CN104974261A - Recombinant anti-HER2/PS bispecific antibody as well as preparation method and application thereof - Google Patents
Recombinant anti-HER2/PS bispecific antibody as well as preparation method and application thereof Download PDFInfo
- Publication number
- CN104974261A CN104974261A CN201410129991.3A CN201410129991A CN104974261A CN 104974261 A CN104974261 A CN 104974261A CN 201410129991 A CN201410129991 A CN 201410129991A CN 104974261 A CN104974261 A CN 104974261A
- Authority
- CN
- China
- Prior art keywords
- her2
- specific antibody
- antibody
- cell
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the biotechnology field, and more particularly discloses a recombinant anti-HER2/PS bispecific antibody as well as a preparation method and an application thereof. The anti-HER2/PS bispecific antibody disclosed by the invention can be combined with HER 2 and PS and has a good anti-tumor effect.
Description
Technical field
The present invention relates to antibody art, more specifically, the invention discloses a kind of bi-specific antibody of recombinating, its preparation method and its effect on solid tumor resisting.
Background technology
Apoptosis is a program by strict regulation and control in body, and high-efficient cleaning removes the basis that apoptotic cell is immunological tolerance.In apoptotic process, the phosphatidylserine (Phosphatidylserine, PS) being in Normocellular cytolemma internal skin turn to cytolemma extexine.M2 type scavenger cell utilizes this signal of cell surface PS Receptor recognition thus engulfs apoptotic body, simultaneously, release tumor somatomedin (tumor growth factor, TGF)-β, interleukin 10 (interlukin10, etc. IL-10) inflammation supressor mediates a series of immunosuppression program [Gabrilovich D etc., Nature Review Immunology.2009,9:162-174].In recent years, it is found that the exosome that tumor vessel epithelial cell, tumour are originated and the tumour cell be in tumor microenvironment also exists turning up of PS, and this turn up more obvious after accepting chemotherapy or radiotherapy.The tumour cell that these PS turn up is equally by strengthening scavenger cell in tumor microenvironment to the M2 type macrophage differentiation with immune suppression function, the M1 type scavenger cell with powerful cellkilling capacity is suppressed to generate thus promote tumor growth [Ran S etc., Clinical Cancer Research.2005,11:1551-1562].Research shows, specificity is openly developed for the monoclonal antibody Bavituximab(U.S. Peregrine of people PS, CAS NO.648904-28-3) inhibit the growth of tumour by multiple different mechanism: cell-mediated toxic action (the antibody dependent cell mediated cytotoxicity 1) utilizing antibody-dependant, ADCC) direct killing expresses the tumour derived cell of PS, especially tumor vessel epithelial cell; 2) M2 type scavenger cell is blocked to the identification of PS, in Tumor suppression microenvironment immunosuppressive strategy development thus promote the activation of M1 type tumor-killing scavenger cell, remove tumour cell [Huang X etc., Cancer Research.2005,65:4408-4416].Bavituximab is at nonsmall-cell lung cancer (the non-small-cell lung carcinoma with docetaxel (Docetaxel) drug combination, NSCLC) second phase clinical in show fabulous curative effect, compared to docetaxel, meta Overall survival improves 4.3 months, based on these data, U.S. FDA is included in rapid passage.Meanwhile, in the second line treatment of mammary cancer, patient's meta Overall survival is brought up to 21.7 months in 11.4 months from docetaxel list medicine by the coupling of Bavituximab and docetaxel.
There is ErbB-2 (human epidermal growth factor in the patient with breast cancer of about 20% ~ 25%, HER2) gene amplification or albumen overexpression [Jahanzeb M etc., Clinical Breast Cancer.2008,8:324-333].Anti-HER 2 monoclonal antibody Trastuzumab(trade(brand)name: Herceptin) from 1998 listing so far, be in always monoclonal antibody medicine sales volume the first five.By the breast cancer cell of direct killing HER2 high expression level, Trastuzumab significantly improves the prognosis [White C etc., Annual Review Medicine.2001,52:125-145] of tumour patient.But in the process, inevitably because dead cell and apoptotic cell present a large amount of cell surface PS, tumour tolerance type immunne response is induced.Therefore, building one can the bi-specific antibody of simultaneously specific binding HER2 and PS two target spots, realize while the tumour cell of direct killing cell surface HER2 or the PS positive, also suppress the generation of tumour immunity tolerance subsequently, block tumor immune escape path, be those skilled in the art's problem anxious to be resolved always.
Summary of the invention
In order to solve the problem, the present inventor has carried out lot of experiments, obtain the bi-specific antibody that can block HER2 and PS two target spots simultaneously, i.e. " anti-HER2/PS bi-specific antibody of recombinating " of the present invention, thus complete the present invention.
The invention discloses:
1. the anti-HER2/PS bi-specific antibody of restructuring, is characterized in that described antibody can be combined with HER2, can also be combined with PS.
2. the anti-HER2/PS bi-specific antibody of above-mentioned restructuring, is characterized in that, described restructuring anti-HER2/PS bi-specific antibody variable region amino acid sequence comprises variable region and the anti-PS variable region of mab aminoacid sequence of anti-HER 2 monoclonal antibody.
