CN104926943B - Apoptosis element combined peptide and its application in antitumor drug is prepared - Google Patents
Apoptosis element combined peptide and its application in antitumor drug is prepared Download PDFInfo
- Publication number
- CN104926943B CN104926943B CN201510104548.5A CN201510104548A CN104926943B CN 104926943 B CN104926943 B CN 104926943B CN 201510104548 A CN201510104548 A CN 201510104548A CN 104926943 B CN104926943 B CN 104926943B
- Authority
- CN
- China
- Prior art keywords
- apoptosis
- apoptosis element
- peptide
- combined peptide
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
Application the invention discloses apoptosis element combined peptide and its in antitumor drug is prepared.A kind of apoptosis element combined peptide of the present invention, it is characterised in that be made of elements below:(1) two nuclear localization signals of apoptosis element 82 88,111 121;(2) hydrophobic amino acid of apoptosis element 33 46 is rich in area, which is placed between two nuclear localization signals;And (3) transduction peptide, the aminoterminal of the polypeptide formed positioned at apoptosis element nuclear localization signal and hydrophobic region sequence, induction combined peptide enters cytoplasm during for intravenous administration.Preferably, the apoptosis element combined peptide, its amino acid sequence is as shown in SEQ ID NO.1.It is demonstrated experimentally that the apoptosis element combined peptide has the activity of the rush apoptosis of tumor cells of higher compared to apoptosis element, and molecular weight is small, safe to use, while can reduce synthetically produced cost.
Description
Technical field
The present invention relates to a kind of with the apoptosis element combined peptide of antitumor action and its application, belong to polypeptide drugs field.
Background technology
Apoptosis element is the pathogenic protein of chicken anaemia virus, is made of 121 amino acid, molecular weight 14KD.Apoptosis element passes through
Inducing host cell apoptosis and cause a disease.Apoptosis element inducing cell apoptosis has selectivity to cell, i.e., only induction tumour cell withers
Die, without causing normal apoptosis.The characteristic of this selective induction apoptosis of tumor cells of apoptosis element makes it possible into
For a kind of safe targeting antineoplastic medicine thing.
An apoptosis element inducing apoptosis of tumour cell does not cause normal apoptosis, has with its own structure and cellular localization
Close.Known apoptosis element 82-88,111-121 amino acids form two sections of nuclear localization signals, can guide apoptosis element by cytoplasm into
Enter nucleus.97-105 amino acids form out nuclear signal, the apoptosis element into core can be made to return to cytoplasm, and be positioned at cell
Matter.The threonine of 108, by CDK2 cycle dependent kinase phosphorylations in tumour cell, uses nuclear signal inactivation, apoptosis element
Stay in nucleus;CDK2 activity is low in normal cell, and 108 threonines are not phosphorylated, and going out nuclear signal can guide apoptosis plain
Go out core, be positioned at cytoplasm.33-46 are rich in hydrophobic amino acid, contribute to apoptosis element to form polymerization by hydrophobic forces
Body is combined with other protein.
Apoptosis element is positioned at the precondition that nucleus is apoptosis element inducing apoptosis of tumour cell, but is not unique conditional.
Apoptosis element is manually imported to the nucleus of normal cell can not cause normal apoptosis.Heat shock protein 70 is that a kind of heat should
Shock protein, polycyclic save land can resist Apoptosis in all apoptosis pathway.The result of study of inventor confirms, withers
Element is died by being combined with the Binding characteristic on Heat Shock Protein 70 Genes, is prevented the transcription of heat shock protein gene, is suppressed heat
The irritability expression of shock protein 70.This discovery satisfactorily discloses apoptosis element of knowing clearly and only causes apoptosis of tumor cells, does not induce
The mechanism of normal apoptosis:Apoptosis element is by suppressing the irritability induced expression Apoptosis of heat shock protein 70.Heat shock
The emergency expression of protein 70 only starts under stress situation.Tumour cell has the response expression of heat shock protein 70, normal thin
Irritability in born of the same parents there is no heat shock protein 70 is expressed, therefore the plain inducing apoptosis of tumour cell of apoptosis is without causing normal cell
Apoptosis;Transcription is completed in nucleus, and apoptosis element is combined the transcription for preventing Heat Shock Protein 70 Genes with Binding characteristic
Nucleus must be first positioned at.
