CN104962626A - Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP - Google Patents
Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP Download PDFInfo
- Publication number
- CN104962626A CN104962626A CN201510353287.0A CN201510353287A CN104962626A CN 104962626 A CN104962626 A CN 104962626A CN 201510353287 A CN201510353287 A CN 201510353287A CN 104962626 A CN104962626 A CN 104962626A
- Authority
- CN
- China
- Prior art keywords
- primer
- imp
- metallo
- seq
- lamp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an LAMP kit and method used for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP. The kit comprises a pair of outer primers, a pair of inner primers and a pair of loop primers. The method is implemented as SEQ ID NO.1-6 and includes the steps that DNA of a to-be-detected bacterium genome is extracted, six specific primers and a kind of DNA polymerase with the strand displacement activity are adopted, the DNA sample is amplified at 60 DEG C to 65 DEG C, and a user adds color developing agents to observe changes in the color in a reaction tube to judge whether amplifying is achieved or not. The LAMP kit and method have the advantages of being rapid, efficient, easy and convenient to operate, high in specificity, high in sensitivity, easy and convenient to detect, suitable for site detection and the like, and is suitable for application and popularization.
Description
Technical field
The present invention relates to the detection of pathogenic micro-organism, be specifically related to one ring mediated isothermal gene amplification (LAMP technology) rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPtest kit and method.
Background technology
In recent years, along with the widespread use clinically of the Carbapenem antibiotics such as imipenum, bacterium creates the metallo-β-lactamase that a class extensively can be hydrolyzed β-lactam antibitics, the bacterium producing this fermentoid produces resistance to all microbiotic of beta-lactam, extreme difficulties is caused to clinical anti-infective therapy, and produce at present the Pseudomonas aeruginosa kind of metallo-β-lactamase and quantity in continuous increase, that has reported mainly contains
iMPwith
vIMtwo types.And in Guangzhou Guangdong, the eruption and prevalence of producing IMP metalloenzyme Pseudomonas aeruginosa once appearred in 2005 ~ 2007 Nian Duojia hospitals, oneself became the thorny problem that clinicist faces.Therefore, monitor timely and effectively by
iMPthe imipenem-resistant Pseudomonas aeruginosa hospital infection caused is imperative.
And traditional culture of microorganism and drug sensitive test method can provide good value clinically, but because of length consuming time, loaded down with trivial details operating process, need the different reasons such as expensive plant and instrument to fail large-scale promotion clinically to use.And the specificity amplification primer that this research designs for IMP singly can not increase effectively specifically
iMP, thus set up a kind of easy, rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPmethod.
Summary of the invention
The object of the present invention is to provide a kind of for rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPlAMP kit and a kind of with ring mediated isothermal gene amplification (LAMP technology) rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPmethod.
The technical solution used in the present invention is:
A kind of for rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPlAMP primer group, it comprises a pair inner primer, a pair outer primer and a pair ring primer, and nucleotide sequence is respectively as follows:
Inner primer 1:5 '-TTAGCTTGTACCTTACCGTCTTAGAGTGGCTTAATTCTCAATCT-3 ' (SEQ ID No.1);
Inner primer 2:5 '-GCGGAGTTAGCTATTGGCTAGTCCACTACGTTATCTGGAGC-3 ' (SEQ ID No.2);
Outer primer 1:5 '-TTCCATAGCGACAGCACG-3 ' (SEQ ID No.3);
Outer primer 2:5 '-ATTACCTAGACCGTAGGGTTT-3 ' (SEQ ID No.4);
Ring primer 1:5 '-GTTAATTCAGATGCATACGTGG-3 ' (SEQ ID No.5);
Ring primer 2: 5 '-TATCCTGGTCCAGGGCAC-3 ' (SEQ ID No.6).
A kind of for rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPlAMP kit, it comprises above-mentioned for rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPlAMP primer group.
As preferably, in described primer sets, the mol ratio of inner primer, outer primer, ring primer is 6-8:1:3-4.
As preferably, also contain in described test kit: archaeal dna polymerase, LAMP reaction solution, developer, positive control and negative control.
As preferably, described archaeal dna polymerase is
bstarchaeal dna polymerase.
As preferably, described LAMP reaction solution contains: 10 mM dNTP, 10 × ThermoPol reaction buffer, 150 mM MgSO
4the aqueous solution, 5 mM trimethyl-glycines, the volume ratio of four is 6-8:4-5:2-3:8-10.
As preferably, described developer is SYBR GREEN I.
As preferably, described positive control is for containing bacterium metallo-β-lactamase drug resistant gene
iMPthe plasmid of fragment, described bacterium metallo-β-lactamase drug resistant gene
iMPfragment is as shown in SEQ ID NO.7; Described negative control is DEPC water.
A kind of rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPmethod, comprise the steps:
(1) measuring samples DNA is extracted;
(2) utilize above-mentioned for rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPlAMP primer group isothermal duplication is carried out to measuring samples DNA;
(3) result judges: in above-mentioned reaction tubes, add 1-2 μ L developer 10 × SYBR GREEN I, and the color of observing response liquid after mixing, if present green, is
iMPmetallo-β-lactamase drug resistant gene, orange is then non-
iMPgene.
As preferably, 25 μ L reaction systems of isothermic gene amplification reaction contain: inner primer each 8pmol/ μ L, each 1 pmol/ μ L of outer primer, ring primer each 4 pmol/ μ L, reaction solution 12.5 μ L, archaeal dna polymerase 8U, DNA 1-100 ng to be checked, with sterilizing deionized water polishing to 25 μ L; The condition of isothermic gene amplification reaction is: 60-65 DEG C of reaction 55-65min.
The invention has the beneficial effects as follows: invention directed toward bacteria metallo-β-lactamase drug resistant gene
iMPspecific designs 6 primers, are combined with 6 regions of goal gene, have higher specificity, can exactly by bacterium metallo-β-lactamase drug resistant gene
iMPwith other non-bacterial metallo-β-lactamase drug resistant genes
iMPmake a distinction.In addition, test kit of the present invention is convenient and swift, can discriminating bacteria metallo-β-lactamase drug resistant gene in the short period of time
iMP, do not need expensive plant and instrument; Highly sensitive; Specificity is good, is applicable to Site Detection.
Accompanying drawing explanation
Fig. 1 is that the present invention is to bacterium metallo-β-lactamase drug resistant gene
iMPand to non-bacterial metallo-β-lactamase drug resistant gene
iMPamplification (-: negative sample ,+: bacterium metallo-β-lactamase drug resistant gene
iMPsample);
Fig. 2 be embodiment 3 specificity verification result (1:DEPC, 2:
cTX-M-1,3:
pME, 4:
sME, 5:
cMY-2, 6:
tEM, 7:
iMP, 8:
vIMand
cMY-2);
Fig. 3 is the LAMP sensitivity experiment result (a:: the electrophoresis result of LAMP amplification of the present invention of embodiment 4; B: the colour developing result of LAMP amplification of the present invention; Wherein, 1 is DEPC, and 2 ~ 9 for belonging to β-lactamase drug resistant gene containing bacterium
iMPpBCSK plasmid, concentration is followed successively by 1.0 × 10
0, 1.0 × 10
1, 1.0 × 10
2, 1.0 × 10
3, 1.0 × 10
4, 1.0 × 10
5, 1.0 × 10
6, 1.0 × 10
7copy/μ L).
Fig. 4 is that (wherein, 1 is DEPC, and 2 ~ 9 belong to β-lactamase drug resistant gene containing bacterium for the Standard PCR sensitivity experiment result of embodiment 4
iMPpBCSK plasmid, concentration is followed successively by 1.0 × 10
0, 1.0 × 10
1, 1.0 × 10
2, 1.0 × 10
3, 1.0 × 10
4, 1.0 × 10
5, 1.0 × 10
6, 1.0 × 10
7copy/μ L).
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated, but be not limited thereto.
embodiment 1 is for rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPthe foundation of LAMP kit
For rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPlAMP kit, comprise following composition: (1) Auele Specific Primer group; (2) archaeal dna polymerase; (3) LAMP reaction solution; (4) developer; (5) positive control and negative control.
(1) design of Auele Specific Primer:
According to bacterium metallo-β-lactamase drug resistant gene
iMP(GenBank accession number is: specific designs 6 Auele Specific Primers of (NF812058), and sequence is as follows respectively:
Inner primer 1:5 '-TTAGCTTGTACCTTACCGTCTTAGAGTGGCTTAATTCTCAATCT-3 ' (SEQ ID No.1);
Inner primer 2:5 '-GCGGAGTTAGCTATTGGCTAGTCCACTACGTTATCTGGAGC-3 ' (SEQ ID No.2);
Outer primer 1:5 '-TTCCATAGCGACAGCACG-3 ' (SEQ ID No.3);
Outer primer 2:5 '-ATTACCTAGACCGTAGGGTTT-3 ' (SEQ ID No.4);
Ring primer 1:5 '-GTTAATTCAGATGCATACGTGG-3 ' (SEQ ID No.5);
Ring primer 2: 5 '-TATCCTGGTCCAGGGCAC-3 ' (SEQ ID No.6).
(2) archaeal dna polymerase is
bstarchaeal dna polymerase;
(3) LAMP reaction solution contains: 10mM dNTP, 10 × ThermoPol reaction buffer, 150mM MgSO
4, 5mM trimethyl-glycine, the volume ratio of four is 8:5:3:10.
(4) developer is SYBR GREEN I.
(5) positive control is for containing bacterium metallo-β-lactamase drug resistant gene
iMPthe pBCSK plasmid (utilizing conventional plasmid construction method to be inserted in pBCSK plasmid by SEQ ID NO.7 to obtain) of fragment (SEQ ID NO.7); Negative control is DEPC water.
embodiment 2 bacterium metallo-β-lactamase drug resistant gene
iMPmethod for quick
Utilize the test kit rapid detection bacterium metallo-β-lactamase drug resistant gene of embodiment 1
iMP, concrete steps are as follows:
(1) template DNA is extracted: adopt water-boiling method to extract bacterial genomes DNA;
(2) ring mediated isothermal gene amplification reaction: 25 μ L reaction systems contain: inner primer 1,2 final concentration is respectively 8 pmol/ μ L, outer primer 1,2 final concentration is respectively 1 pmol/ μ L, ring primer 1,2 final concentration is respectively 4 pmol/ μ L, reaction solution 12.5 μ L, archaeal dna polymerase 8U, DNA 50 ng to be checked, with sterilizing deionized water polishing to 25 μ L, then the sealing liquid of 20 μ L is added, by above-mentioned reaction tubes in 63 DEG C of reaction 60min;
(3) result judges: in above-mentioned reaction tubes, add 1 μ L developer 1 × SYBR Green I, and after mixing, the color of observing response liquid, if present green, is bacterium metallo-β-lactamase drug resistant gene
iMP, orange is then non-bacterial metallo-β-lactamase drug resistant gene
iMP (as Fig. 1).
embodiment 3 specificity experiments
The method of embodiment 2 is utilized not contain through qualification respectively
iMPthe clinical separation strain of gene detects, and DEPC water belongs with yin contrasts.
Detected result is shown in
fig. 2.Only bacterium metallo-β-lactamase drug resistant gene
iMPpipe is for green, and all the other pipes are for orange.Result shows, detection kit specificity of the present invention is high, can exactly by
iMPand other are non-
iMPmake a distinction.
embodiment 4 sensitivity experiment
(what namely build contains bacterium metallo-β-lactamase drug resistant gene to get positive reference substance
iMPthe pBCSK plasmid of fragment (SEQ ID NO.7)), measure its concentration and calculate copy number, according to the concentration gradient dilution of 10 times, choosing 1.0 × 10
0~ 1.0 × 10
7the concentration of copy/μ L is tested as sample.Detect by detection method of the present invention and conventional PCR method respectively.
Standard PCR detection method primer sequence used is as follows:
blaIMP-F： CGCGGATCCATGAGCAAGTTATTTGTATT （SEQ ID NO.8）
blaIMP-R： CCGGAATTCTTAATGTGCAGTGGTACTT （SEQ ID NO.9）
The detected result of test kit of the present invention as
fig. 3shown in, result shows, this test kit pair
iMPthe minimum detectability of gene is: 1.0 × 10
4copy/μ L.
The detected result of conventional PCR method as
fig. 4shown in.Its minimum detectability is: 1.0 × 10
5copy/μ L.
Above embodiment shows, test kit of the present invention has good, the highly sensitive feature of accuracy, and does not need expensive plant and instrument, is applicable to Site Detection.
Above embodiment is only introduces preferred case of the present invention, to those skilled in the art, not deviating from any apparent changes and improvements of carrying out in the scope of spirit of the present invention, all should be regarded as a part of the present invention.
<110> Zhongshan University
The diagnostic method of a <120> rapid detection bacterium metallo-β-lactamase drug resistant gene IMP
<130>
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 44
<212> DNA
<213> artificial sequence
<400> 1
ttagcttgta ccttaccgtc ttagagtggc ttaattctca atct 44
<210> 2
<211> 41
<212> DNA
<213> artificial sequence
<400> 2
gcggagttag ctattggcta gtccactacg ttatctggag c 41
<210> 3
<211> 18
<212> DNA
<213> artificial sequence
<400> 3
ttccatagcg acagcacg 18
<210> 4
<211> 21
<212> DNA
<213> artificial sequence
<400> 4
attacctaga ccgtagggtt t 21
<210> 5
<211> 22
<212> DNA
<213> artificial sequence
<400> 5
gttaattcag atgcatacgt gg 22
<210> 6
<211> 18
<212> DNA
<213> artificial sequence
<400> 6
tatcctggtc cagggcac 18
<210> 7
<211> 738
<212> DNA
<213> artificial sequence
<400> 7
atgagcaagt tatttgtatt ctttatgttt ttgttttgta gcattactgc cgcaggagag 60
tctttgccag atttaaaaat tgagaagctt gacgaaggcg tttatgttca tacttcgttt 120
gaagaagtta acggttgggg tgttattcct aaacacggct tggtggttct tgtaaatact 180
gatgcctatc tgatagacac tccatttact gctaaagata ctgaaaattt agttaattgg 240
tttgttgagc gcggctatag aataaaaggc agtatttcct cacatttcca tagcgacagc 300
acgggtggaa tagagtggct taattctcaa tctatcccca cgtatgcatc tgaattaaca 360
aatgaacttc ttaaaaaaga cggtaaggta caagctaaat attcatttag cggagttagc 420
tattggctag ttaagaaaaa gattgaagtt ttttatcctg gtccagggca cgctccagat 480
aacgtagtgg tttggctgcc tgaaaattag agttttgttc ggtggttgtt ttgttaaacc 540
ctacggtcta ggtaatttgg gtgacgcaaa tttagaagct tggccaaaat ccgccaaata 600
ttaatgtcaa aatatagtaa ggcaaaactg gttgtaccaa gtcatagtga cataggagat 660
tcgtcgctct tgaagcttac atgggagcag acggtaaaag gattcaatga aagcaaaaaa 720
agtaccactg cacattaa 738
<210> 8
<211> 29
<212> DNA
<213> artificial sequence
<400> 8
cgcggatcca tgagcaagtt atttgtatt 29
<210> 9
<211> 28
<212> DNA
<213> artificial sequence
<400> 9
ccggaattct taatgtgcag tggtactt 28
Claims (10)
1. one kind for rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPlAMP primer group, it comprises a pair inner primer, a pair outer primer and a pair ring primer, and nucleotide sequence is respectively as follows:
Inner primer 1:5 '-TTAGCTTGTACCTTACCGTCTTAGAGTGGCTTAATTCTCAATCT-3 ' (SEQ ID No.1);
Inner primer 2:5 '-GCGGAGTTAGCTATTGGCTAGTCCACTACGTTATCTGGAGC-3 ' (SEQ ID No.2);
Outer primer 1:5 '-TTCCATAGCGACAGCACG-3 ' (SEQ ID No.3);
Outer primer 2:5 '-ATTACCTAGACCGTAGGGTTT-3 ' (SEQ ID No.4);
Ring primer 1:5 '-GTTAATTCAGATGCATACGTGG-3 ' (SEQ ID No.5);
Ring primer 2: 5 '-TATCCTGGTCCAGGGCAC-3 ' (SEQ ID No.6).
2. one kind for rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPlAMP kit, it comprises the primer sets shown in claim 1.
3. LAMP kit according to claim 2, is characterized in that, in described primer sets, the mol ratio of inner primer, outer primer, ring primer is 6-8:1:3-4.
4. according to the LAMP kit shown in claim 2, it is characterized in that, also contain in described test kit: archaeal dna polymerase, LAMP reaction solution, developer, positive control and negative control.
5. LAMP kit according to claim 2, is characterized in that, described archaeal dna polymerase is
bstarchaeal dna polymerase.
6. LAMP kit according to claim 2, is characterized in that, described LAMP reaction solution contains: 10 mM dNTP, 10 × ThermoPol reaction buffer, 150 mM MgSO
4the aqueous solution, 5 mM trimethyl-glycines, the volume ratio of four is 6-8:4-5:2-3:8-10.
7. LAMP kit according to claim 2, is characterized in that, described developer is SYBR GREEN I.
8. LAMP kit according to claim 2, is characterized in that, described positive control is for containing bacterium metallo-β-lactamase drug resistant gene
iMPthe plasmid of fragment, described bacterium metallo-β-lactamase drug resistant gene
iMPfragment is as shown in SEQ ID NO.7; Described negative control is DEPC water.
9. a rapid detection bacterium metallo-β-lactamase drug resistant gene
iMPmethod, comprise the steps:
(1) measuring samples DNA is extracted;
(2) primer sets of claim 1 is utilized to carry out isothermic gene amplification reaction to measuring samples DNA;
(3) result judges: in above-mentioned reaction tubes, add 1-2 μ L developer 10 × SYBR GREEN I, and after mixing, the color of observing response liquid, if present green, is bacterium metallo-β-lactamase drug resistant gene
iMP, orange is then non-
iMPgene.
10. method according to claim 9, it is characterized in that, 25 μ L reaction systems of isothermic gene amplification reaction contain: inner primer each 8pmol/ μ L, the each 1 pmol/ μ L of outer primer, ring primer each 4 pmol/ μ L, reaction solution 12.5 μ L, archaeal dna polymerase 8U, DNA 1 ~ 100 ng to be checked, with sterilizing deionized water polishing to 25 μ L;
the condition of isothermic gene amplification reaction is: 60-65 DEG C of reaction 55-65min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510353287.0A CN104962626A (en) | 2015-06-23 | 2015-06-23 | Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510353287.0A CN104962626A (en) | 2015-06-23 | 2015-06-23 | Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104962626A true CN104962626A (en) | 2015-10-07 |
Family
ID=54216711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510353287.0A Pending CN104962626A (en) | 2015-06-23 | 2015-06-23 | Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104962626A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880896A (en) * | 2019-03-13 | 2019-06-14 | 中山大学 | A kind of multiple LAMP kit and detection method for the specific parting of quick discriminating bacteria polymyxins drug resistant gene mcr |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102952875A (en) * | 2011-08-31 | 2013-03-06 | 宁波市第二医院 | Bacterium drug-resistant gene detection method, gene chip and kit |
| CN103614465A (en) * | 2013-11-06 | 2014-03-05 | 南方医科大学 | Loop-mediated isothermal amplification (LAMP) primers, kit and detection method for detecting common carbapenemase genes of gram negative bacilli |
-
2015
- 2015-06-23 CN CN201510353287.0A patent/CN104962626A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102952875A (en) * | 2011-08-31 | 2013-03-06 | 宁波市第二医院 | Bacterium drug-resistant gene detection method, gene chip and kit |
| CN103614465A (en) * | 2013-11-06 | 2014-03-05 | 南方医科大学 | Loop-mediated isothermal amplification (LAMP) primers, kit and detection method for detecting common carbapenemase genes of gram negative bacilli |
Non-Patent Citations (1)
| Title |
|---|
| H.S.SADER等: "IMPs, VIMs and SPMs: the diversity of metallo-β-lactamases produced by carbapenem-resistant Pseudomonas aeruginosa in a Brazilian hospital", 《RESEARCH NOTE》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880896A (en) * | 2019-03-13 | 2019-06-14 | 中山大学 | A kind of multiple LAMP kit and detection method for the specific parting of quick discriminating bacteria polymyxins drug resistant gene mcr |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106834506A (en) | A kind of LAMP primer group of quick detection bacterium polymyxins drug resistant gene mcr 1, kit and detection method | |
| CN105671148A (en) | Kit for detecting carbapenem-resistant Enterobacteriaceae (CRE) and detection method | |
| CN107460242B (en) | Detection kit capable of simultaneously detecting multiple high-drug-resistance genes and application thereof | |
| CN101429539B (en) | Reagent kit for real time fluorescence quantitative PCR detection of bacillus pyocyaneus | |
| CN109486972A (en) | A kind of CPA primer sets for detecting pseudomonas aeruginosa, CPA nucleic acid test strip kit and its application | |
| CN102230019A (en) | Primer of loop-mediated isothermal amplification (LAMP) for detecting multidrug-resistant cfr gene as well as kit and method for detecting multidrug-resistant cfr gene | |
| CN109880896A (en) | A kind of multiple LAMP kit and detection method for the specific parting of quick discriminating bacteria polymyxins drug resistant gene mcr | |
| CN104726581A (en) | Vibrio parahaemolyticus constant-temperature detection primer set, detection kit and detection method capable of avoiding false negative detection result | |
| CN103773898A (en) | Triple detection kit for human herpes viruses HSV-1, HSV-2 and HCMV | |
| CN105219874A (en) | The PSR detection method of Pseudomonas aeruginosa and primer special thereof and test kit | |
| CN104946764A (en) | Diagnostic method for quickly detecting drug resistance gene CMY-2 of germ AmpC enzyme | |
| CN104962626A (en) | Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP | |
| CN102242210B (en) | Primer for LAMP (Loop-mediated Isothermal Amplification) superbacteria NDM-1 (New Delhi Metallo-beta-lactamase-1) gene as well as kit and method for detecting superbacteria NDM-1 gene | |
| CN104293925B (en) | For the multiple PCR primer group of rapid detection β-lactamase drug resistant gene | |
| CN104232755A (en) | Tobacco phytophthora LAMP detection primer and rapid detection method thereof | |
| CN104962625A (en) | Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene VIM | |
| CN105219847A (en) | A kind of legionella rapid detection and parting kit and detection method thereof | |
| CN102146453B (en) | Fluorescence quantitative polymerase chain reaction (PCR) detection kit for gene of super-bacteria NDM-1 | |
| CN107828856A (en) | A kind of PCR LF technology for detection Carbapenem-resistant gene KPC and NDM Primer composition and its application | |
| CN107460249A (en) | A kind of primer, probe and kit for being used to detect methicillin-resistant staphylococcus aureus drug resistant gene | |
| CN104962624A (en) | Diagnosis method for quickly detecting bacterial super extended spectrum beta-lactamase drug-tolerant gene PME | |
| CN113416797A (en) | Fluorescent quantitative PCR detection kit for simultaneously detecting 7 types of adenoviruses | |
| CN102417931A (en) | Polymerase chain reaction (PCR) fluorescence detection kit and detection method for candida albicans | |
| CN102181543A (en) | Primer, probe, kit for detecting bla<NDM-1 (New Delhi metallo-Beta-lactamase-1)> gene and detection method thereof | |
| CN109097485A (en) | A kind of kit and its detection method of new quick detection bacterium mcr-1 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151007 |
|
| RJ01 | Rejection of invention patent application after publication |