3. the anti-HER2/PS bi-specific antibody of above-mentioned restructuring, described bi-specific antibody heavy chain variable amino acid sequence is as shown in SEQ ID NO:6, and chain variable region amino acid sequence is as shown in SEQ ID NO:5.
4. the anti-HER2/PS bi-specific antibody of restructuring provided by the present invention, is characterized in that, described bi-specific antibody heavy chain amino acid sequence is as shown in SEQ ID NO:2, and light-chain amino acid sequence is as shown in SEQ ID NO:4.
5. the nucleic acid molecule be separated, the arbitrary described anti-HER2/PS bi-specific antibody of its above-mentioned 1-4 that encodes.Preferably, described nucleic acid molecule heavy chain nucleotide sequence is as shown in SEQ ID NO:1, and light chain nucleotide sequence is as shown in SEQ ID NO:3.
6. a carrier, it contains the nucleic acid molecule described in above-mentioned 5, and described carrier can be pDR1, pcDNA3.1(+), one of pDHFF and pCHO1.0, preferred pCHO1.0.
7. a host cell, it contains the carrier described in above-mentioned 6, preferably, described cell is eukaryotic cell, and more preferably, described cell is mammalian cell, most preferably, described cell is Chinese hamster ovary (Chinese Hamster Ovary, CHO) cell.
8. prepare a method for above-mentioned anti-HER2/PS bi-specific antibody, the method comprises:
A) under expression condition, cultivate the host cell described in above-mentioned 7, thus express anti-HER2/PS bi-specific antibody;
B) isolated or purified anti-HER2/PS bi-specific antibody a).
9. above-mentioned anti-HER2/PS bi-specific antibody preparation method, comprises the following steps:
A) heavy chain fusion gene and the light chain fusion gene of anti-HER2/PS bi-specific antibody is built;
B) by above-mentioned a) fusion gene cloning to carrier pCHO1.0, construction of expression vector pCHO1.0(anti-HER2/PS);
C) by above-mentioned pCHO1.0(anti-HER2/PS b)) expression vector transfection CHO cell, screening, carries out subclone, carrying out enlarged culturing, expressing anti-HER2/PS bi-specific antibody by screening the high-expression clone obtained;
D) isolated or purified c) described anti-HER2/PS bi-specific antibody.
10. a composition, containing the arbitrary described antibody of above-mentioned 1-4 and pharmaceutically acceptable carrier.
Described in the arbitrary described anti-HER2/PS bi-specific antibody or above-mentioned 10 of 11. above-mentioned 1-4, composition is preparing the purposes in antitumor drug.
Purposes described in 12. above-mentioned 11, also comprises the antitumor drug conbined usage with other.
One of in the present invention, any suitable carrier can use, and can be pDR1, pcDNA3.1(+), pDHFF and pCHO1.0(is as Fig. 2), expression vector comprises and is connected with the suitable fusion dna sequence with translational regulation sequence of transcribing.
In the present invention, available host cell is the cell containing above-mentioned carrier, can be eukaryotic cell, as the expression of Mammals or insect host cell culture systems fusion rotein all used in the present invention, COS, CHO, NS0, sf9 and sf21 etc. are all applicable to the present invention; Also can, for the prokaryotic cell prokaryocyte containing above-mentioned carrier, can be DH5a, one of BL21 (DE3), TG1.
Disclosed in the present invention, the preparation method of anti-HER2/PS bi-specific antibody is under expression condition, cultivates above-mentioned host cell, thus expresses anti-HER2/PS bi-specific antibody; Anti-HER2/PS bi-specific antibody described in isolated or purified.Utilize aforesaid method, can be substantially homogeneous material by fusion protein purification, such as, be single band on SDS-PAGE electrophoresis.
The method of affinity chromatography can be utilized to carry out separation and purification to fusion rotein disclosed by the invention, according to the characteristic of utilized affinity column, the conventional method such as fusion rotein polypeptide of method elution of bound on affinity column such as high-salt buffer, change PH can be used.
Above-mentioned anti-HER2/PS bi-specific antibody disclosed by the invention obtains by the following method: Anti-HER 2 Trastuzumab(IgG1, κ) V
lsequence and V
hsequence respectively by different joint small peptide (such as: ASTKGP; TVAAP) with anti-PS antibody Bavituximab(IgG1, κ) N hold and be connected.More specifically, applicant of the present invention, by great many of experiments, have expressed the V of Anti-HER 2 first respectively
hand V
lfragment gene, and the heavy chain of anti-PS antibody and light chain full-length gene.Utilize Overlap PCR by V on this basis
hfragment is connected with the heavy chain of anti-PS antibody by connecting small peptide, V
lfragment connects small peptide by another and is connected with the light chain of anti-PS antibody, then further the light chain after above-mentioned fusion and heavy chain gene are cloned into carrier for expression of eukaryon pCHO1.0(purchased from: Life Technology), be built into carrier for expression of eukaryon pCHO1.0(anti-HER2/PS).By this expression vector by liposome transfection Chinese hamster ovary celI, then with tetracycline and MTX screening positive cell clone.By screening the high-expression clone serum free medium enlarged culturing obtained, with the anti-HER2/PS bi-specific antibody of Protein A affinity column isolated or purified.