The protein of 121 amino acid compositions, molecular weight is not very too big, but as a kind of heterologous protein prolonged application still
With some potential safety problems.The result of study of inventor early period according to the present invention, apoptosis element and Heat Shock Protein 70 Genes
It is the plain key link for suppressing heat shock protein 70 response expression of apoptosis that Binding characteristic, which combines, as can screening, determining apoptosis element
The sequence combined with Binding characteristic on Heat Shock Protein 70 Genes, group is combined into by itself and the function fragments such as nuclear localization signal
Close peptide, it would be possible to keep even improving the activity of the rush apoptosis of tumor cells of apoptosis element, improve the security of its medication, and
Reduce synthetically produced cost.
The content of the invention
It is an object of the present invention to providing a kind of apoptosis element combined peptide, which can improve rush tumour cell and wither
The activity died, and with the features such as safety, use cost is low.
The second object of the present invention is to provide purposes of the apoptosis element combined peptide in antitumor drug is prepared.
The purpose of the present invention is what is realized by following technological means:
1st, the nuclear localization signal of apoptosis element 82-88 and 111-121 is determined, and apoptosis element is combined with Binding characteristic
Sequence.
Inventor proves that apoptosis element two fragments of 82-88,111-121 are apoptosis element and heat with gel retardation assasy
The sequence that Binding characteristic on 70 gene of shock protein combines, the result is shown in Figure 1.The two fragments previously have proven to wither
The nuclear localization signal of element is died, so two fragments of apoptosis element 82-88,111-121 are both nuclear localization signal and apoptosis element and heat
Shock element binding fragment, has dual-use function.
2nd, the hydrophobic amino acid of apoptosis element 33-46 can promote the polymerization of nuclear localization signal oligomer rich in area (LRS), carry
The ability that high nuclear localization signal is combined with Binding characteristic.
Between the hydrophobic region sequences of 33-46 are connected to two nuclear localization signals, the polymerization of nuclear localization signal oligomer can be promoted.
This polymerization improves the ability that nuclear localization signal is combined with Binding characteristic, and experimental result is shown in Fig. 2.
3rd, the amino acid sequence of apoptosis element combined peptide is determined.The sequence is made of elements below:(1) apoptosis element 82-88,
Two nuclear localization signals of 111-121.Nuclear localization signal ensures that combined peptide into nucleus, is combined after entering core with Binding characteristic
Prevent the irritability transcription of heat shock protein 70.(2) hydrophobic amino acid of apoptosis element 33-46 is rich in area, which is placed in
Between two nuclear localization signals, promote the formation of nuclear localization signal oligomer, enhancing nuclear localization signal is combined with Binding characteristic
Ability.(3) transduction peptide, in the polypeptide aminoterminal joint transduction peptide that apoptosis element nuclear localization signal and hydrophobic region sequence form, is protected
Combined peptide, which is can induce, when demonstrate,proving intravenous administration enters cytoplasm.
In the present invention, it is preferred to, the apoptosis element combined peptide, its amino acid sequence is as shown in SEQ ID NO.1.
4th, combined peptide is better than the pro-apoptosis bioactivity of kinds of tumor cells apoptosis element, can be used for tumour as antitumor drug
Treatment.
MTT experiment and the result of Apoptosis by Flow Cytometry experiment all confirm that combined peptide is to kinds of tumor cells
Propagation have inhibitory action, and the effect to glioma is better than other tumours.With Flow cytometry apoptosis element and
Combined peptide promotees U87 human glioma cells the effect of apoptosis, and the 24 U87 apoptosis rates that inducing peptide is combined when small are 35.83%,
The apoptosis rate of TAT- apoptosis element induction is 9.35% (see Fig. 3);48 apoptosis rates that inducing peptide is combined when small are 69.10%, TAT-
The apoptosis rate of apoptosis element induction is 29.90%, sees Fig. 4.To C 6 glioma cell of rat, apoptosis rate that combined peptide 48 induces when small
Apoptosis rate for the element induction of 90.8%, TAT- apoptosis is 22.8%, sees Fig. 5.It is and small to HepG2 human liver cancer cells, combined peptide 48
When the apoptosis rate that induces there was only the apoptosis rate 23.48% of 40.16%, TAT- apoptosis element induction, see Fig. 6.It is big with combined peptide treatment
The subcutaneous glioma of mouse, treatment group tumors weight are both less than control group, and necrosis region occurs in treatment group, sees Fig. 7, Fig. 8.
Therefore, further, the answering in antitumor drug is prepared the invention also provides the apoptosis element combined peptide
With.
Brief description of the drawings
Fig. 1 detects apoptosis element nuclear localization signal and Binding characteristic combination result for gel retardation assasy;
Nuclear localization signal 1, nuclear localization signal 2, negative control are followed successively by from left to right
Fig. 2 is that gel retardation assasy detects the knot that hydrophobic sequence makes nuclear localization signal be combined after polymerizeing with Binding characteristic
Fruit;
Negative control, the nuclear localization signal oligomer of hydrophobic sequence polymerization, apoptosis element are followed successively by from left to right;
Fig. 3 is induction people's U87 glioma cell apoptosis experimental results when apoptosis is plain, combined peptide 24 is small;
Fig. 4 is induction people's U87 glioma cell apoptosis results when apoptosis is plain, combined peptide 48 is small;
Fig. 5 is induced rat C6 glioma cell apoptosis results when apoptosis is plain, combined peptide 48 is small;
Fig. 6 is induction people's HepG2 hepatoma cell apoptosis results when apoptosis is plain, combined peptide 24 is small;
Fig. 7 treats subcutaneous rat glioma experimental result (balance display tumor weight) for combined peptide;
Fig. 8 is the pathological change that combined peptide treats nude mice by subcutaneous glioma;
Upper diagram combined peptide suppresses the invasion and attack of tumour cell, and lower diagram combined peptide causes tumor tissue necrosis;
Fig. 9 is the amino acid sequence of TAT- apoptosis element.
Embodiment
The invention will now be further described with reference to specific embodiments, and the advantages and features of the present invention will be with specific implementation
The description of example is apparent.But these embodiments are only exemplary, do not form any restrictions to the scope of the present invention.Ability
Field technique personnel should be understood that without departing from the spirit and scope of the present invention can be to technical scheme and details
Form is modified or replaced, but these modifications and replacement are each fallen within the scope of protection of the invention.
1 apoptosis of embodiment element and the screening of Binding characteristic binding sequence and determine
According to the Binding characteristic sequence synthetic dna probe of Heat Shock Protein 70 Genes, particular sequence is as follows, wherein including
Three heat shock factor binding sequence NGAAN, 5' ends biotin labelings, are synthesized and are marked by Shanghai life work.
5’CAGTGAATCCCAGAAGACTCTGGAGAGTTCTG 3’
3’GTCACTTAGGGTCTTCTGAGACCTCTCAAGAC 5'
KitChemiluminescent EMSA Kit (chemiluminescence detection EMSA kits) are purchased
From Thermo, chemoluminescence method EMSA kits --- purchased from the green skies.The side that gel retardation assasy is provided by two kinds of kits
Method operates.As a result two nuclear localization signals are combined with Binding characteristic probe, but binding ability is weaker, sees Fig. 1.It will wither
The LRS sequences for dying element are inserted among two nuclear localization signals, and nuclear localization signal can be promoted to form oligomer, enhancing nuclear location letter
Number ability combined with Binding characteristic, is shown in Fig. 2.The nuclear localization signal that result of study discloses apoptosis element is on apoptosis element and DNA
The sequence that heat shock Yuan Jian Knot are closed, LRS sequences can strengthen the combination of nuclear localization signal and Binding characteristic.
According to the amino acid sequence of apoptosis element design apoptosis element combined peptide, its amino acid sequence as shown in SEQ ID NO.1,
By Shanghai, Qiang Yao companies synthesize.
2 Flow cytometry apoptosis element combined peptide inducing apoptosis of tumour cell of embodiment
1st, cell culture:
U87 cells, C6 cells, HepG2 cells are all adherent growth cells, and cultural method is the same as common attached cell.
Per 25cm2Blake bottle adds 5ml (containing 10%FBS, 1% dual anti-) DMEM cultures, and observation cell sticks bottom wall and state
Well, 2.5ml PBS are added and washes attached cell twice.
Unnecessary digestive juice, cell dissociation 30-60s are discarded after covering cell face by 500ul/ bottles plus 0.25% pancreatin digestive juice
When, Microscopic observation cell rounding brightens.
The DMEM for adding (containing 10%FBS, 1% dual anti-) terminates digestion, 4ml nutrient solutions/bottle (primary cell is 3ml/ bottles),
Gently cell is blown and beaten and is mixed, spread six orifice plates by 2ml cell suspensions/hole (is counted with cell counting count board at this time:Cell number is 3~7
×105A/ml).
It is put into 37 DEG C of CO2Incubator culture after its adherent (next day can be adherent) afterwards dosing.
2nd, dosing, collection cell
N-terminal adds TAT- apoptosis plain (amino acid sequence is shown in Fig. 9) and apoptosis element combined peptide (the SEQ ID NO.1 institutes of transduction peptide
Show) adding consistency be 100ug/ml.15ml centrifuge tubes are transferred to when dosing 24 is small and by cell culture fluid when 48 is small, are used
2.5mlPBS/ washes in hole attached cell, and washing lotion is recycled to 15ml centrifuge tubes;It is thin with 0.25% pancreatin digestive juices of 500ul/hole digestion
Born of the same parents, the cell culture fluid (10%FBS, 1% dual anti-) that 2ml is added per hole terminate digestion, the cell suspension blown and beaten also are turned
Move to 15ml centrifuge tubes;1ml PBS are added with all cells in recovery holes in per hole, are transferred in 15ml centrifuge tubes.
1500r/min, centrifuges 5min, collects cell, and every centrifuge tube adds 500ul PBS and cell is gently resuspended, takes
20ul cell suspensions are counted with cell counting count board.
Take 0.5~1 × 106A cell is into new centrifuge tube, 1500r/min, centrifuges 5min, is added in cell precipitation
195ulAV-FITC combination buffers, are gently resuspended cell and (add 200ul in cont compensation pipes, added in PI Dan Yangguan
190ul), 5ulAV-FITC dyeing liquors (except cont compensation pipe and PI Dan Yangguan) are added, room temperature (20~25 DEG C) lucifuge is incubated
1500r/min after 10min, centrifuges 5min, abandons supernatant (cont compensation pipe and PI Dan Yangguan do not have to centrifugation), respectively manages (except cont
Compensation pipe and PI Dan Yangguan) 190ulAV-FITC combination buffers are added, cell is gently resuspended, each pipe (is managed except cont is compensated
With AV Dan Yangguan) add 10ulPI dyeing liquors (ice bath lucifuge).
(every Guan Kejia 150ulPBS are sufficiently large to ensure measurement volume) flow cytometer detection is withered after cell filtration cloth
Die.
Flow cytometry U87, C6/HepG2 Apoptosis as a result, seeing Fig. 3-6.24 it is small when the element induction of TAT- apoptosis
U87 human glioma cells apoptosis rate be 9.35%, apoptosis element combined peptide is 35.83%, 48 it is small when the element induction of TAT- apoptosis
U87 human glioma cells apoptosis rate is 29.90%, and apoptosis element combined peptide is 69.10%.48 it is small when the element induction of TAT- apoptosis C6
Rat Glioma cells apoptosis rate is 22.80%, and apoptosis element combined peptide is 90.80%.48 it is small when the element induction of TAT- apoptosis people
HepG2 hepatoma cell apoptosis rate is 23.48%%, and apoptosis element combined peptide is 40.16%.Either U87 human glioma cells, C6
Rat Glioma cells or HepG2 human liver cancer cells, the apoptosis activity of apoptosis element combination inducing peptide are both greater than TAT- apoptosis element.
3 apoptosis element combined peptide of embodiment tests nude mice by subcutaneous U87 Glioma Models treatment of animals
Experiment material
1 experimental drug:
1) apoptosis element combined peptide:(shown in SEQ ID NO.1, being synthesized by Shanghai Qiangyao Biotechnology Co., Ltd.):Take
10mg combined peptides are dissolved in 10ml physiological saline, and the filtering of concentration 1mg/ml, 0.22um filter, is stored in -20 DEG C.
2)PBS:8g NaCl、0.2g KCl、0.2g Na2HPO4, 2.9g KH2PO4It is dissolved in 1L distilled water, autoclaving
Afterwards, with the filtering with microporous membrane of 0.22ul, 4 DEG C of preservations are placed in
3) pancreatin digestive juice:
4) physiological saline:
5) cell culture fluid DMEM:
6) calf serum:
7) it is dual anti-:
8) 4% chloraldurate:
2nd, experimental animal:Wistar rats, male, weight 200g or so:The attached Second Academy of Harbin Medical University is purchased to move
Thing room
3rd, C6 glioma cells:Heredity teaching and research room of Harbin Medical University presents
Experimental procedure:
1st, cell culture:
C 6 glioma cell of rat is in DMEM nutrient solutions (PURO 2ug/ml) 50cm of 15% serum2In glass blake bottle,
It is placed in 37 DEG C, 5% CO2Incubator culture, routinely changes liquid passage, when cell fills 80% or so, second day stand-by.
2nd, subcutaneous Glioma Model:
1) Preparatory work of experiment:75% alcohol, blood cell tally, cell PBS, chloraldurate, 1ml syringes, sterilizing
Operating table and operation special equipment, the ultraviolet disinfection 12h in aseptic operating platform;
2) intraperitoneal anesthesia rat:Anaesthetized according to 3ml/kg dosage, after anesthesia, belly unhairing, 75% alcohol disinfecting
3) tumor inoculation:Take the logarithm the cell in raw growth period, conventional centrifugal counts, and PBS liquid cleans twice, and cell is made and hangs
Liquid, concentration 2*107/ ml, 0.4% platform expect blue staining cell activity>95%.500ul suspensions are drawn with 1ml syringes, it is male
Property wistar rat abdomens are subcutaneously slowly injected, and let the acupuncture needle remain at a certain point after injection, and close observation rat is into knurl situation.
3rd, observe and record and be grouped, be administered
Rat body weight and tumor size are measured since modeling second day, according to the size of tumour, quality judge modeling into
Whether work(.
Modeling has five rats to have tumour generation for second day, and subendothelial knurl volume persistently increases within five days.By 5 model mouses with
Machine is divided into 2 groups, and 1,3, No. 4 mouse is test group, and the apoptosis element combined peptide 50ul of 2mg/ml is injected in daily tumor tissue, is used in conjunction 10
My god.2nd, No. 5 mouse are control group, injecting normal saline 50ul in daily tumor tissue.The next day of last dose puts to death mouse.Balance claims
Take knurl weight and make pathologic finding, the result is shown in Fig. 7 and Fig. 8.
Claims (3)
1. a kind of apoptosis element combined peptide, it is characterised in that be made of elements below:
(1) two nuclear localization signals of apoptosis element 82-88,111-121;
(2) hydrophobic amino acid of apoptosis element 33-46 is rich in area, which is placed between two nuclear localization signals;And
(3) transduction peptide, the aminoterminal of the polypeptide formed positioned at apoptosis element nuclear localization signal and hydrophobic region sequence, for intravenous administration
When induction combined peptide enter cytoplasm;
The amino acid sequence of the apoptosis element combined peptide is as shown in SEQ ID NO.1.
2. application of the apoptosis element combined peptide in antitumor drug is prepared described in claim 1.
3. application as claimed in claim 2, it is characterised in that apoptosis element combined peptide is higher than it to the antitumor activity of glioma
His tumour.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510104548.5A CN104926943B (en) | 2015-03-10 | 2015-03-10 | Apoptosis element combined peptide and its application in antitumor drug is prepared |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510104548.5A CN104926943B (en) | 2015-03-10 | 2015-03-10 | Apoptosis element combined peptide and its application in antitumor drug is prepared |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104926943A CN104926943A (en) | 2015-09-23 |
CN104926943B true CN104926943B (en) | 2018-05-08 |
Family
ID=54114384
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510104548.5A Active CN104926943B (en) | 2015-03-10 | 2015-03-10 | Apoptosis element combined peptide and its application in antitumor drug is prepared |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104926943B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114181322A (en) * | 2021-12-13 | 2022-03-15 | 厦门医学院 | Polypeptide for inhibiting lung cancer cell proliferation |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN100586961C (en) * | 2006-05-16 | 2010-02-03 | 中国人民解放军军事医学科学院野战输血研究所 | To tumour cell inhibited fusion rotein and encoding gene and application |
CN101081871A (en) * | 2006-05-31 | 2007-12-05 | 华中科技大学 | Protein transduction field 4-apopain fusion protein (PTD4-Apoptin) and preparation method and application thereof |
CN101081870B (en) * | 2006-05-31 | 2012-07-11 | 华中科技大学 | Antineoplastic biological medicament PTD4-GFP-Apoptin fusion protein and preparation method thereof |
CN101747437B (en) * | 2008-12-10 | 2012-09-26 | 浙江日升昌药业有限公司 | Apoptin-EC-SOD carboxyl terminal protein transduction domain fusion protein |
CN102757503A (en) * | 2011-04-28 | 2012-10-31 | 中国人民解放军第二军医大学 | Preparation method and application of human prostate apoptosis response protein 4 and apoptin 2 ligand fusion protein |
-
2015
- 2015-03-10 CN CN201510104548.5A patent/CN104926943B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN104926943A (en) | 2015-09-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101815522A (en) | Composition for the diagnosis, prevention or treatment of diseases related to cells expressing IL-8 or GRO-alpha, comprising UCB-MSCs | |
CN104471057A (en) | Modified bacteria and uses thereof for treatment of cancer or tumor | |
CN102321158B (en) | Polypeptide for preventing cell DNA synthesis and inhibiting cell proliferation and application | |
CN106167789A (en) | The mescenchymal stem cell of hypoxia process and application thereof | |
CN110339350A (en) | A kind of antitumor drug combination compositions and its application | |
CN107028957A (en) | Application of the traditional Chinese medicine monomer toosendanin as STAT3 inhibitor and its in anti-bone and flesh tumor medicine is prepared | |
EP2799445A1 (en) | Integrin blocker polypeptide and use thereof | |
CN109568299A (en) | Ambroxol purposes in preparing tumor chemotherapeutic drug Synergistic preparations | |
Shao et al. | Wogonin inhibits inflammation and apoptosis through STAT3 signal pathway to promote the recovery of spinal cord injury | |
CN101058809B (en) | Use of humanization modified rat ING4 gene and adenovirus expression vectors in preparing medicine for treating lung cancer | |
CN104926943B (en) | Apoptosis element combined peptide and its application in antitumor drug is prepared | |
US9498516B2 (en) | Composition for preventing or treating erectile dysfunction comprising angiopoietin-4 protein | |
CN106589130A (en) | Slit2D2-HSA recombinant protein and application thereof in treatment of sepsis | |
CN104083368A (en) | Application of G-1 in preparation of G protein coupled receptor 30-based triple negative breast cancer targeting drugs | |
CN106727701A (en) | A kind of Contained Serum prepared by Sishen wan and its preparation method and application | |
CN106955292A (en) | A kind of pharmaceutical composition and purposes for treating the cancer of the esophagus | |
CN106924748A (en) | The structure of high-penetration cancer target lipid plug-in unit and its promote the effect of cell and cell membrane preparation to tumor accumulation | |
CN101747414B (en) | Tumor necrosis factor (TNF)-alpha binding peptide and tumor necrosis factor receptor 1(TNFR1) blocking peptide and applications thereof in treatment of TNF related diseases | |
Li et al. | The enhanced treatment efficacy of invasive brain glioma by dual-targeted artemether plus paclitaxel micelles | |
CN104825507A (en) | Radix actinidiae chinensis extract and application thereof in preparation of drugs for treating bile duct cancer | |
US20230212233A1 (en) | Novel mutant of recombinant ganoderma lucidum immunomodulatory protein and use thereof | |
CN104491496B (en) | Application of the Gastrodin/Rhizoma Gastrodiae powder in anti-hepatic fibrosis medicines are prepared | |
CN104926945B (en) | A kind of oncotherapy polypeptide and its application with FSHR targetings | |
CN108727472A (en) | Negatively charged cell-penetrating peptides and the purposes as intracellular transport carrier | |
CN107693509A (en) | SB FI 26 are preparing the application in treating breast cancer medicines |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |