CN101081870B - Antineoplastic biological medicament PTD4-GFP-Apoptin fusion protein and preparation method thereof - Google Patents
Antineoplastic biological medicament PTD4-GFP-Apoptin fusion protein and preparation method thereof Download PDFInfo
- Publication number
- CN101081870B CN101081870B CN2006100192399A CN200610019239A CN101081870B CN 101081870 B CN101081870 B CN 101081870B CN 2006100192399 A CN2006100192399 A CN 2006100192399A CN 200610019239 A CN200610019239 A CN 200610019239A CN 101081870 B CN101081870 B CN 101081870B
- Authority
- CN
- China
- Prior art keywords
- ptd4
- gfp
- apoptin
- protein
- pet28a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The biomedicine PTD4-GFP-Apoptin fusion protein for treating tumor has its synthesized PTD4 utilized to introduce Apoptin protein into cell, and its Apoptin further utilized to induce tumor apoptosis, so as to inhibit tumor growth. At the same time, green fluorescent protein (GFP) is utilized for observing the intracellular distribution of the fusion protein and showing the aggregation of the medicine in the target position, realizing the effective monitoring and timely regulation of the treating process. Experiment shows that the fusion protein can penetrate biomembrane to kill tumor cell effectively while generating no damage to health cell. The present invention is applied in treating tumor.
Description
Technical field
The present invention relates to biotech drug, especially for the biotech drug of treatment tumour.
Background technology
Cancer is very big to the threat of human health and life, and there is the new cancer stricken of 7,000,000 people in the whole world every year approximately, has every year more than 500 ten thousand people to die from cancer approximately.China on average has 1,500,000 people's new trouble diseases present every year approximately, has every year 800000 people to die from cancer approximately.Cancer is that current serious influences human health, threatens one of principal disease of human life.Cancer constitutes world today's All Countries three big causes of death with cardiovascular and cerebrovascular diseases and mishap.Therefore, the World Health Organization and hygiene department of national governments all classify capture cancer as a top priority as.Seeking new medicine of treating tumour safely and effectively and method, is the important topic that current field of medicaments faces.
(chicken anemia virus, VP3 albumen CAV) (is also claimed that apoptosis is plain, Apoptin) has been caused people's attention because of its tumor specificity antiapoptotic inductive effect to derive from chicken anaemia virus.The inside and outside result of study shows that all VP3 (VP3 among this paper all refers to the VP3 albumen of chicken anaemia virus, and promptly CAV VP3 also claims that apoptosis is plain, i.e. Apoptin) can induce the kinds of tumor cells apoptosis
[1], its inductive apoptosis effect is non-p53 dependency
[2], do not receive the inhibition of anti-apoptosis factor Bcl-2, Bcl-xL
[3]More meaningfully, VP3 only induces the apoptosis that has the tumorigenic phenotype cell or transform the phenotype cell, and normal cell is not had apoptosis effect, no cytotoxicity
[4], the VP3 transgenic mice can be grown by normal growth
[5]People utilize VP3 treatment tumour to carry out positive exploration: at present, directly import exogenous vp3 gene and carry out gene therapy and be still the main policies that people take; Simultaneously, attempted Different Strategies to realize magnetic target therapy to different tumours
[6-7], as we in the world reported first realize in the vp3 genosome through receptor-mediated transfer techniques that liver cell is directed and shift and express that the specificity liver cancer apoptosis reducing has been obtained good tumor killing effect
[8-9]But; How to give full play to the characteristic of VP3 " tumor cell specific inducing apoptosis of tumour cell "; Potential risk that possibly occur after avoiding foreign gene to import in the body such as over-expresses etc. further expand the range of application that VP3 treats tumour, are still problem demanding prompt solution.
Protein transduction waveguide technology (protein transduction technology) is emerging in recent years a kind of macromole transition strategy: utilize some to have protein transduction domains (protein transduction domain; PTD) protein or polypeptide, the biomacromolecule that directly will have a therapeutic action " send " goes into cell performance biological effect
[10]This polypeptide with the ability of passing cytolemma is called cell and passes through film peptide (Cell-Penetrating Peptides; CPPs); Length generally is no more than 30 amino acid and is rich in basic aminoacids, like TAT (11 peptides, 13 peptides), Antp (16 peptide), VP22 (34 peptide), Transportan (28 peptide), MAP (18 peptide).The transmissible material wide range of CPP is general, like protein, DNA, antibody, video picture reagent, toxin, Nano medication particle, liposome etc.
[11]The CPP transfer system is the instrument of bioprocess in the excellent research cell, also is a research object that potential value is arranged at bio-pharmaceutical sender mask.This technology is just becoming the new approaches of tumor biotherapy---and utilize it directly therapeutant to be imported cancer cells, make therapeutic action more controlled
[10]Correlative study at present focuses mostly on HIV-TAT (trans-activator of transcription) polypeptide.TAT albumen (86 peptide) is a kind of transcription activating protein, Green in 1988
[11]And Frankel
[12]Independent separately discovery HIV-TAT albumen has the biomembranous ability that penetrates
[12-13]Find that subsequently this passes through the film ability is to be mediated by the peptide section between 47-57 (or 48-60) amino-acid residue, and the fusion rotein that forms of TAT polypeptide and other albumen also can permeate through cell membranes, and can bring into play these proteinic biological functions
[14-16]People such as Ho
[17]Utilize chemical synthesis that TAT is transformed; Obtained a series of TAT-PTD polypeptide through the amino acid replacement; Wherein the secondary structure of PTD4 is more stable, transduction efficiency is higher; Can make target protein transduction success ratio almost reach 100%, and the protein import volume of individual cells is 33 times of the TAT import volume, but can PTD4 realize that through biosynthesizing the film transportation of striding of fusion rotein does not appear in the newspapers at present as yet.
Summary of the invention
Task of the present invention provides a kind of antineoplastic biological medicament, it is had can directly get into inducing apoptosis of tumour cell in the tumour cell, and can send fluorescence, is convenient to observe it in characteristics such as intracellular distribution situations.
Antineoplastic biological medicament provided by the invention is protein transduction domain 4-green fluorescent protein-apoptosis plain fusion protein (PTD4-GFP-Apoptin; Or PTD4-GFP-VP3); Have the aminoacid sequence shown in sequence 8 in the sequence table or the sequence 9, its preparation method may further comprise the steps:
A. make up the prokaryotic expression carrier pET28a-PTD4 that contains the PTD4 sequence;
B. make up and contain GFP Prokaryotic Expression carrier pET28a-PTD4-GFP;
C. make up and contain Apoptin Prokaryotic Expression carrier pET28a-PTD4-GFP-Apoptin;
D.PTD4-GFP-Apoptin Expression of Fusion Protein and purifying.
The method that structure contains the prokaryotic expression carrier pET28a-PTD4 of PTD4 sequence is: form its base sequence of design according to the PTD4 polypeptide amino acid; Synthetic two oligonucleotide fragments; Moles such as two oligonucleotide fragments are mixed; 95 ℃ of 10min, room temperature is placed the 1h renaturation then, forms the double-stranded DNA of coding PTD4; This two strands is inserted into the Nhe I place of pET28a, transforms DH5 α, cut evaluation, PCR, order-checking, prove to be built into the pET28a-PTD4 recombinant plasmid through enzyme.
The method that structure contains GFP Prokaryotic Expression carrier pET28a-PTD4-GFP is: the GFP gene that utilizes PCR method amplification green fluorescent protein; With pcr amplified fragment GFP and pET28a-PTD4 recombinant plasmid respectively through BamH I and EcoR I double digestion; Reclaim the purpose segment; Connect, transform DH5 α, plasmid is extracted in amplification, obtains recombinant chou pET28a-PTD4-GFP.
The method that structure contains Apoptin Prokaryotic Expression carrier pET28a-PTD4-GFP-Apoptin is: the Apoptin gene that utilizes PCR method amplification chicken anaemia virus; With pcr amplified fragment Apoptin and pET28a-PTD4-GFP recombinant plasmid respectively through through EcoR I and Sal I double digestion; Reclaim the purpose fragment; Connect, transform DH5 α, plasmid is extracted in amplification, obtains recombinant chou pET28a-PTD4-GFP-Apoptin.
The method of PTD4-GFP-Apoptin Expression of Fusion Protein and purifying is: recombinant plasmid pET28a-PTD4-GFP-Apoptin is transformed expression strain e. coli bl21 (DE3) PlysS; Contain in the LB substratum of 0.05mg/ml kantlex 37 ℃ of concussions at 5ml and cultivate, to A
600=0.4～0.6 o'clock, add IPTG and induced 8 hours to final concentration 1.0mM, carrying out ultrasonic bacteria breaking, centrifugal collection inclusion body does not compare to induce bacterium, identifies through 12.5%SDS-PAGE; Inclusion body is dissolved in the sample-loading buffer that contains 8mol/l urea, and through the nickel affinity chromatography column purification, operation steps is undertaken by the test kit requirement.SDS-PAGE identifies eluted protein, merges the elutriant that contains target protein, dialysis, concentrated, filtration sterilization, and the BCA method is measured protein content ,-80 ℃ of preservations.
Construction of recombinant plasmid synoptic diagram of the present invention is seen Fig. 1.
Antineoplastic biological medicament PTD 4-GFP-Apoptin fusion protein provided by the invention; Utilize synthetic PTD4 directly with Apoptin albumen transfered cell; Then utilize Apoptin inducing apoptosis of tumour cell specifically; Thereby the purpose that realize promoting tumor death, suppresses tumor growth utilizes GFP (green fluorescent protein) can send the characteristics of green fluorescence simultaneously, can under fluorescent microscope, observe this fusion rotein in intracellular distribution; Show the gathering situation of medicine, thereby can realize the effective monitoring of therapeutic process and adjustment in good time at target site.Can penetrate microbial film through protein transduction experiment confirm PTD4-GFP of the present invention and PTD4-GFP-Apoptin fusion rotein; Confirm PTD4-GFP-Apoptin fusion rotein ability inducing apoptosis of tumour cell of the present invention through TUNEL method and DAPI dyeing; Show that PTD4-GFP-Apoptin fusion rotein that the present invention obtains with manual method preparation and purifying has good microbial film effect and the ability inducing apoptosis of tumour cell of penetrating; Tumour cell had great kill capability; And injuring normal cell not can not import the danger of foreign gene, can be used for tumor treatment.
With protein transduction domain 4-green fluorescent protein provided by the invention-apoptosis plain fusion protein (PTD4-GFP-Apoptin) is activeconstituents; Add acceptable carrier and/or additive on the pharmacopedics; Be prepared into anti-tumor medicinal preparation by ordinary method; Imposing on tumor locus can treat tumour, and described pharmaceutical carrier can be PBS (phosphate buffered saline buffer), glycerine or urea etc.
Description of drawings
Fig. 1 is a construction of recombinant plasmid synoptic diagram of the present invention.
Fig. 2 is a recombinant chou pET28a-PTD4 qualification result, indicates among the figure to be respectively:
M1:Mraker, molecular weight standard is followed successively by 7000,5500,3500,2000,1000,500bp from big to small;
A:pET28a-PTD4 is the result after Nhe I enzyme is cut;
B: by the PTD4 fragment that step 1 obtained;
C:pET28a-PTD4PCR result;
M2:Mraker, molecular weight standard is followed successively by 600,500,400,300,200,100bp from big to small.
Fig. 3 is a recombinant chou pET28a-PTD4-GFP qualification result, indicates among the figure to be respectively:
M1:Marker, molecular weight standard is followed successively by 7000,5500,3500,2000,1000,500bp from big to small;
A: the GFP fragment that step 1 obtained;
B:pET-28a-PTD4-GFP cuts through BamHI and EcoRI enzyme;
C:pET-28a-PTD4-GFP cuts through the BamHI enzyme.
Fig. 4 is a recombinant chou pET28a-PTD4-GFP-VP3 qualification result, indicates among the figure to be respectively:
M3:Mraker, molecular weight standard is followed successively by 1500,1000,900,800,700,600,500,400,300,200,100bp from big to small;
The PCR result of A:pcDNA-vp3;
The result that B:pET28a-PTD4-GFP-VP3 cuts through EcoR I and Sal I enzyme;
The result that C:pET28a-PTD4-GFP-VP3 cuts through EcoR I enzyme;
M1:Marker, molecular weight standard is followed successively by 7000,5500,3500,2000,1000,500bp from big to small.
Fig. 5 is PTD4-GFP fusion rotein PAGE result, indicates among the figure to be respectively:
M: protein molecular weight standard is followed successively by from top to bottom: 116.0kDa, 66.2kDa, 45.0kDa, 35.0kDa, 25.0kDa, 18.4kDa, 14.4kDa;
1: the total bacterial protein of abduction delivering not;
The total bacterial protein of 2:IPTG abduction delivering;
3: the PTD4-GFP fusion rotein of purifying.
Fig. 6 is PTD4-GFP-VP3 fusion rotein PAGE result, indicates among the figure to be respectively:
M: protein molecular weight standard is followed successively by from top to bottom: 116.0kDa, 66.2kDa, 45.0kDa, 35.0kDa, 25.0kDa, 18.4kDa, 14.4kDa;
4: the bacterioprotein in the inclusion body;
5: the total bacterial protein of abduction delivering not;
The total bacterial protein of 6:IPTG abduction delivering;
7: the PTD4-GFP-VP3 fusion rotein of purifying.
Fig. 7 is the result of the fluorescence microscope that passes through the film effect experiment of PTD4-GFP fusion rotein;
Fig. 8 is the result of the observation by light microscope that passes through the film effect experiment of PTD4-GFP fusion rotein;
Fig. 9 is the result of the fluorescence microscope that passes through the film effect experiment of PTD4-GFP-VP3 fusion rotein;
Figure 10 is the result of the observation by light microscope that passes through the film effect experiment of PTD4-GFP-VP3 fusion rotein;
Figure 11 induces HepG for the PTD4-GFP-VP3 fusion rotein
2Apoptotic laser confocal microscope is observed the FITC excitation result;
Figure 12 induces HepG for the PTD4-GFP-VP3 fusion rotein
2Apoptotic laser confocal microscope is observed the DAPI excitation result;
Figure 13 induces HepG for the PTD4-GFP-VP3 fusion rotein
2Apoptotic laser confocal microscope observes FITC and DAPI is total to excitation result;
Figure 14 induces HepG for the PTD4-GFP-VP3 fusion rotein
2Result under the apoptotic laser confocal microscope light microscopic.
Embodiment
Structure contains the prokaryotic expression carrier pET28a-PTD4 of PTD4 sequence
1. utilize the oligonucleotide fragment annealing method of synthetic to prepare the PTD4 sequence
(1) according to the report of Ho
[17], the PTD4 polypeptide is made up of 11 amino acid, and is following according to its base sequence of characteristics autonomous design of prokaryotic organism codon:
S1：5′-CTAGTTATGCCCGCGCGGCAGCACGACAAGCTCGAGCCC-3′
S2：5′-CTAGGGGCTCGAGCTTGTCGTGCTGCCGCGCGGGCATAA-3′
Article two, oligonucleotide fragment is synthetic by Shanghai bio-engineering corporation.
Moles such as two oligonucleotide fragments are mixed, 95 ℃ of 10min, room temperature is placed the 1h renaturation then, forms the double-stranded DNA of coding PTD4.
2. make up recombinant chou pET28a-PTD4
(1) prokaryotic expression carrier pET-28a (+) purchases Novagen company.
(2) construction process adopts conventional gene clone method.
The two strands that aforesaid method is obtained is inserted into the Nhe I place of pET28a, and conversion DH5 α cuts evaluation, PCR, order-checking through enzyme, proves to be built into the pET28a-PTD4 recombinant plasmid.Determined dna sequence is by rich inferior completion the in Shanghai.The PCR primers designed is:
P1：GGCAGCACGACAAGCTCGAG
P2:AACCCCTCAAGACCCGTTTAGAG, clip size is: 298bp
The pcr amplification reaction condition
Loop parameter is 95 ℃ of sex change 5min, 94 ℃ of 1min, 50 ℃ of 1min, 72 ℃ of 1min, and cyclic amplification number of times 30 times, last 72 ℃ are extended 10min.
Recombinant chou pET28a-PTD4 qualification result is seen Fig. 2, can judge that from the result of Fig. 2 recombinant chou pET28a-PTD4 makes up successfully.
Structure contains GFP Prokaryotic Expression carrier pET28a-PTD4-GFP
1. utilize the GFP gene of PCR method amplification green fluorescent protein
(1) pEGFP-C1 is available from CLONETECH company.
(2) the PCR primer sequence is following:
P3：5′-ACGGATCCATGGTGAGCAAGGGCG-3′；
P4：5′-GCGAATTCCTTGTACAGCTCGTCCATGC-3′
Article two, primer 5 ' end contains the recognition site of restriction enzyme BamH I and EcoR I respectively.
(3) pcr amplification reaction condition
Loop parameter is 94 ℃ of 5min, 94 ℃ of 55sec, 62 ℃ of 55sec, 72 ℃ of 1min, cyclic amplification 30 times, last 72 ℃ of insulation 10min.The PCR product identifies that through 1.5% agarose gel electrophoresis stripe size is correct.
2. make up prokaryotic expression carrier pET28a-PTD4-GFP
(1) structure of prokaryotic expression carrier pET28a-PTD4 is seen step ().
(2) construction process adopts conventional gene clone method.
Pcr amplified fragment GFP and pET28a-PTD4 recombinant plasmid reclaim the purpose segment respectively through BamH I and EcoR I double digestion, connect, transform DH5 α, and plasmid is extracted in amplification.
The recombinant chou qualification result is seen Fig. 3, can judge that from the result of Fig. 3 recombinant chou pET28a-PTD4-GFP makes up successfully.
Structure contains vp3 Prokaryotic Expression carrier pET28a-PTD4-GFP-VP3
1. utilize the vp3 gene of PCR method amplification chicken anaemia virus
(1) make up the carrier for expression of eukaryon pcDNA-vp3 contain the vp3 gene, concrete grammar referring to: Wang Yuzhe, Tian Jun bends and stretches etc., the structure of chicken anaemia virus vp3 gene and external apoptosis induction Study on Effect, Tongji Medical Univ's journal, 2001,30 (4): 300-4.
[18]
(2) the PCR primer sequence is following:
P5：5′-AGGAATTCATGAACGCTCTCCAAG-3′
P6：5′-GCGTCGACTTACAGTCTTATACGCC-3′
Article two, primer 5 ' end contains the recognition site of restriction enzyme EcoR I and Sal I respectively.
(3) pcr amplification reaction condition
Loop parameter is 94 ℃ of 5min, 94 ℃ of 55sec, 60 ℃ of 50sec, 72 ℃ of 55sec, cyclic amplification 30 times, 72 ℃ of insulation 10min.The PCR product is identified errorless through 1.5% agarose gel electrophoresis.
2. make up and contain vp3 Prokaryotic Expression carrier pET28a-PTD4-VP3
(1) structure of prokaryotic expression carrier pET28a-PTD4-GFP is seen step (two).
(2) construction process adopts conventional gene clone method.
Pcr amplified fragment vp3 and pET28a-PTD4-GFP recombinant plasmid through through EcoR I and Sal I double digestion, reclaim the purpose fragment respectively, connect, transform DH5 α, and plasmid is extracted in amplification.
The recombinant chou qualification result is seen Fig. 4, can judge that from the result of Fig. 4 recombinant chou pET28a-PTD4-GFP-VP3 makes up successfully.
PTD4-GFP, PTD4-GFP-VP3 Expression of Fusion Protein and purifying
1. prokaryotic expression bacterial strain E.coli BL21 (DE3) PlysS purchases Novagen company.The nickel affinity chromatography post is purchased Promega company.IPTG purchases BBI company.The BCA protein determination kit is purchased Pierce company.
2. expressing fusion protein process
Two kinds of recombinant plasmid pET28a-PTD4-GFP, pET28a-PTD4-GFP-VP3 behind the purifying are transformed expression strain e. coli bl21 (DE3) PlysS respectively.Contain in the LB substratum of 0.05mg/ml kantlex 37 ℃ of concussions at 5ml and cultivate, to A
600=0.4 ~ 0.6 o'clock, add IPTG and induced 8 hours to final concentration 1.0mM, carrying out ultrasonic bacteria breaking, centrifugal collection inclusion body does not compare to induce bacterium, identifies through 12.5%SDS-PAGE.
3. fusion rotein purge process
Inclusion body is dissolved in the sample-loading buffer that contains 8mol/l urea, and through the nickel affinity chromatography column purification, operation steps is undertaken by the test kit requirement.SDS-PAGE identifies eluted protein, merges the elutriant that contains target protein, dialysis, concentrated, filtration sterilization, and the BCA method is measured protein content ,-80 ℃ of preservations.
4.PTD4-GFP the fusion rotein qualification result is seen Fig. 5 and Fig. 6.The electrophoresis result of Fig. 5 obtains pure PTD4-GFP fusion rotein; The electrophoresis result of Fig. 6 obtains pure PTD4-GFP-VP3 fusion rotein.
The external film effect experiment of fusion rotein of the present invention
1. experiment material:
(1) PBS of PTD4-GFP and PTD4-GFP-VP3 (phosphate buffered saline buffer: 0.8%NaCl, 0.02%KCl, 0.144%Na
2HPO
4, 0.024%KH
2PO
4) solution.
(2) experimental cell behaviour source SMMC-7721 HepG
2Purchase CCTCC.
2. experimental technique
With people source liver cancer cell HepG
2Be inoculated in the culture plate, behind the cell attachment,, inhale behind the 2h and go nutrient solution, PBS to give a baby a bath on the third day after its birth time, place observation fluorescent microscope under then with fusion rotein PTD4-GFP and the PTD4-GFP-VP3 incubated cell of 1 μ mol/L.
3. experimental result
PTD4-GFP, PTD4-GFP-VP3 fusion rotein join the HepG of vitro culture respectively
2In the cell, behind the 2h in cell visible significantly green fluorescence, see Fig. 7, Fig. 8, Fig. 9 and Figure 10.
In conjunction with the result of Fig. 7, Fig. 8, Fig. 9 and Figure 10, show that PTD4-GFP, all successful permeate through cell membranes of PTD4-GFP-VP3 fusion rotein get into HepG
2In the cell, explain that synthetic PTD4 of the present invention has the function that mediates fusion albumen passes through film.
Fusion rotein PTD4-GFP-VP3 of the present invention induces HepG
2The experiment of apoptosis effect
1. experiment material:
(1) PBS of PTD4-GFP-VP3 (phosphate buffered saline buffer: 0.8%NaCl, 0.02%KCl, 0.144%Na
2HPO
4, 0.024%KH
2PO
4) solution.
(2) experimental cell behaviour source SMMC-7721 HepG
2Purchase CCTCC.The TUNEL detection kit is purchased Promega company.
2. experimental technique
The deckglass of handling is placed in six orifice plates people source liver cancer cell HepG
2Be inoculated in six orifice plates with proper density, behind the cell attachment, with the fusion rotein PTD4-GFP-VP3 incubated cell of 1 μ mol/L 4-5 days; PBS gives a baby a bath on the third day after its birth inferior; 4% Paraformaldehyde 96 is 30min fixedly, and TUNEL detects apoptosis (FITC dyeing) and redyes with DAPI, and operating process is carried out to specifications.Place under the laser confocal microscope and observe.
3. experimental result
Fusion rotein PTD4-GFP-VP3 and HepG
2Cell was hatched 4-5 days, and TUNEL detects apoptosis and redyes with DAPI, obvious visible cell nuclear shrinkage under the laser confocal microscope, and the limit collection explains that its fusion rotein can cause apoptosis, sees Figure 11, Figure 12, Figure 13 and Figure 14.
In conjunction with the result of Figure 11, Figure 12, Figure 13 and Figure 14, explain that the PTD4-GFP-VP3 fusion rotein induces HepG
2Cell generation apoptosis effect.
With PTD4-GFP-VP3 fusion rotein provided by the invention is activeconstituents, adds PBS (phosphate buffered saline buffer: 0.8%NaCl, 0.02%KCl, 0.144%Na
2HPO
4, 0.024%KH
2PO
4) solution, be prepared into anti-tumor medicinal preparation by ordinary method.
Embodiment 8
With PTD4-GFP-VP3 fusion rotein provided by the invention is activeconstituents, adds the glycerine of PBS solution and 10%, is prepared into anti-tumor medicinal preparation by ordinary method.
Embodiment 9
With PTD4-GFP-VP3 fusion rotein provided by the invention is activeconstituents, adds certain amount of urea (like 4M), is prepared into anti-tumor medicinal preparation by ordinary method.
Reference
1.Noteborn?MHM.Chicken?anemia?virus?induced?apoptosis：underlying?molecular?mechanisms.VetMicorbiol，2004，98：89-94.
2.Zhuang?SM，shvarts?A，van?Ormondt?H，Jochemsen?AG，van?der?Eb?AJ，and?Noteborn?MHM.Apoptin，a?protein?derived?from?chicken?anemia?virus，induces?p53-independent?apoptosis?in?humanosteosarcoma?cells.Cancer?Res，1995，55：486-489.
3.Schoop?RA，Kooistra?K，Baatenburg?De?Jong?RJ，and?Noteborn?MHM.Bcl-xL?inhibits?p53-butnot?apoptin-induced?apoptosis?in?head?and?neck?squamous?cell?carcinoma?cell?line.Int?JCancer，2004，109：38-42.
4.Zhang?YH，Leliveld?SR，Kooistra?K，Molenaar?C，Rohn?JL，Tanke?HJ，Abrahams?JP，and?NotebornMHM.Recombinant?Apoptin?multimers?kill?tumor?cells?but?are?nontoxic?and?epitope-shieldedin?a?normal-cell-specific?fashion.Exp?Cell?Res，2003，289：36-46.
5.Pietersen?AM.Preclinical?studies?with?Apoptin.PhD?thesis，Erasmus?University，Rotterdam，The?Netherlands，2003.
6.Van?der?Eb?MM，Pietersen?AM，Speetjens?FM，Kuppen?PJ，van?de?Velde?CJ，Notetorn?MHM，andHoeben?RC.Gene?therapy?with?apoptin?induces?regression?of?xenografted?human?hepatomas.Cancer?Gene?Ther，2002，9：53-61.
7.Song?JS.Enhanced?expression?of?apoptin?by?the?myc-max?binding?motif?and?SV40?enhancer?forSCLC?gene?therapy.Biosci?Biotechnol?Biochem，2005，69：51-55.
Sun Jun, Wang Yuzhe, Peng Dongjun, Zong Yiqiang, bend and stretch the experimental study of the receptor-mediated vp3 gene target property of asialoglycoprotein treatment liver cancer, Medical Molecular Biology magazine, 2004,1 (1): 5-9.
9.WANG?YZ，Peng?DJ，SUN?J，TIAN?J，Zhang?YH，Noteborn?MHM，Qu?S.Inhibition?of?hepatocarcinomaby?systemic?delivery?of?Apoptin?gene?to?the?hepatic?asiaglycorprotein?receptor.Cancer?GeneTherapy，2006，submitted.
10.KG?Ford，BE?Souberbielle，D?Darling?and?F?Farzaneh，Protein?Transduction：an?alternativeto?genetic?intervention?Gene?Therapy，2001，8：1-4.
11.Gupta?B，Levchenko?TS，Torchilin?VP，Intracellular?delivery?of?large?molecules?and?smallparticles?by?cell-penetrating?protein?and?peptides.Advanced?Drug?Delivery?Reviews.2005，57：637-651.
12.Green，M.，and?Loewenstein，P.M.Autonomous?functional?domains?of?chemically?synthesizedhuman?immunodeficiency?virus?tat?trans-activator?protein.Cell，1988，55：1179-1188.
13.Frankel，A.D.，and?Pabo，C.O.Cellular?uptake?of?the?tat?protein?from?humanimmunodeficiency?virus.Cell，1988，55：1189-1193.
14.Nagahara，H.，Vocero-Akbani，A.M.，Snyder，E.L.，Ho，A.，Latham，D.G.，Lissy，N.A.，Becker-Hapak，M.，Ezhevsky，S.A.，and?Dowdy，S.F.Transduction?of?full?length?tat?fusionproteins?into?mammalian?cells：p27Kipl?mediates?cell?migration.Nat.Med.，1998，4：1449-1452.
15.Schwarze，S.，Ho，A.，Vocero-Akbani，A.，and?Dowdy，S.F.In?vivo?protein?transduction：delivery?of?biologically?active?protein?into?the?mouse.Science(Washington?DC)，1999，285：1569-1572.
16.Schwarze，S.R.，Hruska，K.A.，and?Dowdy，S.F.Protein?transduction：unrestricted?deliveryinto?all?cells?Trends?Cell?Biol.2000，10：290-295.
17.Ho?A.，Schwarze?SR.，ermelstein?SJ.，Waksman?G.and?Dowdy?SF.，Synthetic?ProteinTransduction?Domains：Enhanced?Transduction?Poteintial?in?Vitro?and?in?Vivo.，CancerResearch，61，474-477，Jan.15，2001.
18. Wang Yu is wise, Tian Jun bends and stretches etc., the structure of chicken anaemia virus vp3 gene and external apoptosis induction Study on Effect, Tongji Medical Univ's journal, 2001,30 (4): 300-4.
Be nucleotide sequence and the aminoacid sequence that the present invention relates to below, sequence is respectively successively in the table:
Sequence 8 is aminoacid sequences of PTD4-GFP--Apoptin fusion rotein;
Sequence 9 is aminoacid sequences of the PTD4-GFP--Apoptin fusion rotein after the zymoplasm enzyme is cut.
Sequence table
< 110>Central China University of Science and Technology
< 120>a kind of biological medicament PTD 4-GFP-Apoptin fusion protein and preparation method who treats tumour
<130>1
<160>9
<170>PatentIn?version?3.1
<210>1
<211>33
<212>DNA
< 213>artificial sequence
<400>1
tatgcccgcg?cggcagcacg?acaagctcga?gcc 33
<210>2
<211>11
<212>PRT
< 213>artificial sequence
<400>2
Tyr?Ala?Arg?Ala?Ala?Ala?Arg?Gln?Ala?Arg?Ala
1 5 10
<210>3
<211>366
<212>DNA
<213>Chicken?anemia?virus
<400>3
atgaacgctc?tccaagaaga?tactccaccc?ggaccatcaa?cggtgttcag?gccaccaaca 60
agttcacggc?cgttggaaac?ccctcactgc?agagagatcc?ggattggtat?cgctggaatt 120
acaatcactc?tatcgctgtg?tggctgcgcg?aatgctcgcg?ctcccacgct?aagatctgca 180
actgcggaca?attcagaaag?cactggtttc?aagaatgtgc?cggacttgag?gaccgatcaa 240
cccaagcctc?cctcgaagaa?gcgatcctgc?gacccctccg?agtacagggt?aagcgagcta 300
aaagaaagct?tgattaccac?tactcccagc?cgaccccgaa?ccgcaaaaag?gcgtataaga 360
ctgtaa 366
<210>4
<211>121
<212>PRT
<213>Chicken?anemia?virus
<400>4
Met?Asn?Ala?Leu?Gln?Glu?Asp?Thr?Pro?Pro?Gly?Pro?Ser?Thr?Val?Phe
1 5 10 15
Arg?Pro?Pro?Thr?Ser?Ser?Arg?Pro?Leu?Glu?Thr?Pro?His?Cys?Arg?Glu
20 25 30
Ile?Arg?Ile?Gly?Ile?Ala?Gly?Ile?Thr?Ile?Thr?Leu?Ser?Leu?Cys?Gly
35 40 45
Cys?Ala?Asn?Ala?Arg?Ala?Pro?Thr?Leu?Arg?Ser?Ala?Thr?Ala?Asp?Asn
50 55 60
Ser?Glu?Ser?Thr?Gly?Phe?Lys?Asn?Val?Pro?Asp?Leu?Arg?Thr?Asp?Gln
65 70 75 80
Pro?Lys?Pro?Pro?Ser?Lys?Lys?Arg?Ser?Cys?Asp?Pro?Ser?Glu?Tyr?Arg
85 90 95
Val?Ser?Glu?Leu?Lys?Glu?Ser?Leu?Ile?Thr?Thr?Thr?Pro?Ser?Arg?Pro
100 105 110
Arg?Thr?Ala?Lys?Arg?Arg?Ile?Arg?Leu
115 120
<210>5
<211>717
<212>DNA
<213>Aequorea?victoria
<400>5
atggtgagca?agggcgagga?gctgttcacc?ggggtggtgc?ccatcctggt?cgagctggac 60
ggcgacgtaa?acggccacaa?gttcagcgtg?tccggcgagg?gcgagggcga?tgccacctac 120
ggcaagctga?ccctgaagtt?catctgcacc?accggcaagc?tgcccgtgcc?ctggcccacc 180
ctcgtgacca?ccctgaccta?cggcgtgcag?tgcttcagcc?gctaccccga?ccacatgaag 240
cagcacgact?tcttcaagtc?cgccatgccc?gaaggctacg?tccaggagcg?caccatcttc 300
ttcaaggacg?acggcaacta?caagacccgc?gccgaggtga?agttcgaggg?cgacaccctg 360
gtgaaccgca?tcgagctgaa?gggcatcgac?ttcaaggagg?acggcaacat?cctggggcac 420
aagctggagt?acaactacaa?cagccacaac?gtctatatca?tggccgacaa?gcagaagaac 480
ggcatcaagg?tgaacttcaa?gatccgccac?aacatcgagg?acggcagcgt?gcagctcgcc 540
gaccactacc?agcagaacac?ccccatcggc?gacggccccg?tgctgctgcc?cgacaaccac 600
tacctgagca?cccagtccgc?cctgagcaaa?gaccccaacg?agaagcgcga?tcacatggtc 660
ctgctggagt?tcgtgaccgc?cgccgggatc?actctcggca?tggacgagct?gtacaag 717
<210>6
<211>239
<212>PRT
<213>Aequorea?victoria
<400>6
Met?Val?Ser?Lys?Gly?Glu?Glu?Leu?Phe?Thr?Gly?Val?Val?Pro?Ile?Leu
1 5 10 15
Val?Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val?Ser?Gly
20 25 30
Glu?Gly?Glu?Gly?Asp?Ala?Thr?Tyr?Gly?Lys?Leu?Thr?Leu?Lys?Phe?Ile
35 40 45
Cys?Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val?Thr?Thr
50 55 60
Leu?Thr?Tyr?Gly?Val?Gln?Cys?Phe?Ser?Arg?Tyr?Pro?Asp?His?Met?Lys
65 70 75 80
Gln?His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val?Gln?Glu
85 90 95
Arg?Thr?Ile?Phe?Phe?Lys?Asp?Asp?Gly?Asn?Tyr?Lys?Thr?Arg?Ala?Glu
100 105 110
Val?Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu?Lys?Gly
115 120 125
Ile?Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu?Glu?Tyr
130 135 140
Asn?Tyr?Asn?Ser?His?Asn?Val?Tyr?Ile?Met?Ala?Asp?Lys?Gln?Lys?Asn
145 150 155 160
Gly?Ile?Lys?Val?Asn?Phe?Lys?Ile?Arg?His?Asn?Ile?Glu?Asp?Gly?Ser
165 170 175
Val?Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly
180 185 190
Pro?Val?Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Ala?Leu
195 200 205
Ser?Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe
210 215 220
Val?Thr?Ala?Ala?Gly?Ile?Thr?Leu?Gly?Met?Asp?Glu?Leu?Tyr?Lys
225 230 235
<210>7
<211>1230
<212>DNA
< 213>artificial sequence
<400>7
atgggcagca?gccatcatca?tcatcatcac?agcagcggcc?tggtgccgcg?cggcagccat 60
atggctagtt?atgcccgcgc?ggcagcacga?caagctcgag?cccctagcat?gactggtgga 120
cagcaaatgg?gtcgcggatc?catggtgagc?aagggcgagg?agctgttcac?cggggtggtg 180
cccatcctgg?tcgagctgga?cggcgacgta?aacggccaca?agttcagcgt?gtccggcgag 240
ggcgagggcg?atgccaccta?cggcaagctg?accctgaagt?tcatctgcac?caccggcaag 300
ctgcccgtgc?cctggcccac?cctcgtgacc?accctgacct?acggcgtgca?gtgcttcagc 360
cgctaccccg?accacatgaa?gcagcacgac?ttcttcaagt?ccgccatgcc?cgaaggctac 420
gtccaggagc?gcaccatctt?cttcaaggac?gacggcaact?acaagacccg?cgccgaggtg 480
aagttcgagg?gcgacaccct?ggtgaaccgc?atcgagctga?agggcatcga?cttcaaggag 540
gacggcaaca?tcctggggca?caagctggag?tacaactaca?acagccacaa?cgtctatatc 600
atggccgaca?agcagaagaa?cggcatcaag?gtgaacttca?agatccgcca?caacatcgag 660
gacggcagcg?tgcagctcgc?cgaccactac?cagcagaaca?cccccatcgg?cgacggcccc 720
gtgctgctgc?ccgacaacca?ctacctgagc?acccagtccg?ccctgagcaa?agaccccaac 780
gagaagcgcg?atcacatggt?cctgctggag?ttcgtgaccg?ccgccgggat?cactctcggc 840
atggacgagc?tgtacaagga?attcatgaac?gctctccaag?aagatactcc?acccggacca 900
tcaacggtgt?tcaggccacc?aacaagttca?cggccgttgg?aaacccctca?ctgcagagag 960
atccggattg?gtatcgctgg?aattacaatc?actctatcgc?tgtgtggctg?cgcgaatgct 1020
cgcgctccca?cgctaagatc?tgcaactgcg?gacaattcag?aaagcactgg?tttcaagaat 1080
gtgccggact?tgaggaccga?tcaacccaag?cctccctcga?agaagcgatc?ctgcgacccc 1140
tccgagtaca?gggtaagcga?gctaaaagaa?agcttgatta?ccactactcc?cagccgaccc 1200
cgaaccgcaa?aaaggcgtat?aagactgtaa 1230
<210>8
<211>409
<212>PRT
< 213>artificial sequence
<400>8
Met?Gly?Ser?Ser?His?His?His?His?His?His?Ser?Ser?Gly?Leu?Val?Pro
1 5 10 15
Arg?Gly?Ser?His?Met?Ala?Ser?Tyr?Ala?Arg?Ala?Ala?Ala?Arg?Gln?Ala
20 25 30
Arg?Ala?Pro?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Gly?Ser?Met
35 40 45
Val?Ser?Lys?Gly?Glu?Glu?Leu?Phe?Thr?Gly?Val?Val?Pro?Ile?Leu?Val
50 55 60
Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val?Ser?Gly?Glu
65 70 75 80
Gly?Glu?Gly?Asp?Ala?Thr?Tyr?Gly?Lys?Leu?Thr?Leu?Lys?Phe?Ile?Cys
85 90 95
Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val?Thr?Thr?Leu
100 105 110
Thr?Tyr?Gly?Val?Gln?Cys?Phe?Ser?Arg?Tyr?Pro?Asp?His?Met?Lys?Gln
115 120 125
His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val?Gln?Glu?Arg
130 135 140
Thr?Ile?Phe?Phe?Lys?Asp?Asp?Gly?Asn?Tyr?Lys?Thr?Arg?Ala?Glu?Val
145 150 155 160
Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu?Lys?Gly?Ile
165 170 175
Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu?Glu?Tyr?Asn
180 185 190
Tyr?Asn?Ser?His?Asn?Val?Tyr?Ile?Met?Ala?Asp?Lys?Gln?Lys?Asn?Gly
195 200 205
Ile?Lys?Val?Asn?Phe?Lys?Ile?Arg?His?Asn?Ile?Glu?Asp?Gly?Ser?Val
210 215 220
Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly?Pro
225 230 235 240
Val?Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Ala?Leu?Ser
245 250 255
Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe?Val
260 265 270
Thr?Ala?Ala?Gly?Ile?Thr?Leu?Gly?Met?Asp?Glu?Leu?Tyr?Lys?Glu?Phe
275 280 285
Met?Asn?Ala?Leu?Gln?Glu?Asp?Thr?Pro?Pro?Gly?Pro?Ser?Thr?Val?Phe
290 295 300
Arg?Pro?Pro?Thr?Ser?Ser?Arg?Pro?Leu?Glu?Thr?Pro?His?Cys?Arg?Glu
305 310 315 320
Ile?Arg?Ile?Gly?Ile?Ala?Gly?Ile?Thr?Ile?Thr?Leu?Ser?Leu?Cys?Gly
325 330 335
Cys?Ala?Asn?Ala?Arg?Ala?Pro?Thr?Leu?Arg?Ser?Ala?Thr?Ala?Asp?Asn
340 345 350
Ser?Glu?Ser?Thr?Gly?Phe?Lys?Asn?Val?Pro?Asp?Leu?Arg?Thr?Asp?Gln
355 360 365
Pro?Lys?Pro?Pro?Ser?Lys?Lys?Arg?Ser?Cys?Asp?Pro?Ser?Glu?Tyr?Arg
370 375 380
Val?Ser?Glu?Leu?Lys?Glu?Ser?Leu?Ile?Thr?Thr?Thr?Pro?Ser?Arg?Pro
385 390 395 400
Arg?Thr?Ala?Lys?Arg?Arg?Ile?Arg?Leu
405
<210>9
<211>392
<212>PRT
< 213>artificial sequence
<400>9
Gly?Ser?His?Met?Ala?Ser?Tyr?Ala?Arg?Ala?Ala?Ala?Arg?Gln?Ala?Arg
1 5 10 15
Ala?Pro?Ser?Met?Thr?Gly?Gly?Gln?Gln?Met?Gly?Arg?Gly?Ser?Met?Val
20 25 30
Ser?Lys?Gly?Glu?Glu?Leu?Phe?Thr?Gly?Val?Val?Pro?Ile?Leu?Val?Glu
35 40 45
Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val?Ser?Gly?Glu?Gly
50 55 60
Glu?Gly?Asp?Ala?Thr?Tyr?Gly?Lys?Leu?Thr?Leu?Lys?Phe?Ile?Cys?Thr
65 70 75 80
Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val?Thr?Thr?Leu?Thr
85 90 95
Tyr?Gly?Val?Gln?Cys?Phe?Ser?Arg?Tyr?Pro?Asp?His?Met?Lys?Gln?His
100 105 110
Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val?Gln?Glu?Arg?Thr
115 120 125
Ile?Phe?Phe?Lys?Asp?Asp?Gly?Asn?Tyr?Lys?Thr?Arg?Ala?Glu?Val?Lys
130 135 140
Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu?Lys?Gly?Ile?Asp
145 150 155 160
Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu?Glu?Tyr?Asn?Tyr
165 170 175
Asn?Ser?His?Asn?Val?Tyr?Ile?Met?Ala?Asp?Lys?Gln?Lys?Asn?Gly?Ile
180 185 190
Lys?Val?Asn?Phe?Lys?Ile?Arg?His?Asn?Ile?Glu?Asp?Gly?Ser?Val?Gln
195 200 205
Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly?Pro?Val
210 215 220
Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Ala?Leu?Ser?Lys
225 230 235 240
Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe?Val?Thr
245 250 255
Ala?Ala?Gly?Ile?Thr?Leu?Gly?Met?Asp?Glu?Leu?Tyr?Lys?Glu?Phe?Met
260 265 270
Asn?Ala?Leu?Gln?Glu?Asp?Thr?Pro?Pro?Gly?Pro?Ser?Thr?Val?Phe?Arg
275 280 285
Pro?Pro?Thr?Ser?Ser?Arg?Pro?Leu?Glu?Thr?Pro?His?Cys?Arg?Glu?Ile
290 295 300
Arg?Ile?Gly?Ile?Ala?Gly?Ile?Thr?Ile?Thr?Leu?Ser?Leu?Cys?Gly?Cys
305 310 315 320
Ala?Asn?Ala?Arg?Ala?Pro?Thr?Leu?Arg?Ser?Ala?Thr?Ala?Asp?Asn?Ser
325 330 335
Glu?Ser?Thr?Gly?Phe?Lys?Asn?Val?Pro?Asp?Leu?Arg?Thr?Asp?Gln?Pro
340 345 350
Lys?Pro?Pro?Ser?Lys?Lys?Arg?Ser?Cys?Asp?Pro?Ser?Glu?Tyr?Arg?Val
355 360 365
Ser?Glu?Leu?Lys?Glu?Ser?Leu?Ile?Thr?Thr?Thr?Pro?Ser?Arg?Pro?Arg
370 375 380
Thr?Ala?Lys?Arg?Arg?Ile?Arg?Leu
385 390
Claims (9)
1. protein transduction domain 4-green fluorescent protein-apoptosis plain fusion protein PTD4-GFP-Apoptin, its aminoacid sequence is shown in sequence in the sequence table 8 or sequence 9.
2. contain protein transduction domain 4-green fluorescent protein-apoptosis plain fusion protein PTD4-GFP-Apoptin Prokaryotic Expression carrier, the nucleotide sequence of described protein transduction domain 4-green fluorescent protein-apoptosis plain fusion protein PTD4-GFP-Apoptin gene is shown in sequence in the sequence table 7.
3. the application of the described fusion rotein of claim 1 in the preparation medicines resistant to liver cancer.
4. the preparation method of the described protein transduction domain 4-green fluorescent protein of claim 1-apoptosis plain fusion protein PTD4-GFP-Apoptin may further comprise the steps:
A. make up the prokaryotic expression carrier pET28a-PTD4 that contains the PTD4 sequence;
B. make up and contain PTD4-GFP Prokaryotic Expression carrier pET28a-PTD4-GFP;
C. structure contains PTD4-GFP-Apoptin Prokaryotic Expression carrier pET28a-PTD4-GFP-Apoptin, and the nucleotide sequence of described PTD4-GFP-Apoptin gene is shown in sequence in the sequence table 7;
D.PTD4-GFP-Apoptin Expression of Fusion Protein and purifying.
5. the preparation method of protein transduction domain 4-green fluorescent protein according to claim 4-apoptosis plain fusion protein PTD4-GFP-Apoptin; It is characterized in that the method that said structure contains the prokaryotic expression carrier pET28a-PTD4 of PTD4 sequence is: form its base sequence of design according to the PTD4 polypeptide amino acid; Synthetic two oligonucleotide fragments mix moles such as two oligonucleotide fragments 95 ℃ of 10min; Room temperature is placed the 1h renaturation then, forms the double-stranded DNA of coding PTD4; This two strands is inserted into the Nhe I place of pET28a, transforms DH5 α, cut evaluation, PCR, order-checking, prove to be built into the pET28a-PTD4 recombinant plasmid through enzyme.
6. the preparation method of protein transduction domain 4-green fluorescent protein according to claim 4-apoptosis plain fusion protein PTD4-GFP-Apoptin; It is characterized in that the method that said structure contains GFP Prokaryotic Expression carrier pET28a-PTD4-GFP is: the GFP gene that utilizes PCR method amplification green fluorescent protein; With pcr amplified fragment GFP and pET28a-PTD4 recombinant plasmid respectively through BamH I and EcoR I double digestion; Reclaim the purpose segment; Connect, transform DH5 α, plasmid is extracted in amplification, obtains recombinant chou pET28a-PTD4-GFP.
7. the preparation method of protein transduction domain 4-green fluorescent protein according to claim 4-apoptosis plain fusion protein PTD4-GFP-Apoptin; It is characterized in that the method that said structure contains PTD4-GFP-Apoptin Prokaryotic Expression carrier pET28a-PTD4-GFP-Apoptin is: the Apoptin gene that utilizes PCR method amplification chicken anaemia virus; With pcr amplified fragment Apoptin and pET28a-PTD4-GFP recombinant plasmid respectively through through EcoR I and Sal I double digestion; Reclaim the purpose fragment; Connect, transform DH5 α, plasmid is extracted in amplification, obtains recombinant chou pET28a-PTD4-GFP-Apoptin.
8. the preparation method of protein transduction domain 4-green fluorescent protein according to claim 4-apoptosis plain fusion protein PTD4-GFP-Apoptin; The method that it is characterized in that said PTD4-GFP-Apoptin Expression of Fusion Protein and purifying is: recombinant plasmid pET28a-PTD4-GFP-Apoptin is transformed expression strain e. coli bl21 PlysS; Contain in the LB substratum of 0.05mg/ml kantlex 37 ℃ of concussions at 5ml and cultivate, to A
600=0.4～0.6 o'clock, add IPTG and induced 8 hours to final concentration 1.0mM, carrying out ultrasonic bacteria breaking, centrifugal collection inclusion body does not compare to induce bacterium, identifies through 12.5%SDS-PAGE; Inclusion body is dissolved in the sample-loading buffer that contains 8mol/l urea, and through the nickel affinity chromatography column purification, operation steps is undertaken by the test kit requirement; SDS-PAGE identifies eluted protein, merges the elutriant that contains target protein, dialysis, concentrated, filtration sterilization; The BCA method is measured protein content ,-80 ℃ of preservations.
9. the gene of protein transduction domain 4-green fluorescent protein-apoptosis plain fusion protein PTD4-GFP-Apoptin, its nucleotide sequence is shown in sequence in the sequence table 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100192399A CN101081870B (en) | 2006-05-31 | 2006-05-31 | Antineoplastic biological medicament PTD4-GFP-Apoptin fusion protein and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006100192399A CN101081870B (en) | 2006-05-31 | 2006-05-31 | Antineoplastic biological medicament PTD4-GFP-Apoptin fusion protein and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101081870A CN101081870A (en) | 2007-12-05 |
| CN101081870B true CN101081870B (en) | 2012-07-11 |
Family
ID=38911681
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006100192399A Expired - Fee Related CN101081870B (en) | 2006-05-31 | 2006-05-31 | Antineoplastic biological medicament PTD4-GFP-Apoptin fusion protein and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101081870B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059886A (en) * | 2012-12-14 | 2014-09-24 | 上海柯莱逊生物技术有限公司 | Method of modifying T cells through TAT-apoptin gene |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101747437B (en) * | 2008-12-10 | 2012-09-26 | 浙江日升昌药业有限公司 | Apoptin-EC-SOD carboxyl terminal protein transduction domain fusion protein |
| CN101875688B (en) * | 2010-02-10 | 2013-04-17 | 赵洪礼 | Folic acid modification step of method for preparing recombinant tumor specific apoptosis factor and application of products of recombinant tumor specific apoptosis factor |
| CN104926943B (en) * | 2015-03-10 | 2018-05-08 | 哈尔滨医科大学 | Apoptosis element combined peptide and its application in antitumor drug is prepared |
| CN106399372A (en) * | 2016-10-18 | 2017-02-15 | 广西壮族自治区水牛研究所(中国农业科学院水牛研究所) | Method for transducing buffalo embryo by virtue of PEP-1 peptide mediated green fluorescent protein |
| CN106480091B (en) * | 2016-10-18 | 2019-08-30 | 广西壮族自治区水牛研究所(中国农业科学院水牛研究所) | A kind of method that PEP-1 peptide concatermer mediates green fluorescent protein transduction buffalo embryo |
| CN108642070B (en) * | 2018-04-11 | 2022-03-15 | 沈阳金石生物制药有限公司 | Recombinant human Fc antibody for specifically inducing tumor cell apoptosis and preparation method and application thereof |
| CN114751990B (en) * | 2022-04-01 | 2023-10-20 | 中国科学技术大学 | Amido homoserine lactone receptor-enhanced green fluorescence fusion protein, preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1690212A (en) * | 2004-04-23 | 2005-11-02 | 中国人民解放军军需大学军事兽医研究所 | Anti-tumor recombinant live-vector vaccine |
| CN1765929A (en) * | 2004-10-29 | 2006-05-03 | 中国人民解放军军事医学科学院毒物药物研究所 | Contain the fusion rotein of peptide carrier and Urogastron and nucleic acid and uses thereof |
-
2006
- 2006-05-31 CN CN2006100192399A patent/CN101081870B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1690212A (en) * | 2004-04-23 | 2005-11-02 | 中国人民解放军军需大学军事兽医研究所 | Anti-tumor recombinant live-vector vaccine |
| CN1765929A (en) * | 2004-10-29 | 2006-05-03 | 中国人民解放军军事医学科学院毒物药物研究所 | Contain the fusion rotein of peptide carrier and Urogastron and nucleic acid and uses thereof |
Non-Patent Citations (2)
| Title |
|---|
| Lars Guel等.TAT-apoptin is efficiently delivered and induces apoptosis in cancer cells.《Oncogene》.2004,第23卷(第5期),1153-1165. * |
| 李士泽等.亡蛋白融合基因与报告基因pECFP-C1的构建及其稳定表达细胞株的建立.《农业生物技术学报》.2006,第14卷(第1期),1-6. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059886A (en) * | 2012-12-14 | 2014-09-24 | 上海柯莱逊生物技术有限公司 | Method of modifying T cells through TAT-apoptin gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101081870A (en) | 2007-12-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101081870B (en) | Antineoplastic biological medicament PTD4-GFP-Apoptin fusion protein and preparation method thereof | |
| JP7177047B2 (en) | Rationally-designed synthetic peptide shuttle agents, uses thereof, methods and kits associated therewith for delivering polypeptide cargoes from the extracellular space of target eukaryotic cells to the cytosol and/or nucleus | |
| US7700109B2 (en) | Biomolecule transduction motif Mph-1-BTM and the use thereof | |
| Park et al. | Nontoxic membrane translocation peptide from protamine, low molecular weight protamine (LMWP), for enhanced intracellular protein delivery: in vitro and in vivo study | |
| US20180214565A1 (en) | Peptide having cell membrane penetrating activity | |
| US10040830B2 (en) | Methods and compositions for protein delivery | |
| KR101841211B1 (en) | Cell penetrating peptide and method for delivery of biologically active materials using it | |
| Beerens et al. | Protein transduction domains and their utility in gene therapy | |
| Grdisa | The delivery of biologically active (therapeutic) peptides and proteins into cells | |
| WO2005084158A2 (en) | Polypeptide transduction and fusogenic peptides | |
| US20180298359A1 (en) | Intracellular protein delivery | |
| JP2009517080A (en) | Non-active Wnt inhibitory polypeptide and method for producing the same | |
| KR101778244B1 (en) | Cell penetrating peptide and method for delivery of biologically active materials using it | |
| CN101081871A (en) | Protein transduction field 4-apopain fusion protein (PTD4-Apoptin) and preparation method and application thereof | |
| US7354737B2 (en) | Biomolecule transduction motif Sim-2-BTM and the use thereof | |
| Sadiq et al. | Biotherapeutic effect of cell-penetrating peptides against microbial agents: A review | |
| WO2004081188A2 (en) | Non-toxic membrane-translocating peptides | |
| EP4006057A1 (en) | Complex for intracellular delivery of molecules | |
| KR20090016890A (en) | New cell penetrating peptides and method for delivery of biologically active agents using thereof | |
| CN101747437B (en) | Apoptin-EC-SOD carboxyl terminal protein transduction domain fusion protein | |
| CN114605501A (en) | Polypeptide FIP-21 capable of antagonizing RNA binding activity of FUS protein and application thereof | |
| KR101775625B1 (en) | Novel cell permeable peptide with high stability in plasma and use thereof | |
| WO2022166905A1 (en) | High-affinity tcr against hpv | |
| CN101899100B (en) | Anti-HIV-I (Human Immunodeficiency Virus-I) polypeptides as well as coding sequences and applications thereof | |
| Beerens | Intercellular spread of the transgene product to improve the efficiency of cancer gene therapy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120711 Termination date: 20150531 |
|
| EXPY | Termination of patent right or utility model |