Applicant of the present invention carries out biological experiment in external, body to above-mentioned anti-HER2/PS bi-specific antibody.Extracorporeal biology experimental result shows that this antibody capable is combined with HER2 and/or PS well simultaneously.The plasma half-life of anti-HER2/PS bi-specific antibody in Mice Body is 6.3 days, shows that the structure height of anti-HER2/PS bi-specific antibody of the present invention is stablized.
Cell-mediated toxic action (the antibody dependent cell mediated cytotoxicity of the antibody-dependant that applicant of the present invention carries out avidity detection to above-mentioned anti-HER2/PS bi-specific antibody, HER2 or PS target mediates, ADCC), the experiment such as tumor suppression in albumen pharmacokinetic studies, body, experimental result shows, anti-HER2/PS bi-specific antibody disclosed by the invention can simultaneously in conjunction with surface of cell membrane HER2 and PS, the signal transduction pathway of both blocking-up.On the one hand, the ADCC effect that anti-HER2/PS bi-specific antibody of the present invention is powerful has mediated the direct killing of the tumour cell to high expression level HER2 or cell surface PS; On the other hand, the PS that turns up presented is continued during this anti-HER2/PS bi-specific antibody passes through and in process of cell death, stop itself and M2 Macrophage Surface PS receptors bind, blocked apoptosis program to the immunoreactive induction of suppressive, resisted the generation of tumor immune escape.In addition, anti-HER2/PS bi-specific antibody of the present invention has larger molecular weight than Trastuzumab or Bavituximab, its transformation period obviously extends, experiment shows, under equal dose, anti-HER2/PS bi-specific antibody of the present invention has better antineoplaston effect than applying separately Trastuzumab or Bavituximab.
The present invention discloses above-mentioned anti-HER2/PS bi-specific antibody; can pharmaceutical preparations composition be formed thus more play consistently curative effect together with pharmaceutically acceptable carrier; these preparations can ensure the conformation integrity of the amino acid core sequence of anti-HER2/PS bi-specific antibody disclosed by the invention, and the polyfunctional group simultaneously going back protected protein matter prevents its degraded (including but not limited to cohesion, deamination or oxidation).Under normal circumstances, for liquid preparation, usually can preserve under 2 DEG C of-8 DEG C of conditions and at least stablize 1 year, for freeze-dried preparation, within least six months, keep stable at 30 DEG C.Described anti-HER2/PS bi-specific antibody preparation can be the conventional preparation such as suspendible, liquid drugs injection, freeze-drying of pharmacy field, preferred liquid drugs injection or freeze-dried preparation, for liquid drugs injection or the freeze-dried preparation of above-mentioned anti-HER2/PS bi-specific antibody disclosed by the invention, pharmaceutically acceptable auxiliary material includes but not limited to: tensio-active agent, solution stabilizer, isotonic regulator and damping fluid one or a combination set of, and wherein tensio-active agent includes but not limited to: nonionic surface active agent is as Polyoxyethylene Sorbitol Fatty Acid Esters (polysorbas20 or 80); Poloxamer(is as poloxamer188); Triton; Sodium lauryl sulphate (SDS); Sulfuric acid,monododecyl ester, sodium salt; Tetradecyl, sub-oil base or octadecyl sarkosine; Pluronics; MONAQUAT
tMdeng, its add-on should make the granulating trend of anti-HER2/PS bi-specific antibody minimum.Solution stabilizer includes but not limited to following to enumerate one or a combination set of: carbohydrate, such as, and reducing sugar and nonreducing sugar; Amino acids, such as, msg powder type or Histidine; Alcohols, such as: trivalent alcohol, senior sugar alcohol, propylene glycol, polyoxyethylene glycol etc., keeps steady state in the time that the add-on of solution stabilizer should make last preparation those skilled in the art formed think to reach stable.Isotonic regulator includes but not limited to sodium-chlor, N.F,USP MANNITOL one or a combination set of.Damping fluid includes but not limited to: TRIS, histidine buffering liquid, phosphate buffered saline buffer one or a combination set of.
Above-mentioned preparation is the composition comprising anti-HER2/PS bi-specific antibody, and after to the animals administer comprising people, antitumous effect is obvious.Specifically, preventing and/or treating effectively tumour, can use as antitumor drug.
The tumour of indication of the present invention, include but not limited to: gland cancer, leukemia, lymphoma, melanoma, sarcoma, the source of tumor tissues includes but not limited to suprarenal gland, gall-bladder, bone, marrow, brain, mammary gland, bile duct, gi tract, heart, kidney, liver, lung, muscle, ovary, pancreas, parathyroid gland, penis, prostate gland, skin, sialisterium, spleen, testis, thymus gland, Tiroidina and uterus.Except above-mentioned tumour, also can be used for the tumour of central nervous system as spongiocyte diversity knurl, astrocytoma etc., in addition the tumour of eye comprises rodent cancer, squamous cell carcinoma, melanoma etc., also comprise endocrine disrupting effects, neuroendocrine system tumour, gi tract pancreatic endocrine system tumor, genital system tumor and tumor of head and neck etc.Here will not enumerate.Preferred mammary cancer.
Antitumor drug alleged by the present invention, refer to that there is the medicine suppressing and/or treat tumour, the reduction of delay and/or these severity of symptom developed with tumor growth related symptoms can be comprised, it further comprises alleviating of already present tumor growth simultaneous phenomenon and prevents the appearance of other symptoms, also comprises and reduces or prevent transfer.
In the present invention, anti-HER2/PS bi-specific antibody and composition thereof are to when comprising the animals administer of people, dosage is because of age of patient and body weight, disease traits and seriousness, and route of administration and different, can with reference to zooperal result and all situations, total dosage can not exceed certain limit.Specifically intravenous dosage is 1 ~ 1800mg/ days.
Anti-HER2/PS bi-specific antibody disclosed by the invention and composition thereof can also and other antitumour drug Combined Preparation, for the treatment of tumour, these antitumour drugs include but not limited to: 1, cytotoxic drug (1) acts on the medicine of DNA chemical structure: alkylating agent is as nitrogen mustards, nitrous urine class, methanesulfonate ester class; Platinum compound is as cis-platinum, carboplatin and RP-54780 etc.; Mitomycin (MMC); (2) medicine of nucleic acid synthesis is affected: dihydrofolate reductase inhibitor is as Rheumatrex (MTX) and Alimta etc.; Thymus nucleoside synthetase inhibitors is as fluorouracil (5FU, FT-207, capecitabine) etc.; Purine nucleoside synthetase inhibitors is as Ismipur (6-MP) and 6-TG etc.; Ribonucleotide reductase inhibitor is as hydroxyurea (HU) etc.; DNA polymerase inhibitor is as cytosine arabinoside (Ara-C) and gemzar (Gemz) etc.; (3) act on the medicine of transcribed nucleic acid: selectively acting, in DNA profiling, suppresses DNA dependenc RNA polysaccharase, thus suppress the medicine of RNA synthesis as dactinomycin, daunorubicin, Zorubicin, pidorubicin, aclacinomycin, Plicamycin etc.; (4) medicine of tubulin synthesis is mainly acted on: taxol, taxotere, vincaleucoblastine, vinorelbine, Podophyllum emodi var chinense alkali class, homoharringtonine; (5) other Cytotoxic drugs: the synthesis of the main arrestin matter of Asparaginase; 2, hormones estrogen antagonist: tamoxifen, droloxifene, Exemestane etc.; Arimedex: aminoglutethimide, Lan Telong, letrozole, Rui Ningde etc.; Androgen antagonist: its ammonia RH-LH agonist/antagonist of fluorine: Zoladex, enatone etc.; 3, biological response modifier: mainly through body's immunity Tumor suppression Interferon, rabbit; Interleukin II; Thymic; 4, monoclonal antibody: Mabthera (MabThera); Cetuximab (C225); Bevacizumab (Avastin); 5, other comprise some machine-processed medicines failed to understand and need research further at present; Cell differentiation inducer is as retinoids; Cell death inducer.Anti-HER2/PS bi-specific antibody disclosed by the invention and composition thereof can with above-mentioned antitumor drug one or a combination set of drug combination.
Accompanying drawing explanation
Fig. 1 anti-HER2/PS bi-specific antibody structural representation
Fig. 2 pCHO1.0 structural representation
The anti-HER2/PS bi-specific antibody of Fig. 3 for HER2 bonding force experimental result
The bonding force experimental result of the anti-HER2/PS bi-specific antibody of Fig. 4 and PS
The anti-HER2/PS bi-specific antibody of Fig. 5 is for the ADCC effect experiment result of HER2 target antigen
The activity experiment result of BT-474 growth is suppressed in Fig. 6 anti-HER2/PS bi-specific antibody body
Embodiment
Following examples, experimental example are further detailed the present invention, should not be construed as limitation of the present invention.Embodiment does not comprise the detailed description to traditional method, as the method that those draw for carrier construction and matter, the gene of proteins encoded being inserted into the method that such carrier and matter are drawn or method plasmid being introduced host cell. such method is well-known for person having ordinary skill in the art, and described by having in many publications, comprise Sambrook, J., Fritsch, E.F.and Maniais, T.(1989) Molecular Cloning:A Laboratory Manual, 2
ndedition, Cold spring Harbor Laboratory Press.
Gene constructed and the expression of embodiment 1 anti-HER2/PS bi-specific antibody
The sequence of anti-human HER2 monoclonal antibody trastuzumab (IgG1, κ) comes from KEGG gene pool (NO.D03257), and the constant-region sequences analysis of comparison human IgG1 antibody obtains VH and VL gene fragment.Meanwhile, according to anti-human PS monoclonal antibody Bavituximab(IgG1, κ that who.int announces) aminoacid sequence (WHO Drug Information, Vol.21, No.1,2007.p7), by Sheng Gong biotechnology company limited full genome synthesizing ribonucleotide sequence after codon optimization.The N adopting the method for Overlapping PCR the VH gene fragment of Trastuzumab to be passed through joint (ASTKGP) and Bavituximab heavy chain holds and merges; N VL gene fragment being passed through joint (TVAAP) and Bavituximab light chain holds and merges.Linker fragment comes from the N terminal sequence of human IgG1 CH1 or C κ respectively.The primer of heavy chain Overlapping PCR is (sense primer 1:GAAGTGCAGCTGGTGGAAAGCGG; Antisense primer 1:CTCTGCTGCAGCTGCACTTCCGGGCCTTTGGTGCTCGCCACCAGGGTGCCCTGG CCCCAATAA; Sense primer 2:GGGGCCAGGGCACCCTGGTGGCGAGCACCAAAGGCCCGGAAGTGCAGCTGCAGC AGAGCGGCC; Antisense primer 2:TTTGCCCGGGCTCAGGCTCAGGC).The primer of light chain Overlapping PCR is (sense primer 1:GATATTCAGATGACCCAGAGCCC; Antisense primer 1:CTCTGGGTCATCTGAATATCCGGCGCCGCCACGGTCACTTTGGTGCCCTGGCCA AAGGTC; Sense primer 2:TTGGCCAGGGCACCAAAGTGACCGTGGCGGCGCCGGATATTCAGATGACCCAGA GCCCGA; Antisense primer 2:GCATTCGCCGCGGTTAAAGCTTT).SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:1, SEQ ID NO:6 respectively illustrate gained anti-PS/HER2 bi-specific antibody heavy chain nucleotide sequence, heavy chain amino acid sequence and heavy chain variable amino acid sequence; SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 respectively illustrate the light chain nucleotide sequence of the anti-PS/HER2 bispecific antibody of gained, light-chain amino acid sequence and chain variable region amino acid sequence.Figure 1 shows anti-HER2/PS bi-specific antibody structural representation (wherein, VH1 is former Trastuzumab weight chain variabl area sequence, VH2 is the weight chain variabl area sequence of former Bavituximab, CH1-CH2-CH3 is the light chain constant region sequence of former Bavituximab, VL1 is former Trastuzumab light-chain variable sequence, VL2 is the light-chain variable sequence of former Bavituximab, and CL is the constant light chain sequences of former Bavituximab).PCR primer is cloned into pCHO1.0 expression vector (purchased from Life technologies company), sequence verification confirms to obtain correct clone, and correct cloning vector is expressed as: pCHO1.0(anti-HER2/PS).In addition, people HER2 gene (NM_001005862.2) routine is synthesized by Sheng Gong biotechnology company limited after adding human IgG1 Fc sequence, use the same method respectively by HER2-Fc, Trastuzumab and Bavituximab full gene cloning is in pCHO1.0, and correct cloning vector is labeled as pCHO1.0(anti-HER2 respectively) and pCHO1.0(anti-PS).
By above-mentioned pCHO1.0(anti-HER2/PS), pCHO1.0(HER2-Fc), pCHO1.0(anti-HER2) and pCHO1.0(anti-PS) carrier respectively transient transfection to human embryonic kidney cell 293 clone (purchased from ATCC company), after cultivating a couple of days, utilize Protein A affinity column (purchased from Pharmacia company) antibody purification albumen from cells and supernatant.Quantitatively being undertaken by BCA (Bicinchoninic acid) method of albumen.The anti-HER2/PS bi-specific antibody that purifying obtains, Trastuzumab and Bavituximab antibody samples are for following further analysis and research.
Experimental example 2SDS-PAGE and Western-blot detects anti-HER2/PS bispecific antibody
Anti-HER2/PS bispecific antibody after purifying, Trastuzumab and Bavituximab detect its purity and molecular size range by polyacrylamide gel electrophoresis respectively under non-reduced (6%) and reduction (12%) condition, identify its character and molecular weight further by Western-blot simultaneously.Western-blot method is as follows: be transferred on pvdf membrane by the glue after electrophoresis by the method for electrotransfer, and add the goat anti-human igg (H+L) of HRP mark after closing, PBST washes twice, last DAB method colour developing.The result display of polyacrylamide gel electrophoresis and Western-blot: under the reducing conditions, Trastuzumab and Bavituximab is all rendered as heavy chain and the light chain that molecular size range is about 50KDa and 25KDa, and anti-HER2/PS bispecific antibody of the present invention is rendered as molecular size range is about 63KDa(heavy chain) and 36KDa(light chain).Under non reducing conditions, all antibody all presents a band, and their size is respectively 149KDa(Trastuzumab), 148KDa(Bavituximab) and the anti-HER2/PS bi-specific antibody of 192KDa().Meanwhile, under non reducing conditions, utilize anti-Fc antibody or anti-κ antibody (all purchased from: Sigma), the existence (as independent heavy chain, independent light chain, or heavy chain complexes etc.) of aberrant molecules fragment do not detected.
The qualification of the anti-HER2/PS bispecific antibody of embodiment 3 and HER2 binding ability
Anti-HER2/PS bispecific antibody and HER2 detect in combination with Biacore3000.After on the chip HER2-Fc of expression and purification being coated on Biacore3000 with different concns, detect its avidity.Anti-HER2/PS bi-specific antibody is similar to the female antibody trastuzumab of the avidity of HER2 and its, specifically in table 1.
Table 1, anti-HER2/PS bi-specific antibody is to the avidity of HER2
Anti-HER2/PS bi-specific antibody detects the proliferation experiment of the In vitro biological activity of HER2 by breast carcinoma cell strain BT-474.BT-474 cell (purchased from the type culture classical collection council of Chinese Academy of Sciences cell bank).Logarithmic phase is cultured to, with 6 × 10 with RPMI1640 perfect medium after cell recovery
4the density of/ml is prepared into single cell suspension, 100 μ l/ holes are inoculated in 96 orifice plates, meanwhile, add anti-HER2/PS bi-specific antibody and the Trastuzumab (10ng/ml ~ 100ng/ml) of same volume different concns dilution, each concentration gradient arranges 3 multiple holes.Cultivate after 7 days, utilize MTT method to detect the propagation of cell.As shown in Figure 3, anti-HER2/PS bi-specific antibody of the present invention suppresses the propagation of the BT-474 cell of HER2 mediation suitable with female antibody trastuzumab to experimental result.
The anti-HER2/PS bi-specific antibody of embodiment 4 is to the identification of PS target
The avidity of anti-HER2/PS bi-specific antibody and PS is detected by ELISA.In PS(available from Sigma) wrap in 96 orifice plates of quilt the anti-HER2/PS bi-specific antibody and Bavituximab that add different concns (0.016nM-33nM) respectively, hatch 2 hours for 37 DEG C, then goat against murine IgG-HRP is utilized to carry out association reaction, hatch 1 hour for 37 DEG C, add TMB nitrite ion 37 DEG C reaction 10 minutes, then use 2MH
2sO
4color development stopping, surveys A
490value.As shown in Figure 4, anti-HER2/PS bispecific antibody is suitable with the binding ability of female antibody Bavituximab to PS for experimental result.Anti-HER2/PS bispecific antibody one-piece construction compared with female antibody Bavituximab changes, but it does not affect anti-HER2/PS bispecific antibody to the identification of PS epitope.
The expression of embodiment 5 antibody gene in Chinese hamster ovary celI
By liposome method by pCHO1.0(anti-HER2/PS) carrier transfection is to CHO-S clone (Life technologies Products), and then use tetracycline and MTX screen positive cell clone.Utilize human IgG ELISA to detect antibody concentration in nutrient solution supernatant: the goat anti-human igg Fc antibody (purchased from Sigma) of 5 μ g/ml is coated in elisa plate, and 4 DEG C are spent the night, 2% bovine serum albumin 37 DEG C closes 2 hours.Add nutrient solution supernatant or standard substance (human IgG1) 37 DEG C hatch 2 hours, utilize HRP-goat anti-human igg (PIERCE) to detect.By screening the high-expression clone serum free medium enlarged culturing obtained, with the anti-HER2/PS bi-specific antibody of Protein A affinity column separation and purification.
The ADCC effect of the anti-HER2/PS bispecific antibody of embodiment 6
The ADCC effect of the HER2 mediation of anti-HER2/PS bispecific antibody is measured by BT-474 clone.1.5 × 10
4bT-474 cell (purchased from the type culture classical collection council of Chinese Academy of Sciences cell bank) hatches 10 minutes with the bispecific antibody of different concns (7.8ng/ml ~ 64 μ g/ml) in 96 orifice plates, and female antibody trastuzumab in contrast.Effector cell's peripheral blood mononuclear cell is separated from Fresh human peripheral's blood by Ficoll density gradient centrifugation, and with 3 × 10
5the concentration in/hole is added to experimental port.37 DEG C hatch 4 hours after by serum lactic dehydrogenase (Lactate dehydrogenase, LDH) citotoxicity detection kit (Promega Products) detect kill and wound situation.As shown in Figure 5, the ADCC that anti-HER2/PS bi-specific antibody of the present invention maintains its female antibody trastuzumab is active, its cellkilling capacity and Trastuzumab there was no significant difference for result.Because PS mainly expresses on apoptotic cell, therefore, ADCC experiment for PS target spot cannot distinguish the apoptosis that the apoptosis of cell self or ADCC effect cause, and this bispecific antibody is its Fc with the Fc fragment of the female antibody of HER2 instead of the female antibody of PS, existing contrast cannot the structural modification of objective evaluation bispecific antibody to the change of the ADCC effect for PS target spot.Based on above reason, we do not carry out the external ADCC experiment for PS target spot.
The heteroplastic transplantation model of embodiment 7 MCF-7 BT-474
BT-474 cell (purchased from the type culture classical collection council of the Chinese Academy of Sciences cell bank) 0.25%(w/v that growth conditions is good) trypsinase and the of short duration digestion of 0.02%EDTA, wash resuspended after with 1 × 10
6the right side that cell/mouse is inoculated in 6-8 week Female nude mice is subcutaneous.When tumour grows to>=200mm
3time, tumor bearing nude mice more consistent for 30 tumor sizes is divided into five groups at random, start to give the treatment of anti-HER2/PS bispecific antibody, irrelevant Isotype antibody IgG1 (available from Sigma), Trastuzumab, Bavituximab, Trastuzumab+Bavituximab are in contrast.Five kinds of antibody are all with 10mg/kg, and weekly intravenous mode carries out administration.Mouse treatment starts rear Continuous Observation six weeks, and measure gross tumor volume weekly, the account form of gross tumor volume size is: V=0.5ab
2.A is tumor entity longest diameter, and b is the shortest diameter of tumor entity.Experimental result as shown in Figure 6, similar with Trastuzumab+Bavituximab drug combination, anti-HER2/PS bi-specific antibody treatment group of the present invention has blocked the further growth of tumour completely, and mouse tumor volume is significantly less than Trastuzumab or Bavituximab group.
Claims (10)
1. the anti-HER2/PS bi-specific antibody of restructuring, is characterized in that described antibody can be combined with HER2, can also be combined with PS.
2. recombinate described in claim 1 anti-HER2/PS bi-specific antibody, it is characterized in that, described antibody variable region amino acid sequence comprises variable region and the anti-PS variable region of mab aminoacid sequence of anti-HER 2 monoclonal antibody.
3. recombinate described in claim 2 anti-HER2/PS bi-specific antibody, it is characterized in that, described bi-specific antibody heavy chain variable amino acid sequence is as shown in SEQ ID NO:6, and chain variable region amino acid sequence is as shown in SEQID NO:5.
4. recombinate described in claim 3 anti-HER2/PS bi-specific antibody, it is characterized in that, described heavy chain of antibody aminoacid sequence is as shown in SEQ ID NO:2, and light-chain amino acid sequence is as shown in SEQ ID NO:4.
5. be separated a nucleic acid molecule, the arbitrary described anti-HER2/PS bi-specific antibody of its above-mentioned 1-4 that encodes, described nucleic acid molecule can be its heavy chain nucleotide sequence as shown in SEQ ID NO:1, light chain nucleotide sequence is as shown in SEQ ID NO:3.
6. a carrier, it contains nucleic acid molecule according to claim 5, and described carrier can be pDR1, pcDNA3.1(+), pDHFF or pCHO1.0.
7. a host cell, it contains carrier according to claim 6, and described cell can be one of COS, CHO, NS0, sf9, sf21, DH5a, BL21 (DE3), TG1.
8. prepare a method for the arbitrary described anti-HER2/PS bi-specific antibody of claim 1-4, said method comprising the steps of:
A) under expression condition, cultivate host cell according to claim 7, thus express anti-HER2/PS bi-specific antibody;
B) isolated or purified a) described in anti-HER2/PS bi-specific antibody.
9. a composition, containing the arbitrary described anti-HER2/PS bi-specific antibody of above-mentioned 1-4 and pharmaceutically acceptable carrier.
10. the purposes in solid tumor resisting medicine prepared by preparation described in the arbitrary described anti-HER2/PS bi-specific antibody of claim 1-4 or claim 9; Described purposes can also comprise the antitumor drug conbined usage with other.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410129991.3A CN104974261B (en) | 2014-04-01 | 2014-04-01 | Recombinate anti-HER2/PS bispecific antibody, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410129991.3A CN104974261B (en) | 2014-04-01 | 2014-04-01 | Recombinate anti-HER2/PS bispecific antibody, preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104974261A true CN104974261A (en) | 2015-10-14 |
| CN104974261B CN104974261B (en) | 2019-06-14 |
Family
ID=54271263
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410129991.3A Active CN104974261B (en) | 2014-04-01 | 2014-04-01 | Recombinate anti-HER2/PS bispecific antibody, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104974261B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111647624A (en) * | 2020-06-10 | 2020-09-11 | 成都和同易创生物科技有限公司 | TSAB human monoclonal antibody recombinant vector, recombinant antibody and preparation method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102884084A (en) * | 2010-03-04 | 2013-01-16 | 西福根有限公司 | Anti-her2 antibodies and compositions |
| WO2013123061A1 (en) * | 2012-02-13 | 2013-08-22 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Bispecific chimeric antigen receptors and therapeutic uses thereof |
| CN103509117A (en) * | 2013-05-06 | 2014-01-15 | 江苏匡亚生物医药科技有限公司 | Bispecific antibody capable of resisting human epidermal growth factor receptor 2 (HER2) and human insulin-like growth factor-IR (IGF-IR), and preparation method and applications thereof |
| WO2014025199A2 (en) * | 2012-08-09 | 2014-02-13 | 주식회사 한독 | Staphylococcal enterotoxin-derived superantigen mutant, fusion protein in which target-specific polypeptides are connected to the mutant and use thereof |
-
2014
- 2014-04-01 CN CN201410129991.3A patent/CN104974261B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102884084A (en) * | 2010-03-04 | 2013-01-16 | 西福根有限公司 | Anti-her2 antibodies and compositions |
| WO2013123061A1 (en) * | 2012-02-13 | 2013-08-22 | Seattle Children's Hospital D/B/A Seattle Children's Research Institute | Bispecific chimeric antigen receptors and therapeutic uses thereof |
| WO2014025199A2 (en) * | 2012-08-09 | 2014-02-13 | 주식회사 한독 | Staphylococcal enterotoxin-derived superantigen mutant, fusion protein in which target-specific polypeptides are connected to the mutant and use thereof |
| CN103509117A (en) * | 2013-05-06 | 2014-01-15 | 江苏匡亚生物医药科技有限公司 | Bispecific antibody capable of resisting human epidermal growth factor receptor 2 (HER2) and human insulin-like growth factor-IR (IGF-IR), and preparation method and applications thereof |
Non-Patent Citations (2)
| Title |
|---|
| DAVID E. GERBER 等: "Phase I Safety and Pharmacokinetic Study of Bavituximab, a Chimeric Phosphatidylserine-Targeting Monoclonal Antibody，in Patients with Advanced Solid Tumors", 《CLINICAL CANCER RESEARCH》 * |
| 萨宾·罗素: "双特异性抗体", 《科技创业》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111647624A (en) * | 2020-06-10 | 2020-09-11 | 成都和同易创生物科技有限公司 | TSAB human monoclonal antibody recombinant vector, recombinant antibody and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104974261B (en) | 2019-06-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6997619B2 (en) | Use of VISTA agonists and VISTA antagonists for suppression or enhancement of humoral immunity | |
| TW202115128A (en) | Flt3l-fc fusion proteins and methods of use | |
| EP4177271A1 (en) | Carrier-pd-l1 binding agent compositions for treating cancers | |
| JP2021118699A (en) | Glycan-interacting compounds and methods of use | |
| KR20180075689A (en) | Methods and compositions for chimeric antigen receptors | |
| TW202023629A (en) | Compositions and methods for modulating monocyte and macrophage inflammatory phenotypes and immunotherapy uses thereof | |
| Vijayan et al. | Selective activation of anti-CD73 mechanisms in control of primary tumors and metastases | |
| JP2022518262A (en) | Compositions and Methods for Stimulating Natural Killer Cells | |
| JP2022507606A (en) | How to Treat Tumors with a Combination of IL-7 Protein and Immune Checkpoint Inhibitors | |
| Jiao et al. | A PD-L1 and VEGFR2 dual targeted peptide and its combination with irradiation for cancer immunotherapy | |
| CN107523546A (en) | A kind of NK cells of high efficiency stable expression antibody and application thereof | |
| CN110494152A (en) | Short TRAIL antibody and application method | |
| Bonvin et al. | Antibody neutralization of CXCL10 in vivo is dependent on binding to free and not endothelial-bound chemokine: implications for the design of a new generation of anti-chemokine therapeutic antibodies | |
| Wu et al. | Engineered mRNA-expressed bispecific antibody prevent intestinal cancer via lipid nanoparticle delivery | |
| CN106800599A (en) | Anti-human EGFR and Notch multi-specificity antibodies, Preparation Method And The Use | |
| Park et al. | Multivalent in vivo delivery of DNA-encoded bispecific T cell engagers effectively controls heterogeneous GBM tumors and mitigates immune escape | |
| Ning et al. | Recent progress in antibody-based therapeutics for triple-negative breast cancer | |
| Liu et al. | Discovery of anti-PD-L1 human domain antibodies for cancer immunotherapy | |
| CN106554419A (en) | Recombinate anti-HER2 bispecific antibodies, its preparation method and application | |
| JP2020501518A (en) | Treatment of allergic diseases using chimeric proteins | |
| AU2013403112B2 (en) | Anti-CD20-Flex bifunctional fusion protein, and preparation method and use thereof | |
| CN104974261A (en) | Recombinant anti-HER2/PS bispecific antibody as well as preparation method and application thereof | |
| CN102372778B (en) | Anti-human VEGF/anti-OPN bispecific antibody, its preparation method and application | |
| RU2663104C1 (en) | Producing pegylated fragments of gd2-specific antibodies inducing direct cell death of gd2-positive tumor cells, and use thereof in therapy of gd2-positive tumors | |
| CN105669867A (en) | Anti-GITR/CTLA-4 bispecific antibody, preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| CB02 | Change of applicant information |
Address after: Shanghai city 201203 libing road Pudong New Area Zhangjiang hi tech Park No. 399 Applicant after: Three country Kin Pharmaceutical (Shanghai) Limited by Share Ltd Address before: Shanghai city 201203 libing road Pudong New Area Zhangjiang hi tech Park No. 399 Applicant before: Shanghai CP Guojian Pharmaceutical Co., Ltd. |
|
| COR | Change of bibliographic data | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |