knurl product size are as follows: V=0.5ab2.A is tumor entity longest diameter, and b is the most short diameter of tumor entity.Experiment
As a result as shown in fig. 6, similar with Trastuzumab+Bavituximab drug combination, anti-HER2/PS of the invention is bis- special
Property Antybody therapy group has blocked the further growth of tumour completely, mouse tumor volume significantly less than Trastuzumab or
Bavituximab group.
Claims (9)
1. a kind of anti-HER2/PS bispecific antibody of recombination, which is characterized in that the bispecific antibody heavy chain variable region amino
Acid sequence is as shown in SEQ ID NO:6, and chain variable region amino acid sequence is as shown in SEQ ID NO:5.
2. the anti-HER2/PS bispecific antibody of recombination described in claim 1, which is characterized in that the heavy chain of antibody amino acid sequence
Column are as shown in SEQ ID NO:2, and light-chain amino acid sequence is as shown in SEQ ID NO:4.
3. a kind of isolated nucleic acid molecules encode the above-mentioned any anti-HER2/PS bispecific antibody of 1-2.
4. nucleic acid molecules as claimed in claim 3, which is characterized in that the anti-HER2/PS bispecific of nucleic acid molecule encoding is anti-
The nucleotide sequence of weight chain encodes the nucleotide sequence of its light chain as shown in SEQ ID NO:3 as shown in SEQ ID NO:1.
5. a kind of carrier, containing nucleic acid molecules as claimed in claim 3, the carrier is pDR1, pcDNA3.1 (+), pDHFF
Or pCHO 1.0.
6. a kind of host cell, containing the carrier described in claim 5, the cell is COS, CHO, NS0, sf9, sf21,
One of DH5a, BL21 (DE3), TG1.
7. a kind of method for preparing any anti-HER2/PS bispecific antibody of claim 1-2, the method includes following
Step:
A) under expression condition, host cell as claimed in claim 6 is cultivated, to express anti-HER2/PS bispecific antibody；
B) separate and purify a) described in anti-HER2/PS bispecific antibody.
8. a kind of composition contains any anti-HER2/PS bispecific antibody of above-mentioned 1-2 and pharmaceutically acceptable load
Body.
9. composition described in claim the 1-2 any anti-HER2/PS bispecific antibody or claim 8 is anti-in preparation
Purposes in solid tumor drugs；The purposes further includes and other anti-tumor drugs are used in combination.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410129991.3A CN104974261B (en) | 2014-04-01 | 2014-04-01 | Recombinate anti-HER2/PS bispecific antibody, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410129991.3A CN104974261B (en) | 2014-04-01 | 2014-04-01 | Recombinate anti-HER2/PS bispecific antibody, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104974261A CN104974261A (en) | 2015-10-14 |
| CN104974261B true CN104974261B (en) | 2019-06-14 |
Family
ID=54271263
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410129991.3A Active CN104974261B (en) | 2014-04-01 | 2014-04-01 | Recombinate anti-HER2/PS bispecific antibody, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104974261B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111647624A (en) * | 2020-06-10 | 2020-09-11 | 成都和同易创生物科技有限公司 | TSAB human monoclonal antibody recombinant vector, recombinant antibody and preparation method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102884084A (en) * | 2010-03-04 | 2013-01-16 | 西福根有限公司 | Anti-her2 antibodies and compositions |
| WO2013123061A1 (en) * | 2012-02-13 | 2013-08-22 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Bispecific chimeric antigen receptors and therapeutic uses thereof |
| CN103509117A (en) * | 2013-05-06 | 2014-01-15 | 江苏匡亚生物医药科技有限公司 | Bispecific antibody capable of resisting human epidermal growth factor receptor 2 (HER2) and human insulin-like growth factor-IR (IGF-IR), and preparation method and applications thereof |
| WO2014025199A2 (en) * | 2012-08-09 | 2014-02-13 | 주식회사 한독 | Staphylococcal enterotoxin-derived superantigen mutant, fusion protein in which target-specific polypeptides are connected to the mutant and use thereof |
-
2014
- 2014-04-01 CN CN201410129991.3A patent/CN104974261B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102884084A (en) * | 2010-03-04 | 2013-01-16 | 西福根有限公司 | Anti-her2 antibodies and compositions |
| WO2013123061A1 (en) * | 2012-02-13 | 2013-08-22 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Bispecific chimeric antigen receptors and therapeutic uses thereof |
| WO2014025199A2 (en) * | 2012-08-09 | 2014-02-13 | 주식회사 한독 | Staphylococcal enterotoxin-derived superantigen mutant, fusion protein in which target-specific polypeptides are connected to the mutant and use thereof |
| CN103509117A (en) * | 2013-05-06 | 2014-01-15 | 江苏匡亚生物医药科技有限公司 | Bispecific antibody capable of resisting human epidermal growth factor receptor 2 (HER2) and human insulin-like growth factor-IR (IGF-IR), and preparation method and applications thereof |
Non-Patent Citations (2)
| Title |
|---|
| Phase I Safety and Pharmacokinetic Study of Bavituximab, a Chimeric Phosphatidylserine-Targeting Monoclonal Antibody，in Patients with Advanced Solid Tumors;David E. Gerber 等;《Clinical Cancer Research》;20111101;第17卷(第21期);摘要 |
| 双特异性抗体;萨宾·罗素;《科技创业》;20100630(第6期);第64-65页 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104974261A (en) | 2015-10-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7026169B2 (en) | Use of VISTA agonists and VISTA antagonists for suppression or enhancement of humoral immunity | |
| KR102309950B1 (en) | Checkpoint inhibitor bispecific antibody | |
| JP2023129543A (en) | Anti-cd73 antibodies and methods of use thereof | |
| JP2022036957A (en) | Sirp polypeptide compositions and methods of use | |
| KR20180075689A (en) | Methods and compositions for chimeric antigen receptors | |
| JP2018524284A (en) | Anti-ROR1 antibody | |
| JP2019505564A (en) | Anti-BCMA polypeptides and proteins | |
| WO2020103629A1 (en) | Anti-her2/pd1 bispecific antibody | |
| KR20200143470A (en) | Anti-ROR antibody construct | |
| KR20180073691A (en) | Compositions and methods for treating autoimmune diseases and cancers | |
| EP4157875A1 (en) | Antibodies to tigit | |
| WO2021102624A1 (en) | Covalent protein drugs developed via proximity-enabled reactive therapeutics (perx) | |
| US20220281985A1 (en) | Single chain fusionconstructs comprising multimeric antibody fragments fused to collagen trimerization domains | |
| JP2021536256A (en) | Conditional active chimeric antigen receptor for modified T cells | |
| CN106554419A (en) | Recombinate anti-HER2 bispecific antibodies, its preparation method and application | |
| CN104974261B (en) | Recombinate anti-HER2/PS bispecific antibody, preparation method and application | |
| JP2020501518A (en) | Treatment of allergic diseases using chimeric proteins | |
| WO2023125842A1 (en) | Development of novel upar single-domain antibody | |
| AU2013403112B2 (en) | Anti-CD20-Flex bifunctional fusion protein, and preparation method and use thereof | |
| JP2022539831A (en) | Composition for prevention, improvement or treatment of immune checkpoint inhibitor-resistant cancer | |
| CN104974260B (en) | Anti- HGF/VEGF bispecific antibody, preparation method and application | |
| CN104974258B (en) | Recombinate anti-HGF/DLL4 bispecific antibody, preparation method and application | |
| JP2022529502A (en) | Anti-CD38 antibody and formulation | |
| RU2663104C1 (en) | Producing pegylated fragments of gd2-specific antibodies inducing direct cell death of gd2-positive tumor cells, and use thereof in therapy of gd2-positive tumors | |
| CN105669867A (en) | Anti-GITR/CTLA-4 bispecific antibody, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| CB02 | Change of applicant information |
Address after: Shanghai city 201203 libing road Pudong New Area Zhangjiang hi tech Park No. 399 Applicant after: Three country Kin Pharmaceutical (Shanghai) Limited by Share Ltd Address before: Shanghai city 201203 libing road Pudong New Area Zhangjiang hi tech Park No. 399 Applicant before: Shanghai CP Guojian Pharmaceutical Co., Ltd. |
|
| COR | Change of bibliographic data | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |