CN104962622A - Primer group used for detecting locus polymorphism of MTHFR-A1298C genes, method for detecting same and application of primer group - Google Patents
Primer group used for detecting locus polymorphism of MTHFR-A1298C genes, method for detecting same and application of primer group Download PDFInfo
- Publication number
- CN104962622A CN104962622A CN201510324399.3A CN201510324399A CN104962622A CN 104962622 A CN104962622 A CN 104962622A CN 201510324399 A CN201510324399 A CN 201510324399A CN 104962622 A CN104962622 A CN 104962622A
- Authority
- CN
- China
- Prior art keywords
- mthfr
- primer
- snapshot
- gene
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer group used for detecting locus polymorphism of MTHFR-A1298C genes and a method for detecting the same. The method includes: (1), adopting PCR (polymerase chain reaction) to amplify gene segments where MTHFR-A1298C gene detection loci are located, and purifying the gene segments; (2), adopting an SNaPshot method to mini-sequence amplified products, and analyzing a sequencing result. Specifically, a corresponding primer is designed. The method has the advantages of high sensitivity, high accuracy and high precision and is convenient, quick and reliable.
Description
Technical field
The invention belongs to mensuration and the method for inspection technical field of nucleic acid, be specifically related to for the primer sets of MTHFR-A1298C gene locus polymorphic detection, its detection method and application.
Background technology
China is one of country occurred frequently of inborn defect in the world, and annual Fetal malformation quantity accounts for global 20%.Folic acid deficiency is the major cause causing Newborn Birth-defects.Cause body to lack folic acid and have the reason of two aspects: one is that folic acid intake is not enough, two is because heredity (gene) defect causes body to the Utilization ability of folic acid low (folic acid metabolism path obstacle).5, the corresponding enzymic activity that the genovariations such as 10-Methylene tetrahydrofolate reductase (MTHFR), methionine synthetase reductase enzyme (MTRR) cause reduces can prevent homocysteine to be converted into methionine(Met), cause low folic acid mass formed by blood stasis and hyperhomocysteinemiainjury, thus increase Newborn Birth-defects risk or spontaneous abortion equivalent risk.
Homocysteine (Hcy) is a kind of sulfur-containing amino acid in human body, is the intermediate product of Methionine metabolism.In Hcy metabolic process, folic acid and Methylene tetrahydrofolate reductase (MTHFR) play a crucial role, and folic acid and MTHFR are jointly for Hcy metabolism provides methyl donor.When the folate content in body is not enough, or when mthfr gene C677T undergos mutation, Hcy will constantly accumulate in vivo, causes high Hcy mass formed by blood stasis.Methylene tetrahydrofolate reductase (MTHFR) is one of key enzyme of homocysteine metabolism, and there are three kinds of gene types in its 677 site, wild-type CC, heterozygous mutant CT, homozygous mutant TT.Studies have found that, MTHFR C677T sudden change can make enzymic activity obviously decline, and makes the generation of methyl donor not enough, the Hcy metabolic disturbance in body, thus causes the rising of Hcy concentration.Wherein, the activity of CT type is 65% of CC type, and the activity of TT type is only 30% of CC type.Methylene tetrahydrofolate reductase C677T sudden change is the major genetic factors causing high Hcy.Hypertension is exactly H type hypertension with the essential hypertension of homocysteine (namely Hcy plasma concentration is more than or equal to 10 μm of ol/L).Research shows: in state-owned 200,000,000 hyperpietics, wherein 1.5 hundred million is H type hypertension, and it is Chinese cerebral apoplexy main high risk factor occurred frequently that H type hyperpietic accounts for 75%, H type hypertension, and H type hyperpietic cardiocerebrovasculaevents events is 28 times of normal people.H type hyperpietic merges again TT transgenation, and cardiocerebrovasculaevents events risk is increased to 40 times.Early discovery height Hcy mass formed by blood stasis thus can correct in early days high Hcy mass formed by blood stasis, early prevent and treat cardiovascular and cerebrovascular diseases be the direction that people study, and early discovery can be accomplished to MTHFR C677T polymorphic detection, early stage correct high Hcy mass formed by blood stasis, provide a new approach for preventing and treating cardiovascular and cerebrovascular disease early.
Methylene tetrahydrofolate reductase (methylenetetrahydorfolate reductase, MTHFR) be key enzyme in folic acid metabolism process, reduced form folic acid can be changed into 5-methyltetrahydrofolate (5-MTHF), the former is one of important source material of thymidylic acid synthesis, participates in synthesis and the reparation of DNA; The latter is methyl donor main in body, participates in DNA methylation.MTHFR has very important regulating and controlling effect for the synthesis of DNA, activation and reparation, and its dysfunction can cause DNA normal function not maintain.C>T is there is and changes in mthfr gene in 677 sites, Ala222Val amino acid is caused to be replaced, enzymic activity is significantly reduced, to make in body 5,10-methylene tetrahydrofolate (5,10-MTHF) level raises, 5-methyltetrahydrofolate (5-MTHF) level declines thereupon, and then affect folic acid eubolism, and the curative effect of the medicine such as methotrexate, 5-FU and toxic side effect.Methotrexate (methotrexate, MTX) be antifol, Methylene tetrahydrofolate reductase (methylenetetrahydorfolate reductase can be suppressed, MTHFR), play a significant role in the chemotherapy of the kinds of tumors such as acute lymphoblastic leukemia (especially when invading central nervous system), intracranial primary central nervous system lymphoma (primary central nervous system lymphoma, PCNSL), malignant mole, chorioepithelioma, mammary cancer, tumor of pelvic cavity, tumor of head and neck, lung cancer and osteosarcoma.But patient often occurs untoward reaction over the course for the treatment of, comprise gastrointestinal reaction, bone marrow transplantation and hepatic disorder etc.Research finds that the C>T sudden change of mthfr gene the 677th bit base significantly increases the toxic side effect of MTX.5 FU 5 fluorouracil (fluorouracil, 5-FU) be pyrimidine analogue, belong to the one of antimetabolite, enter after in body, the fluoro-2-deoxyuridine of 5--5-monophosphate is transformed under the catalysis of thymidine kinase, covalent complex is formed again with 5,10-MTHF and thymidylate synthetase, thus the synthesis of interference DNA and reparation.5,10-MTHF can be transformed into 5-MTHF by MTHFR, thus participates in Methionine metabolism circulation and DNA methylation.Therefore, the activity of MTHFR directly will affect the concentration of in body 5,10-MTHF, and then affect 5-FU curative effect.Result of study shows, the C>T sudden change of mthfr gene the 677th bit base can cause enzymic activity significantly to decline, thus increases the susceptibility to 5-FU.Therefore, mthfr gene 677C/T polymorphism can be used for instructing the individuation of such medicine to use, to improve the specific aim of clinical treatment and predictable.
To sum up, the polymorphism of detection mthfr gene can be used in the personalized medicines such as clinical guidance 5-FU class, methotrexate and Women of Childbearing Age folic acid supplements, and is significant.
Summary of the invention
The invention provides the primer sets for MTHFR-A1298C gene locus polymorphic detection, present invention also offers the loci polymorphism detection method of MTHFR-A1298C gene, can be used in the personalized medicines such as clinical guidance 5-FU class, methotrexate and Women of Childbearing Age folic acid to supplement, be significant.
Primer sets for MTHFR-A1298C gene locus polymorphic detection provided by the invention is made up of pcr amplification primer and SNaPshot amplimer, and described pcr amplification primer is:
MTHFR-A1298C-Fwd：CAAGGAGGAGCTGCTGAAG(SEQ ID NO.1)，
MTHFR-A1298C-Rev：CATCACTCACTTTGTGACCATT(SEQ ID NO.2)；
Described SNaPshot amplimer is:
SNE-MTHFR-A1298C：GATGTGGGGGGAGGAGCTGACCAGTGAAG(SEQ ID NO.3)。
The present invention also provides the loci polymorphism detection method of MTHFR-A1298C gene, and step is as follows:
(1) pcr amplification MTHFR-A1298C gene test site place gene fragment purifying is adopted;
(2) adopt SNaPshot method to carry out micrometering sequence to amplified production, analyze sequencing result;
Wherein, step (1) described amplification time primer sequence be:
MTHFR-A1298C-Fwd：CAAGGAGGAGCTGCTGAAG(SEQ ID NO.1)，
MTHFR-A1298C-Rev：CATCACTCACTTTGTGACCATT(SEQ ID NO.2)；
The primer sequence used in the described SNaPshot method of step (2) is:
SNE-MTHFR-A1298C：GATGTGGGGGGAGGAGCTGACCAGTGAAG(SEQ ID NO.3)。
Preferably, described in step (1), pcr amplification reaction system is: Q5
tMwarm start surpasses fidelity 2 × Master Mix 12.5 μ L; H
2o 5.5 μ L; Primer 5.0 μ L, template DNA 2.0 μ L; Reaction conditions is: 98 DEG C of 3min; 98 DEG C of 10s; 58 DEG C of 30s; 72 DEG C of 1min; 29 circulations; 72 DEG C of 5min; 25 DEG C of insulations; Wherein, described primer is MTHFR-A1298C.
Preferably, in the sequence of SNaPshot method micrometering described in step (2), SNaPshot pcr amplification reaction system is: SNaPshot pre-reaction mixed solution 1.25 μ L; 5 × sequencing buffer 1.50 μ L; ddH
2o 4.25 μ L; 2.0 μ LSNaPshot primers; 1.0 μ L purified products; Reaction conditions is: 96 DEG C, 10s; 55 DEG C, 5s; 60 DEG C, 30s; 25 circulations; 4 DEG C of insulations; Wherein, described SNaPshot primer is SNE-MTHFR 1298.
The present invention adopts above-mentioned primer and amplification condition can the nucleotide fragments of efficient amplification nucleotide sequence: MTHFR-A1298C.Wherein, the letter adding black increasing in nucleotide sequence is SNP site.
3rd object of the present invention is to provide above-mentioned primer sets and detects for quoting in mthfr gene loci polymorphism reagent in preparation.
4th object of the present invention is to provide the application of above-mentioned primer sets in the polymorphism detecting mthfr gene A1298C.
5th object of the present invention is to provide above-mentioned primer sets in the toxic side effect analyzing methotrexate, analyzes the curative effect of 5-FU, early discovery height Hcy mass formed by blood stasis, analyzes the application in folic acid deficiency reason.
MTHFR-A1298C gene polynorphisms detection method of the present invention has the advantage of high sensitivity, split hair caccuracy and high-accuracy property, is a kind of convenient reliable MTHFR-A1298C gene locus polymorphic detection; Visual result and stable experiment is good.Apply detection method of the present invention and effectively can instruct clinical 5-FU class personalized medicine, early discovery, the high Hcy mass formed by blood stasis of early stage correction can be accomplished; Meanwhile, for Women of Childbearing Age Supplement of folic acid provides gene foundation.
Accompanying drawing explanation
Accompanying drawing is used to provide a further understanding of the present invention, and forms a part for specification sheets, together with embodiments of the present invention for explaining the present invention, is not construed as limiting the invention.In the accompanying drawings:
Fig. 1 is the part sequencer map of the gene amplification product of MTHFRA1298C:A/A of the present invention;
Fig. 2 is the detected result figure that SNaPshot method of the present invention detects MTHFR_A1298C gene pleiomorphism.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is commercially available.
The application's instrument is see table 1.
Table 1 the application tests instrument
The application's agents useful for same is as follows:
Q5
tMwarm start surpasses fidelity 2 × Master Mix, purchased from NEB company, and article No.: M0494L ,-20 DEG C.
embodiment 1
one. adopt place, PCR method augmentation detection site gene fragment
1 sample to be tested DNA extraction
This detection adopts QIAamp DNA Mini Kit test kit to extract peripheral blood DNA, extraction step reference reagent box specification sheets.
reagent prepares
In a, the application, primer sequence is the applicant's designed, designed, and concrete sequence is see table 2, and Invitrogen company produces, and working concentration is 5.0pmol/ μ L; Dry powder, in-20 DEG C of preservations, is valid for one year; Working fluid in 4 DEG C of preservations, validity period half a year; Gene reference sequence number is
SNP site is with reference to NCBI and UCSC database.
The primer sequence during table 2 pcr amplification
B, taking-up Q5
tMwarm start surpasses fidelity 2 × Master Mix, primers, ddH
2o is after room temperature is melted, of short duration centrifugal; Preparation primer: MTHFR A1298C, concussion mixing; Of short duration centrifugal rear for subsequent use;
Reaction system is prepared:
Q5
tMwarm start surpasses fidelity 2 × Master Mix 12.5 μ L
H
2O 5.5μL
Amount to 18 μ L.
Concussion mixing, of short duration centrifugal after, packing 18.0 μ L is to the PCR reaction tubes that marked; Be transferred to sample add primer 5.0 μ L in PCR reaction tubes after and prepare district.This detection uses high-fidelity warm start polysaccharase, therefore, can prepare the reaction system of 18.0 μ L in the course of the work in advance and be stored in-20 DEG C, take out during each use, add 5.0 μ L primers namely can be used for detect, also primer directly can be mixed with polysaccharase, be stored in-20 DEG C for subsequent use.
application of sample increases
The template after 2.0 μ L dilutions is added in point PCR reaction tubes installed; Carry out pcr amplification, amplification condition is as follows: 98 DEG C of 3min; 98 DEG C of 10s; 58 DEG C of 30s; 72 DEG C of 1min; 29 circulations; 72 DEG C of 5min; 25 DEG C of insulations.Obtain nucleotide sequence.Adopt above-mentioned primer and amplification condition can the nucleotide fragments of efficient amplification nucleotide sequence: MTHFR-A1298C.Wherein, the letter adding black increasing in nucleotide sequence is SNP site.
4 pairs of amplified productions carry out micrometering sequence
When DNA profiling copies or transcribes under archaeal dna polymerase, primer, four kinds of monodeoxy base existence conditions, if introduce four kinds respectively in proportion with fluorescently-labeled pair of deoxidation base (ddNTP) in reactive system, as long as two deoxidation base mixes the end of the chain, this chain just stops extending, and the fragment that the end of the chain mixes monodeoxy base can continue to extend.Just synthesizing with universal primer in so every tube reaction system is 5 ' end, is the nucleic acid fragment that 3 ' a series of length of holding do not wait with two deoxidation base.After reaction terminating, carry out capillary electrophoresis, to be separated nucleic acid fragment (length neighbor only differs from a base) different in size, according to two deoxidation bases that fragment 3 ' is held, the base just can reading synthesis fragment successively puts in order.
Fluorescent mark single-basic extension technology (SNaPshot, SNE) be applying biological company of the U.S. (ABI) exploitation, it is a kind of typing method based on fluorescent mark single-basic extension principle, also micrometering sequence is claimed, refer at one containing Sequenase, four kinds of fluorescent mark ddNTP, the different lengths of next-door neighbour's polymorphic site 5' end extends in the reaction system of primer and PCR primer template, namely primer extension base stops, after ABI sequenator detects, the SNP site that this extension products is corresponding is determined according to the shift position at peak, the base kind of mixing can be learnt according to the color at peak, thus determine the genotype of this sample.Be generally used for 10 ~ 30 SNP site analyses.Have that somatotype is accurate, flux is high, by the restriction of SNP site polymorphism characteristic, not by features such as number of samples restrictions, usually adopt SNaPshot Multiplex Kit to detect.
The present invention, after the gene fragment of application pcr amplification detection site place, adopts fluorescent mark single-basic extension technology (SNaPshot, SNE) to detect in conjunction with capillary electrophoresis technique.
During micrometering sequence, primer is SNE-MTHFR 1298.The present invention uses SNaPshot Multiplex Kit test kit to carry out micrometering sequence, and according to SNaPshot Multiplex Kit operation instructions, gets out detection reagent.
amplified production purifying
Get 2.0 μ L ExoSAP-IT reagent and 3.0 μ L ddH
2o prepares enzyme mixture, adds pcr amplification product 2.0 μ L, mixes micro-centrifugal; Endonuclease reaction is carried out, program: 37 DEG C, 15 min in PCR instrument; 80 DEG C, 15min; 4 DEG C, insulation.
amplification
According to system configurations shown in table 3 after purifying terminates, the sequencing primer adding 2.0 μ L afterwards, to respective tube, finally adds the purified product of 1.0 μ L, carries out pcr amplification by following program: 96 DEG C, 10s; 55 DEG C, 5s; 60 DEG C, 30s; 25 circulations; 4 DEG C of insulations.
Table 3 PCR reacts amplification system
4.3 SNE product purifications
In SNaPshot PCR primer, add 1.0 μ L SAP enzymes, react according to following program: 37 DEG C, 60min; 75 DEG C, 15min; 4 DEG C, insulation.After completion of the reaction, take out product and be stored in 4 DEG C.Carry out SNaPshot analysis immediately, as can not, then should complete subsequent analysis being no more than in 24 hours.
electrophoresis
The molecular weight standard used is GeneScan
tM-120LizTM Size Standards, adopts Genetic Analyser to carry out electrophoresis and analysis (i.e. capillary electrophoresis apparatus) model is ABI 3500XL DX.
interpretation of result
Use SNaPshot method in GENEMAPPERID V4.1 software to analyze, Fig. 1 is sample analysis result, is specially: MTHFR A1298C:A/A.
Analyze reporting the result, specific as follows:
(1) gene that relates to of folic acid Utilization ability Genetic Detection project and site as shown in table 4.
Table 4
| Gene | Site | Genotype | Genotype is difference proportion in Chinese population |
| MTHFR | A1298C | AA(is normal); AC(is normal); CC(risk) | 66%；31%； 3% |
(2) relation of mthfr gene type and 5-FU medication is see table 5.
Table 5
Therefore, apply detection method of the present invention and effectively can instruct clinical 5-FU class personalized medicine, early discovery, the high Hcy mass formed by blood stasis of early stage correction can be accomplished; Meanwhile, for Women of Childbearing Age Supplement of folic acid provides gene foundation.
The present invention is by being optimized pleiomorphism detecting method: select first to adopt SNaPshot method to carry out the method for micrometering sequence again by place, PCR method augmentation detection site gene fragment, verification and measurement ratio is high, highly sensitive, visual result and stable experiment is good.Then a series of actual conditions is optimized: during pcr amplification, in primer, amplification system and reaction conditions, SNaPshot method, use primer and amplification system and reaction conditions to be all optimized.
embodiment 2 pleiomorphism detecting method proof test of the present invention
ARMS method or Sanger sequencing is adopted to verify to polymorphic detection result of the present invention.Wherein, Sanger sequencing uses BigDye Terminator test kit to check order.BigDye Terminator test kit is called for short BDT.BDT v3.1 is the standard reagent box of DNA sequencing, is applicable to the order-checking of all types DNA profiling, and having more advantage for long segment order-checking, is the gold standard of current detection in Gene Mutation.
pleiomorphism detecting method of the present invention is verified
1 main agents and instrument as follows:
1.1 primers (Primers)
This detection the primer by this laboratory designed, designed (see table 2), PCR primer sequence see table 2, all primer sequences all by the comparison of UCSC database, without known SNP site.
main agents
This detection DNA extraction adopts Qiagen Products TIANamp Blood DNA Kit, article No. DP318;
Pcr amplification adopts NEB Products Q5
tMwarm start surpasses fidelity 2 × Master Mix, article No.: M0494L;
The order-checking of SNaPshot single-basic extension adopts ABI Products SNaPshot Multiplex Kit, article No. 4223151;
Operation steps is with reference to respective process specifications.
key instrument is see table 6.
Table 6 key instrument
2 detection specificity(Analytical Specificity)
2.1 primer specificity (Specificity Of Primers)
1) each primer carries out Blasting in UCSC, and amplified fragments covers detection site MTHFR C677T and MTHFR A1298C respectively, without other homologous gene.
2) in use table 2, pcr amplification primer increases and Sanger order-checking to detection sample respectively, and sequencing result shows, and each primer amplification fragment and mthfr gene reference sequences coincide.
3) use SNaPshot PCR primer in table 2, result shows, and the base that the relative position at each product peak and sequencing reaction mix conforms to expection.
detection specificity (Analytical Specificity)
The detection specificity of this detection is defined as negative match-rate.
This detection carries out the detection of SNaPshot sequencing to 21 routine samples altogether, and detected result all adopts ARMS method or Sanger sequencing to verify.MTHFR A4298C site SNaPshot sequencing detects sample (positive) totally 12 examples (as shown in table 7) without sudden change, and the result shown with Sanger sequencing conforms to.The detection sensitivity of this detection is 100%.
Table 7 detection specificity experimental data
3 detection sensitivities (Analytical Sensitivity)
1) detection sensitivity of this detection is defined as positive coincidence rate.
This detection carries out the detection of SNaPshot sequencing to 21 routine samples altogether, detected result all adopts ARMS method or Sanger sequencing to carry out verifying that MTHFR A1298C site SNaPshot sequencing detects sample (positive) totally 9 examples (as shown in table 8) of sudden change, with Sanger sequencing show result conform to.The detection sensitivity of this detection is 100%.
Table 8 detection sensitivity experimental data
4 accuracy (Accuracy)
This accuracy in detection is defined as the consistence of different methods detected result.
21 routine samples check order through SNaPshot method and Sanger or ARMS method detects, and different methods detected result is consistent, as shown in table 10.The accuracy of this detection is 100%.
Table 10 accuracy experimental data
5 precision (Precision)
The precision of this detection is defined as carries out to sample the ability that duplicate detection obtains same result.
This detection has been carried out between personnel, simultaneous test (table 11) between the different hole of different time, different instrument, same sample, and all results all show unanimously, and this detection precision is 100%.
Table 11 betweenrun precision experimental data
6 clinical specificities (Clinical Specificity)
MTHFR is the key enzyme in folic acid metabolism, plays an important role at maintenance DNA normal methyl group and the process such as Nucleotide de novo synthesis and DNA reparation.The common pleomorphism site of mthfr gene is A1298C(rs1801131).In Chinese population, mthfr gene 1298 site A/A, A/C, C/C genotype frequency difference 66%, 31%, 3%.
clinical Sensitivity (Clinical Sensitivity)
The polymorphism in MTHFR 1298 site is the important factor affecting MTHFR enzymic activity and thermostability, and then the individual susceptibility to 5 FU 5 fluorouracil of impact.Result of study shows, 1298 AA genotype carriers chemotherapy are efficient is also obviously better than AC and CC genotype carriers.
The acceptable standard of result of this checking and net result are summed up as shown in table 12.
The acceptable standard of result of this checking of table 12 and net result synopsis
8 clinical applications (Clinical Usage)
There is provided for the patient of the pharmacological agent such as 5 FU 5 fluorouracil or methotrexate need be used and use Drug Sensitivity and toxicity evaluation.
conclusion (Conclusions)
Certificate parameter of the present invention can accept, and the result shows, and method of the present invention can be used for detecting mthfr gene A1298C gene pleiomorphism.
Last it is noted that the foregoing is only the preferred embodiments of the present invention, be not limited to the present invention, although with reference to previous embodiment to invention has been detailed description, for a person skilled in the art, it still can be modified to the technical scheme described in foregoing embodiments, or carries out equivalent replacement to wherein portion of techniques feature.Within the spirit and principles in the present invention all, any amendment done, equivalent replacement, improvement etc., all should be included within protection scope of the present invention.
<110> Guangzhou Kingmed Center for Clinical Laboratory Co., Ltd.
<120> is used for the primer sets of MTHFR-A1298C gene locus polymorphic detection, its detection method and application
<130> 3
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> artificial sequence
<400> 1
caaggaggag ctgctgaag 19
<210> 2
<211> 22
<212> DNA
<213> artificial sequence
<400> 2
catcactcac tttgtgacca tt 22
<210> 3
<211> 29
<212> DNA
<213> artificial sequence
<400> 3
gatgtggggg gaggagctga ccagtgaag 29
Claims (7)
1. for the primer sets of MTHFR-A1298C gene locus polymorphic detection, it is characterized in that: be made up of pcr amplification primer and SNaPshot amplimer, described pcr amplification primer is:
MTHFR-A1298C-Fwd：CAAGGAGGAGCTGCTGAAG，
MTHFR-A1298C-Rev：CATCACTCACTTTGTGACCATT；
Described SNaPshot amplimer is:
SNE-MTHFR-A1298C：GATGTGGGGGGAGGAGCTGACCAGTGAAG。
2.MTHFR-A1298C the loci polymorphism detection method of gene, is characterized in that: step is as follows:
(1) pcr amplification MTHFR-A1298C gene test site place gene fragment purifying is adopted;
(2) adopt SNaPshot method to carry out micrometering sequence to amplified production, analyze sequencing result;
Wherein, step (1) described amplification time primer sequence be:
MTHFR-A1298C-Fwd：CAAGGAGGAGCTGCTGAAG，
MTHFR-A1298C-Rev：CATCACTCACTTTGTGACCATT；
The primer sequence used in the described SNaPshot method of step (2) is:
SNE-MTHFR-A1298C：GATGTGGGGGGAGGAGCTGACCAGTGAAG。
3. method according to claim 2, is characterized in that: described in step (1), pcr amplification reaction system is: Q5
tMwarm start surpasses fidelity 2 × Master Mix 12.5 μ L; H
2o 5.5 μ L; Primer 5.0 μ L, template DNA 2.0 μ L; Reaction conditions is: 98 DEG C of 3min; 98 DEG C of 10s; 58 DEG C of 30s; 72 DEG C of 1min; 29 circulations; 72 DEG C of 5min; 25 DEG C of insulations; Wherein, described primer is MTHFR-A1298C.
4. method according to claim 2, is characterized in that: in the sequence of SNaPshot method micrometering described in step (2), SNaPshot pcr amplification reaction system is: SNaPshot pre-reaction mixed solution 1.25 μ L; 5 × sequencing buffer 1.50 μ L; ddH
2o 4.25 μ L; 2.0 μ LSNaPshot primers; 1.0 μ L purified products; Reaction conditions is: 96 DEG C, 10s; 55 DEG C, 5s; 60 DEG C, 30s; 25 circulations; 4 DEG C of insulations; Wherein, described SNaPshot primer is SNE-MTHFR 1298.
5. primer sets according to claim 1 detects the application be used in mthfr gene loci polymorphism reagent in preparation.
6. the application of primer sets according to claim 1 in the polymorphism detecting mthfr gene A1298C.
7. primer sets according to claim 1 is analyzing the toxic side effect of methotrexate, analyzes the curative effect of 5-FU, early discovery height Hcy mass formed by blood stasis, analyzes the application in folic acid deficiency reason.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510324399.3A CN104962622A (en) | 2015-06-15 | 2015-06-15 | Primer group used for detecting locus polymorphism of MTHFR-A1298C genes, method for detecting same and application of primer group |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510324399.3A CN104962622A (en) | 2015-06-15 | 2015-06-15 | Primer group used for detecting locus polymorphism of MTHFR-A1298C genes, method for detecting same and application of primer group |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104962622A true CN104962622A (en) | 2015-10-07 |
Family
ID=54216707
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510324399.3A Pending CN104962622A (en) | 2015-06-15 | 2015-06-15 | Primer group used for detecting locus polymorphism of MTHFR-A1298C genes, method for detecting same and application of primer group |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104962622A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1451296A (en) * | 2002-04-17 | 2003-10-29 | 山口喜久二 | Royal jelly refining device |
| CN101760526A (en) * | 2008-12-26 | 2010-06-30 | 海南主健生物医学科技有限公司 | Kit for quantitative guidance of folic acid supplement dosage before and during pregnancy |
| CN102676645A (en) * | 2011-11-08 | 2012-09-19 | 苏州市立医院 | Kit for detecting folic acid utilization ability gene and detection method thereof |
| CN104131087A (en) * | 2014-07-11 | 2014-11-05 | 武汉千麦医学检验所有限公司 | Kit for genotyping folate metabolism gene |
-
2015
- 2015-06-15 CN CN201510324399.3A patent/CN104962622A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1451296A (en) * | 2002-04-17 | 2003-10-29 | 山口喜久二 | Royal jelly refining device |
| CN101760526A (en) * | 2008-12-26 | 2010-06-30 | 海南主健生物医学科技有限公司 | Kit for quantitative guidance of folic acid supplement dosage before and during pregnancy |
| CN102676645A (en) * | 2011-11-08 | 2012-09-19 | 苏州市立医院 | Kit for detecting folic acid utilization ability gene and detection method thereof |
| CN104131087A (en) * | 2014-07-11 | 2014-11-05 | 武汉千麦医学检验所有限公司 | Kit for genotyping folate metabolism gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104962621A (en) | Primer group used for detecting locus polymorphism of MTHFR genes and MTRR genes, method for detecting same and application of primer group | |
| CN103710460B (en) | Test kit of detection by quantitative EGFR genetic mutation and uses thereof | |
| CN106554995B (en) | Method and kit for detecting gene related to tumor chemotherapy personalized medicine | |
| CN108004301A (en) | Gene target region enrichment method and build storehouse kit | |
| CN107075730A (en) | The identification of circle nucleic acid and purposes | |
| CN101092644A (en) | Quick detecting gene mutation correlative to curative effect of non small-cell carcinoma of the lung | |
| CN107723354B (en) | Multiplex PCR (polymerase chain reaction) primer, kit and method for detecting non-small cell lung cancer oncogene mutation based on high-throughput sequencing | |
| CN109182501A (en) | A kind of folic acid metabolism genetic polymorphism detection primer and kit | |
| CN105671187B (en) | Group of genes for molecular typing of head and neck squamous cell carcinoma and application thereof | |
| CN109306379A (en) | For detecting primer, detection method and the kit of human EGFR gene T790M mutation | |
| CN110885883A (en) | DNA reference standard and application thereof | |
| CN109234370B (en) | MUT gene mutation detection kit | |
| CN108728537A (en) | A kind of primer, kit and the method for 21 exon L858R site mutations of detection Human epidermal growth factor receptor gene | |
| CN102399872B (en) | Method and kit for detecting mutation of K-ras gene | |
| CN108728536A (en) | Primer, probe, PCR reaction solution and the kit of Human epidermal growth factor receptor gene T790M site primers | |
| CN104928378A (en) | Primer combination used for MTHFR-C677T genetic locus polymorphic detection, MTHFR-C677T genetic locus polymorphic detection method and application | |
| CN104928381A (en) | Primer combination used for MTHFR genetic locus polymorphic detection, MTHFR genetic locus polymorphic detection method and application | |
| CN104962622A (en) | Primer group used for detecting locus polymorphism of MTHFR-A1298C genes, method for detecting same and application of primer group | |
| CN104805178A (en) | TACC3-FGFR3 fused gene sequence and its detection method and use in bladder cancer detection | |
| CN109295177A (en) | A kind of micro mutation of human EGFR gene is enriched with pretreated primer, method and kit | |
| CN109306374A (en) | For detecting primer, detection method and the kit of mankind PIK3CA gene E545K mutation | |
| CN110438224B (en) | Primer, kit and detection method for UGT1A1 gene polymorphism detection | |
| CN110093419B (en) | Application of circular RNA, kit and pharmaceutical composition and application thereof | |
| CN112522375A (en) | Detection kit and detection method for gene mutation of folate metabolism related molecular marker | |
| CN112029833A (en) | Rapid identification method of CTNNB1 gene mutation for tumor organoid culture condition selection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151007 |
|
| RJ01 | Rejection of invention patent application after publication |