CN104911257A - AS-STR locus fluorescent labeling composite amplification system and application thereof - Google Patents
AS-STR locus fluorescent labeling composite amplification system and application thereof Download PDFInfo
- Publication number
- CN104911257A CN104911257A CN201510190395.0A CN201510190395A CN104911257A CN 104911257 A CN104911257 A CN 104911257A CN 201510190395 A CN201510190395 A CN 201510190395A CN 104911257 A CN104911257 A CN 104911257A
- Authority
- CN
- China
- Prior art keywords
- str
- composite amplification
- primer pair
- locus
- amplification system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an AS-STR locus fluorescent labeling composite amplification system and an application thereof. The composite amplification system includes the following 15 linked autosome STR(AS-STR) loci: D3S2402, D3S2452, D3S1766, D3S4554, D3S2388, D3S4551, D3S2422, D3S3051, D3S3053, D4S2364, D4S2404, AC001348A, AC001348B, D17S975 and D17S1294. The 15 linked AS-STR loci are simultaneously amplified in the composite amplification system, so fastness and convenience are realized; and a result of genetic analyzer electrophoresis of PCR products is automatically analyzed, so standardization and internationalization are realized, and the comparison correctness of data in different labs is guaranteed. A closely linked STR composite amplification kit developed in the invention is suitable for parentage determination, and can also be used for antenatal diagnosis of chromosome abnormality, so the kit has a wide market application prospect.
Description
Technical field
The present invention relates to the genetic marker in human body genome with polymorphism, particularly relate to chain AS-STR locus fluorescence labeling composite amplification system and application.
Background technology
Relationship qualification is the difficult point on Forensic Identification.Unknown personnel identity identification, the personnel of scattering find relatives, accident or traffic accidents kill personnel claim, or even the body source qualification of catastrophe sexual behavior part victim all can relate to relationship qualification.For the relationship qualification that some do not have father and mother to participate in, except Y chromosome and inheritance of mitochondrion DNA mark can be got rid of except paternal or maternal sibship, on application euchromosome during non-chain genetic marker, owing to cannot directly observe allelic Genetic conditions between certified individuality, also just directly cannot getting rid of sibship, sibship can only be assessed by comparing the total allelic probability of relatives' nothing to do with individuality.Due to the genetic background of STR, the gene frequency showing as a lot of STR is greater than 0.125 or higher 0.25, this value be greater than third degree relative have 12.5% or second degree relative have 25% mutually homoallelic value, thus cannot distinguish three grades of sibships or independent individuals relation, sibship has met bottleneck in the qualification of secondary or third degree relative.Obviously, just there is good effect to first degree relative (full sibs) qualification with the non-chain STR of euchromosome, and second degree relative, third degree relative or independent individuals cannot be distinguished, therefore cannot sibship discriminating be carried out.
In human genome, there is the closely linked str locus seat of a class, chain STR forms haplotype (haplotye) and entails offspring from parental generation, and close linkage STR haplotype has height polymorphism.The probability between independent individuals with same monomer type is very little, can overcome the interference of the not high and genetic background of conventional non-chain STR polymorphism, break through the difficult problem can not identified the above sibship of secondary at present and distinguish different sibship.If the polymorphism of certain close linkage STR group haplotype is ad infinitum high, the probability so between independent individuals with same monomer type will be extremely little, only have the akin individuality of tool just to have identical haplotype, so just can will have sibship and not have akin individuality to make a distinction.
But except X chromosome str locus seat, the existing STR being applied to Forensic Identification is not closely linked STR, the close linkage STR composite amplification system that can be applied to the qualification of actual relationship has report both at home and abroad so far not yet.Therefore, the present invention filters out the close linkage str locus seat of height polymorphism from No. 3, No. 4, No. 17 euchromosomes, sets up composite amplification system.The close linkage STR composite amplification reagent kit of the present invention's exploitation is not only applicable to relationship qualification, and can also be used for the antenatal diagnosis of chromosome abnormalty, market application foreground is wide.
Summary of the invention
The object of the invention is to for the deficiencies in the prior art, in providing one to be suitable for
compatriotsgroup's, can fast, second degree relative, third degree relative or independent individuals cannot distinguish by the convenient euchromosome STR chain for not close, Y-STR, X-STR, therefore cannot carry out AS-STR locus fluorescence labeling composite amplification system that sibship differentiates to carry out identifying and application.
Above-mentioned purpose of the present invention is achieved by following scheme:
AS-STR locus fluorescence labeling composite amplification system, this composite amplification system comprises 15 locus altogether: D3S2402, D3S2452, D3S1766, D3S4554, D3S2388, D3S4551, D3S2422, D3S3051, D3S3053, D4S2364, D4S2404, AC001348A, AC001348B, D17S975 and D17S1294; Described 15 locus primers use FAM, HEX, TAM or ROX tetra-kinds fluorescein-labelled respectively; FAM fluorescein-labelled D17S1294, D3S4551, D4S2404 and D3S3053, HEX fluorescein-labelled AC001348B, AC001348A, D3S2422 and D3S4554, TAMRA fluorescein-labelled D3S2388, D3S2452, D3S1766 and D17S975, ROX fluorescein-labelled D4S2364, D3S3051 and D3S2402; Wherein amplimer is to being respectively:
D3S2402 primer pair:
F:CCTGGGCAACATAATGAGAT,
R:TGGACAAAGCATTTTATAATCTG;
D3S2452 primer pair:
F:GCTTGCAGATAGCAGATCGT,
R:TATAAGATTAGTCAGGGCTCGC;
D3S1766 primer pair:
F:ACCACATGAGCCAATTCTGT,
R:ACCCAATTATGGTGTTGTTACC;
D3S4554 primer pair:
F:CAATACGGGCTGATGATAGG,
R:TGGAAATGCTCCCATAGATT;
D3S2388 primer pair:
F:TCCACTCAGTACAAGTCTGGG,
R:GATCCTGTGGTTTGTCGATC;
D3S4551 primer pair:
F:AGTCATTGTCAGGCATTGGT,
R:ATATGACCTTGGGCAACAAA;
D3S2422 primer pair:
F:ACTGAGAAAGTCTTTCTGTGCC,
R:GTTCACCATCTACAGTGGGC;
D3S3051 primer pair:
F:GGCAATTAGTTATGTAGCAATCG,
R:TGAGTCAATTGTGCTGGCTA;
D3S3053 primer pair:
F:TCTTTGCTCTCATGAATAGATCAGT,
R:GTTTGTGATAATGAACCCACTCAG; D4S2364 primer pair:
F:AACAAAACTAGGAGATCATGTGG,
R:ACCTTGACTTTGATGTGGGA;
D4S2404 primer pair:
F:ATATATATGATGCATGTCAAAATGG,
R:CTGGGCAAACTCATTTCAAC;
AC001348A primer pair:
F:CAACCATCAGTGATTTGATGGTTTA,
R:CTGTTCTTCTTAATCCTTAACCAGT;
AC001348B primer pair:
F:TCTCAGTCCTGATTTCTTGATTTTG,
R:CCAGAGCTAACACCACATTCA;
D17S975 primer pair:
F:AGTAATGGGACTTCTCGGCT,
R:TAGGATCCCAAGTGTGCAGT;
D17S1294 primer pair:
F:TGGCATGCAATTGTAGTCTC,
R:TTCTTTCCTTACTAAGTTGAGAACG;
In above-mentioned AS-STR locus fluorescence labeling composite amplification system, described 15 AS-STR locus set up 7 linkage groups, respectively: I: D3S2402-D3S2452-D3S1766; II: D3S4554-D3S2388; III: D3S4551-D3S2422; IV: D3S3051-D3S3053; V: D4S2364-D4S2404; VI: AC001348A-AC001348B; VII: D17S975-D17S1294.
Above-mentioned AS-STR locus fluorescence labeling composite amplification system assert the application in sibship inspection case reagent in preparation.
Above-mentioned AS-STR locus fluorescence labeling composite amplification system to carry out the application in the detection reagent of antenatal diagnosis to euchromosome dependency inherited disease in preparation.
A kind of test kit, comprises the mixture that amplimer in above-mentioned AS-STR locus fluorescence labeling composite amplification system is right.
One, the selection of 15 locus in composite amplification system of the present invention
(1) close linkage:
From genome screening be positioned at close linkage str locus seat on same karyomit(e), close linkage STR form chain to or chain group (linkage group) by haplotype genetic stability, the str locus seat genetic distance≤3cM in each chain group.According to document (Inturri S, et al.Forensic Sci IntGenet.2011; Standard 5:152-4), genetic distance≤3cM can think in close linkage.Different chain group of STR is positioned on different karyomit(e), though or multiple chain group of wide apart on same karyomit(e), can freely recombinate, the str locus seat applying multiple chain group builds composite amplification system.Apply these systems detect sample carry out relationship infer time, both considered that combined utilization linked gene seat (can regard a locus as chain group) improved the polymorphism of genetic marker; Consider again freely recombinating between chain STR group and group, make between group and group, to answer product rule (product rule) to carry out the statistics of medicolegal genetics.
15 locus of the present invention are distributed on No. 3, No. 4 and No. 17 karyomit(e)s closely linked, and 15 AS-STR locus can set up 7 linkage groups (I: D3S2402-D3S2452-D3S1766; II: D3S4554-D3S2388; III: D3S4551-D3S2422; IV: D3S3051-D3S3053; V: D4S2364-D4S2404; VI: AC001348A-AC001348B; VII: D17S975-D17S1294).Closely linked locus forms haplotype, is conducive to analyzing the genetic affinity between parental generation and filial generation in relationship qualification.
(2) amplification is easy to:
Except above-mentioned 15 locus, experiment initial stage contriver also have selected other and is positioned at locus on No. 3 karyomit(e), locus as chain in D3S1764, D3S2435 etc.; The locus that locus D4S3334, D4S1644, D4S2426, D4S2368, D4S2414 etc. on No. 4 karyomit(e)s are chain.But single locus amplification finds, the amplification of these locus also exists some problems, and the product amount of some amplifications is few, and aobvious band is excessively shallow, is even sometimes difficult to obtain amplified production, as D4S2368; There is Unspccific bands (as shadow band), as D4S2414 in being easy to of having; And above-mentioned 15 locus are easy to increase good stability, result is clear, and non-specific band is little.
Therefore finally have selected D3S2402, D3S2452, D3S1766, D3S4554, D3S2388, D3S4551, D3S2422, D3S3051, D3S3053, D4S2364, D4S2404, AC001348A, AC001348B, D17S975 and D17S1294 these 15 is easy to amplification, and the good locus of somatotype carries out composite amplification.
(3) amplified production fragment length is not overlapping:
The gap of each locus fragment size of composite amplification should be greater than 20bp, just can not overlap between the allelotrope of each locus, interference somatotype.
15 AS-STR locus composite amplification systems of the present invention are according to each locus amplifications product sheet segment length size, with the locus of different amplified production fragment length (differing by more than 20bp) of same fluorescent mark, can not overlap between the allelotrope of each locus of guarantee composite amplification, can not somatotype be disturbed.With the primer of the multiple locus of the fluorescent mark of four kinds of different colours, ensure that same reaction system can increase multiple locus simultaneously, and do not affect the somatotype of each locus.15 locus primers of the present invention use the fluorescent mark of FAM, HEX, TAM, ROX tetra-kinds of different colours respectively.In system, 15 its fluorescence array modes of AS-STR locus are FAM fluorescein-labelled D3S3053, D4S2404, D3S4551 and D17S1294, HEX fluorescein-labelled AC001348B, AC001348A, D3S2422 and D3S4554, TAMRA fluorescein-labelled D3S2388, D3S2452, D3S1766 and D17S975, ROX fluorescein-labelled D4S2364, D3S3051 and D3S2402.15 AS-STR locus can set up 7 linkage groups.(Ⅰ:D3S2402-D3S2452-D3S1766;Ⅱ:D3S4554-D3S2388;Ⅲ:D3S4551-D3S2422;Ⅳ:D3S3051-D3S3053;Ⅴ: D4S2364-D4S2404;Ⅵ:AC001348A-AC001348B;Ⅶ:D17S975-D17S1294)。
The invention provides a kind of fluorescence labeling composite amplification system simultaneously analyzing chain str locus seat on many karyomit(e)s, comprise the primer of 15 the AS-STR locus analyzed for composite amplification, the primer of whole 15 locus is blended in one in vitro.Locus in composite amplification system is increased by the pair of primers being positioned at these locus both sides, and 5 ' end of the primer normal chain wherein in often pair of primer is with fluorescein-labelled accordingly.
Two, the amplification of composite amplification locus of the present invention
Simultaneously 15 AS-STR locus fluorescence labeling composite amplification systems of the present invention adopt multiplex PCR to increase in same reaction tubes 15 chain AS-STR locus.
(1) PCR reaction system
Reaction cumulative volume is 25 μ l:PCR reaction buffer 5 μ l, and primer mixture 5 μ l, archaeal dna polymerase 1 μ l, template DNA 5 μ l, adds sterilized water to 25 μ l.
The archaeal dna polymerase that above-mentioned archaeal dna polymerase can select those skilled in the art to commonly use, as gold dna polymerase (Ampli Taq
).
(2) pcr amplification parameter:
(3) ABI PRISM 3500 genetic analyzer electropherotyping amplified production
A. preparation of samples:
Brief centrifugation after mixing, often pipe adds 10.0 μ l mixtures, then adds PCR primer 1.0 μ l, brief centrifugation.95 DEG C of sex change 4min, place in ice chest and cool 3min, the sample got after 10.0 μ l sex change is transferred to 96 hole sample panel, is loaded into ABI PRISM 3500 genetic analyzer and carries out electrophoresis.
B. interpretation of result:
iD-X software.
15 locus of the present invention to have been learned in colony in contriver's laboratory applications and have been investigated and obtain the genotyping result of Chinese colony, and result proves that these locus polymorphic are higher, in being suitable for
compatriotsthe detection of group, and be applied to actual inspection case and obtain desirable result.15 chain AS-STR locus fluorescence labeling composite amplification systems of the present invention can generate a reagent box, manyly setting up close linkage str locus seat haplotype data storehouse for family, inferring the complicated sibship of more than secondary based on chain STR haplotype by detecting.
Compared with prior art, the present invention has following beneficial effect:
1. close linkage: 15 chain AS-STR locus close linkages of the present invention, 15 AS-STR locus can set up 7 linkage groups, can analyze 7 linkage group Haplotype data simultaneously.
2. individual recognition rate is high: the haplotype individual recognition rate of 15 in AS-STR locus fluorescence labeling composite amplification system of the present invention chain AS-STR locus, 7 linkage groups reaches more than 0.999999;
3. AS-STR locus fluorescence labeling composite amplification system of the present invention at contriver's use for laboratory in detecting many samples for family and multiple child's family.Result shows chain str locus seat formation haplotype and stably entails offspring from parental generation, this result shows be broken through by the present invention to identify more than three grades and three grades sibships and the difficult problem distinguishing different sibship at present, and the sibship different for accurate evaluation provides scientific basis.
Locus good stability selected by this research, mutation rate is low, and genotyping result is accurate, can meet the needs of actual inspection case;
4. first the present invention develops the fluorescently-labeled composite amplification detection system of the five colors of the composite amplification of one group 15 chain AS-STR locus simultaneously in single reaction pipe at home, reaches at present in the world that fluorescent mark chain AS-STR locus composite amplification test kit is
high level.
5. fluorescent dye primer composite amplification technology of the present invention fast, conveniently, PCR primer can use ABI3500,3130,3100,310, the genetic analyzer electrophoresis such as 377, result automatic analysis, energy stdn, internationalization, ensure that the different experiments number of chambers is according to the exactness compared.
6. the present invention can prepare a set of test kit, commercialization can be carried out, the domestic blank not having chain AS-STR locus fluorescent composite amplification reagent kit can be filled up, also the deficiency of international composite amplification reagent kit can be supplemented, as chain AS-STR locus composite amplification test kit with Chinese characteristics, can be used for paternity test, individual recognition, be specially adapted to infer complicated sibship more than secondary, improve the identification capacity of three grades or higher category kinship, the qualification for these particular cases provides important scientific evidence.
7. chain AS-STR locus fluorescence labeling composite amplification system of the present invention can provide methods for prenatal diagnosis for companion's chromosome linkage inherited disease, also providing new authentication method for solving the relationship qualification being only difficult to the nothing to do with such as second degree relative, third degree relative individuality to distinguish by not chain euchromosome STR, Y-STR, X-STR, being with a wide range of applications.
Accompanying drawing explanation
figure1 is 15 AS-STR locus composite amplification Ladder electrophoresis
figurespectrum;
figure2 is 15 AS-STR locus composite amplification positive sample 9947A electrophoresis
figurespectrum;
figure3 to
figure4 is the electrophoresis of embodiment 1
figureand genotyping result statistical study
figure;
figure3 (A) are grandfather's sample 15 AS-STR locus composite amplification electrophoresis
figurespectrum;
figure3 (B) are grandmother's sample 15 AS-STR locus composite amplification electrophoresis
figurespectrum;
figure3 (C) are aunt's sample 15 AS-STR locus composite amplification electrophoresis
figurespectrum;
figure3 (D) are large uncle's sample 15 AS-STR locus composite amplification electrophoresis
figurespectrum;
figure3 (E) are little uncle's sample 15 AS-STR locus composite amplification electrophoresis
figurespectrum;
figure3 (F) are suspicious granddaughter's sample 15 AS-STR locus composite amplification electrophoresis
figurespectrum;
figure4 is the pedigree analysis of 15 AS-STR locus genotyping result of grandfather, grandmother, aunt, uncle's sample
figure.
figure5 to
figure7 is the pedigree analysis of embodiment 2 genotyping result
figure.
figure5 is chain STR (D4S2364-D4S2404) on No. 4 karyomit(e)s by haplotype stably heredity (haplotype 7/12 as 19 individualities is handed down by generation upon generation of by mom's great grandfather, and haplotype 6/15 is handed down by father by grandmother) in four generation familys
figure6 be chain STR AC001348A-AC001348B-D17S975-D17S1294 haplotype on No. 17 karyomit(e)s in three generations's family stably heredity (haplotype 17/14/20/19 as individual 17 entails mother by grandfather and hands down; The haplotype 14/13/20/19 of individual 18 entails mother by grandmother and hands down; The haplotype 13/13/21/19 of individual 19 entails mother by grandfather and hands down, and haplotype 15/13/21/22 grandmother entails that father hands down)
figure7 is 4 groups of linkage groups on No. 3 karyomit(e)s by haplotype stably heredity in four generation familys.
figuremiddle D3S2422 alleles not yet all checks order complete, and Ladder and sample somatotype represent with bp value temporarily.
Embodiment
Embodiment 1 is applied and is carried out the qualification of throwback relationship containing 15 chain AS-STR locus fluorescence labeling composite amplification systems.
Principle: in human genome, also exists the closely linked str locus seat of a class, and chain STR forms haplotype (haplotye) and entails offspring from parental generation, and close linkage STR haplotype has height polymorphism.The probability between independent individuals with same monomer type is very little, can overcome the interference of the not high and genetic background of conventional non-chain STR polymorphism, break through the difficult problem can not identified the above sibship of secondary at present and distinguish different sibship.If the polymorphism of certain close linkage STR group haplotype is ad infinitum high, the probability so between independent individuals with same monomer type will be extremely little, only have the akin individuality of tool just to have identical haplotype, so just can will have sibship and not have akin individuality to make a distinction.
Operation steps:
1.DNA extracts
Chelex-100 method: the blood stain of clip 4 Х 4mm or salivary stain, add 200 μ l 10%Chelex-100,56 DEG C of baking boxs spend the night, and are placed in PCR instrument 100 DEG C of 10min, and the centrifugal 2min of vibration 30sec, 10000r/min, 4 DEG C save backup.
2.PCR increases
Pcr amplification reaction is totally 25 μ l:PCR reaction buffer (Buffer) 5 μ l, primer mixture (Primer Pair Mix) 5 μ l, gold dna polymerase (Ampli Taq
) 1.0U, template DNA 5 μ l, add sterilized pure water to 25 μ l.
The formula of above-mentioned PCR damping fluid is: dNTP 200 μm of ol/L, MgCl
21.5mmol/L, 1 × Buffer.
In above-mentioned primer mixture, the primer of each locus is as shown in sequence SEQ NO.1-30, FAM fluorescein-labelled D3S3053, D4S2404, D3S4551 and D17S1294, HEX fluorescein-labelled AC001348B, AC001348A, D3S2422 and D3S4554, TAMRA fluorescein-labelled D3S2388, D3S2452, D3S1766 and D17S975, ROX fluorescein-labelled D4S2364, D3S3051 and D3S2402.
3.PCR Amplification: 95 DEG C of denaturation 11min, 94 DEG C of sex change 1min, 60 DEG C of renaturation 1min, 72 DEG C extend 1min, 30 circulations, then 60 DEG C extend 60min.
4.ABI PRISM 3500 genetic analyzer electrophoresis
1) start shooting: open voltage stabilized source → open 3500 host power supplies (instrument enters self-inspection state) → open computer → startup 3500DATA Collection data acquisition software.
2) device prepares: routine cleaning and installation
Kapillary, Buffer grain etc. are pulled down, with pure water cleaning, dries, encapsulating; 1 × Buffer solution is contained in Buffer grain.Double-click the Wizards → click Fill Capillary wizards in Run 3500Data CollectionVersion2.0 software → click menu bar, to kapillary injecting glue → kapillary location and sample editor.
3) preparation of samples:
Brief centrifugation after mixing, often pipe adds 10.0 μ l mixtures, then adds PCR primer 1.0 μ l, brief centrifugation.95 DEG C of sex change 4min, place in ice chest and cool 3min, the sample got after 10.0 μ l sex change is transferred to 96 hole sample panel, is loaded into 3500 genetic analyzers and carries out electrophoresis.
4) interpretation of result: carry out gene type with GeneMapper ID-X software.
Result: 15 AS-STR locus composite amplification electrophoresis of grandfather, grandmother, aunt, uncle and suspicious granddaughter
figurespectrum is shown in
figure3A extremely
figure3F.The statistical study of its genotyping result
figuresee
figure4.By
figure3 Hes
figure4 can find granddaughter's sample at No. 3, No. 4, No. 17 chromosomal result somatotypes all from its grandfather.And these haplotypes can find source from its aunt (sample 3) and uncle's (sample 4): the haplotype from 7 locus (D3S2402/D3S2452/D3S1766/D3S4551/D3S2422/D3S3051/D3S3053) on grandfather's No. 3 karyomit(e)s: 12/15/13/17/13/13/210/14/9 with its aunt and uncle identical (see
figure4); Haplotype from D4S2364/D4S2404 on grandfather's No. 4 karyomit(e)s: 15/10 also can find from its aunt and uncle; Haplotype from (AC001348A/AC001348B/D17S975/D17S1294) on grandfather's No. 17 karyomit(e)s: 16/15/21/21 can find from uncle.Haplotype 12/15/13/17/13/13/210/14/9 and 16/15/21/21 detects in this laboratory 1000 independent individuals to find not yet, therefore its frequency is less than 0.001,15/10 frequency to be 0.1516,15 locus somatotypes be 12/15/13/17/13/13/210/14/9/15/10/16/15/21/21 frequency be less than 1.516*10
-7, so support the sibship of grandfather and granddaughter.
For this case, due to father and its aunt of suspicious granddaughter, uncle is half-blooded, its close grandmother and father all no longer living, therefore the identification of grandfather and granddaughter cannot be applied Y-STR or X-STR and carried out, euchromosome STR can only be relied on, but for not chain STR, due to the genetic background of STR, the gene frequency showing as a lot of STR is greater than 0.125 or higher 0.25, this value be greater than third degree relative have 12.5% or second degree relative have 25% mutually homoallelic value, thus cannot by second degree relative, third degree relative or independent individuals distinguishes, therefore cannot sibship discriminating be carried out.15 close linkage STR composite amplification systems of the present invention's development just can make up the deficiency of not chain STR, the polymorphism of close linkage STR group haplotype is high, the interference of the not high and genetic background of conventional non-chain STR polymorphism can be overcome, break through the difficult problem can not identified the above sibship of secondary at present and distinguish different sibship.
Embodiment 2:
With 15 chain STR composite amplification systems of the present invention detect four generation family have 19 people, confirm that chain group of chain STR by haplotype Genetic conditions.
---pcr amplification---pcr amplification product electrophoresis---interpretation of result that concrete qualification process adopts aforesaid operation steps: DNA extraction.
Result resolve as
figure5,
figure6 Hes
figureshown in 7, from
figure7 linkage groups (I: D3S2402-D3S2452-D3S1766 of the composition of known 15 AS-STR locus; II: D3S4554-D3S2388; III: D3S4551-D3S2422; IV: D3S3051-D3S3053; V: D4S2364-D4S2404; VI: AC001348A-AC001348B; At three generations or in four generations genetic stability VII: D17S975-D17S1294).
figurein 5, chain STR (D4S2364-D4S2404) on No. 4 karyomit(e)s is by haplotype stably heredity (haplotype 7/12 as 19 individualities is handed down by generation upon generation of by mom's great grandfather, and haplotype 6/15 is handed down by father by grandmother) in four generation familys
figurein 6, the chain STR AC001348A-AC001348B-D17S975-D17 S1294 haplotype on No. 17 karyomit(e)s is stably hereditary in three generations's family, and (haplotype 17/14/20/19 as individual 17 entails mother by grandfather and hands down; The haplotype 14/13/20/19 of individual 18 entails mother by grandmother and hands down; The haplotype 13/13/21/19 of individual 19 entails mother by grandfather and hands down, and haplotype 15/13/21/22 grandmother entails that father hands down)
figurein 7,4 groups of linkage groups (I: D3S2402-D3S2452-D3S1766 on No. 3 karyomit(e)s; II: D3S4554-D3S2388; III: D3S4551-D3S2422; By haplotype in four generation familys stably heredity IV: D3S3051-D3S3053).
SEQUENCE LISTING
<110> Zhongshan University
<120> AS-STR locus fluorescence labeling composite amplification system and application
<130>
<160> 30
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> D3S2402 primer 1
<400> 1
cctgggcaac ataatgagat 20
<210> 2
<211> 23
<212> DNA
<213> D3S2402 primer 2
<400> 2
tggacaaagc attttataat ctg 23
<210> 3
<211> 20
<212> DNA
<213> D3S2452 primer 3
<400> 3
gcttgcagat agcagatcgt 20
<210> 4
<211> 22
<212> DNA
<213> D3S2452 primer 4
<400> 4
tataagatta gtcagggctc gc 22
<210> 5
<211> 20
<212> DNA
<213> D3S1766 primer 1
<400> 5
accacatgag ccaattctgt 20
<210> 6
<211> 22
<212> DNA
<213> D3S1766 primer 2
<400> 6
acccaattat ggtgttgtta cc 22
<210> 7
<211> 20
<212> DNA
<213> D3S4554 primer 1
<400> 7
caatacgggc tgatgatagg 20
<210> 8
<211> 20
<212> DNA
<213> D3S4554 primer 2
<400> 8
tggaaatgct cccatagatt 20
<210> 9
<211> 21
<212> DNA
<213> D3S2388 primer 1
<400> 9
tccactcagt acaagtctgg g 21
<210> 10
<211> 20
<212> DNA
<213> D3S2388 primer 2
<400> 10
gatcctgtgg tttgtcgatc 20
<210> 11
<211> 20
<212> DNA
<213> D3S4551 primer 1
<400> 11
agtcattgtc aggcattggt 20
<210> 12
<211> 20
<212> DNA
<213> D3S4551 primer 2
<400> 12
atatgacctt gggcaacaaa 20
<210> 13
<211> 20
<212> DNA
<213> D3S2422 primer 1
<400> 13
gttcaccatc tacagtgggc 20
<210> 14
<211> 20
<212> DNA
<213> D3S2422 primer 2
<400> 14
gttcaccatc tacagtgggc 20
<210> 15
<211> 23
<212> DNA
<213> D3S3051 primer 1
<400> 15
ggcaattagt tatgtagcaa tcg 23
<210> 16
<211> 20
<212> DNA
<213> D3S3051 primer 2
<400> 16
tgagtcaatt gtgctggcta 20
<210> 17
<211> 25
<212> DNA
<213> D3S3053 primer 1
<400> 17
tctttgctct catgaataga tcagt 25
<210> 18
<211> 24
<212> DNA
<213> D3S3053 primer 2
<400> 18
gtttgtgata atgaacccac tcag 24
<210> 19
<211> 23
<212> DNA
<213> D4S2364 primer 1
<400> 19
aacaaaacta ggagatcatg tgg 23
<210> 20
<211> 20
<212> DNA
<213> D4S2364 primer 2
<400> 20
accttgactt tgatgtggga 20
<210> 21
<211> 25
<212> DNA
<213> D4S2404 primer 1
<400> 21
atatatatga tgcatgtcaa aatgg 25
<210> 22
<211> 20
<212> DNA
<213> D4S2404 primer 2
<400> 22
ctgggcaaac tcatttcaac 20
<210> 23
<211> 25
<212> DNA
<213> AC001348A primer 1
<400> 23
caaccatcag tgatttgatg gttta 25
<210> 24
<211> 25
<212> DNA
<213> AC001348A primer 2
<400> 24
ctgttcttct taatccttaa ccagt 25
<210> 25
<211> 25
<212> DNA
<213> AC001348B primer 1
<400> 25
tctcagtcct gatttcttga ttttg 25
<210> 26
<211> 21
<212> DNA
<213> AC001348B primer 2
<400> 26
ccagagctaa caccacattc a 21
<210> 27
<211> 20
<212> DNA
<213> D17S975 primer 1
<400> 27
agtaatggga cttctcggct 20
<210> 28
<211> 20
<212> DNA
<213> D17S975 primer 2
<400> 28
taggatccca agtgtgcagt 20
<210> 29
<211> 20
<212> DNA
<213> D17S1294 primer 1
<400> 29
tggcatgcaa ttgtagtctc 20
<210> 30
<211> 25
<212> DNA
<213> D17S1294 primer 2
<400> 30
ttctttcctt actaagttga gaacg 25
Claims (5)
1.AS-STR locus fluorescence labeling composite amplification system, this composite amplification system comprises 15 locus altogether: D3S2402, D3S2452, D3S1766, D3S4554, D3S2388, D3S4551, D3S2422, D3S3051, D3S3053, D4S2364, D4S2404, AC001348A, AC001348B, D17S975 and D17S1294; Described 15 locus primers use FAM, HEX, TAM or ROX tetra-kinds fluorescein-labelled respectively; FAM fluorescein-labelled D17S1294, D3S4551, D4S2404 and D3S3053, HEX fluorescein-labelled AC001348B, AC001348A, D3S2422 and D3S4554, TAMRA fluorescein-labelled D3S2388, D3S2452, D3S1766 and D17S975, ROX fluorescein-labelled D4S2364, D3S3051 and D3S2402; Wherein amplimer is to being respectively:
D3S2402 primer pair:
F: CCTGGGCAACATAATGAGAT,
R: TGGACAAAGCATTTTATAATCTG;
D3S2452 primer pair:
F: GCTTGCAGATAGCAGATCGT,
R: TATAAGATTAGTCAGGGCTCGC;
D3S1766 primer pair:
F: ACCACATGAGCCAATTCTGT,
R: ACCCAATTATGGTGTTGTTACC;
D3S4554 primer pair:
F: CAATACGGGCTGATGATAGG,
R: TGGAAATGCTCCCATAGATT;
D3S2388 primer pair:
F: TCCACTCAGTACAAGTCTGGG,
R: GATCCTGTGGTTTGTCGATC;
D3S4551 primer pair:
F:AGTCATTGTCAGGCATTGGT,
R:ATATGACCTTGGGCAACAAA;
D3S2422 primer pair:
F:ACTGAGAAAGTCTTTCTGTGCC,
R:GTTCACCATCTACAGTGGGC;
D3S3051 primer pair:
F: GGCAATTAGTTATGTAGCAATCG,
R: TGAGTCAATTGTGCTGGCTA;
D3S3053 primer pair:
F: TCTTTGCTCTCATGAATAGATCAGT,
R: GTTTGTGATAATGAACCCACTCAG;
D4S2364 primer pair:
F: AACAAAACTAGGAGATCATGTGG,
R: ACCTTGACTTTGATGTGGGA;
D4S2404 primer pair:
F: ATATATATGATGCATGTCAAAATGG,
R: CTGGGCAAACTCATTTCAAC;
AC001348A primer pair:
F: CAACCATCAGTGATTTGATGGTTTA,
R: CTGTTCTTCTTAATCCTTAACCAGT;
AC001348B primer pair:
F: TCTCAGTCCTGATTTCTTGATTTTG,
R: CCAGAGCTAACACCACATTCA;
D17S975 primer pair:
F: AGTAATGGGACTTCTCGGCT,
R: TAGGATCCCAAGTGTGCAGT;
D17S1294 primer pair:
F: TGGCATGCAATTGTAGTCTC,
R: TTCTTTCCTTACTAAGTTGAGAACG。
2. AS-STR locus fluorescence labeling composite amplification system as claimed in claim 1, it is characterized in that, described 15 AS-STR locus set up 7 linkage groups, respectively: I: D3S2402-D3S2452-D3S1766; II: D3S4554-D3S2388; III: D3S4551-D3S2422; IV: D3S3051-D3S3053; V: D4S2364-D4S2404; VI: AC001348A-AC001348B; VII: D17S975-D17S1294.
3. the AS-STR locus fluorescence labeling composite amplification system described in claim 1 or 2 is assert the application in Relationship iden-tification.
4. the AS-STR locus fluorescence labeling composite amplification system described in claim 1 or 2 is carrying out the application in the detection of antenatal diagnosis to euchromosome dependency inherited disease.
5. a test kit, comprises the mixture that amplimer in the AS-STR locus fluorescence labeling composite amplification system described in claim 1 or 2 is right.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510190395.0A CN104911257A (en) | 2015-04-21 | 2015-04-21 | AS-STR locus fluorescent labeling composite amplification system and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510190395.0A CN104911257A (en) | 2015-04-21 | 2015-04-21 | AS-STR locus fluorescent labeling composite amplification system and application thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104911257A true CN104911257A (en) | 2015-09-16 |
Family
ID=54080697
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510190395.0A Pending CN104911257A (en) | 2015-04-21 | 2015-04-21 | AS-STR locus fluorescent labeling composite amplification system and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104911257A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114410798A (en) * | 2021-12-20 | 2022-04-29 | 中山大学 | Multiplex amplification detection system for chain STR loci on human chromosome I and chromosome II and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101413030A (en) * | 2008-11-25 | 2009-04-22 | 中山大学 | Fluorescence labeled X-STR locus composite amplification system and use thereof |
-
2015
- 2015-04-21 CN CN201510190395.0A patent/CN104911257A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101413030A (en) * | 2008-11-25 | 2009-04-22 | 中山大学 | Fluorescence labeled X-STR locus composite amplification system and use thereof |
Non-Patent Citations (2)
Title |
---|
MUHAMMAD ASLAM ET AL: "A Novel Autosomal Recessive Nonsyndromic Hearing Impairment Locus (DFNB42) Maps to Chromosome 3q13.31-q22.3", 《AMERICAN JOURNAL OF MEDICAL GENETICS》 * |
QIU-LING LIU ET AL: "Genetic polymorphism of 13 non-CODIS STR loci in three national populations from China", 《ELECTROPHORESIS》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114410798A (en) * | 2021-12-20 | 2022-04-29 | 中山大学 | Multiplex amplification detection system for chain STR loci on human chromosome I and chromosome II and application thereof |
CN114410798B (en) * | 2021-12-20 | 2023-11-03 | 中山大学 | System for detecting composite amplification of chain STR loci on human chromosome one and chromosome two and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103221551B (en) | HLA gene type-SNP interlocking data storehouse, its construction process and HLA classifying method | |
CN103045591B (en) | HLA gene specific PCR amplification primer, HLA typing method and kit | |
WO2011053790A2 (en) | Assay of closely linked targets in fetal diagnosis and coincidence detection assay for genetic analysis | |
ITTO20070307A1 (en) | METHOD AND DEVICE FOR NON-INVASIVE PRENATAL DIAGNOSIS | |
CN102250883B (en) | Fluorescent labeled X-STR gene locus multiplex PCR method and application thereof | |
CN104017895A (en) | Composite amplification kit for 26 Y chromosome short tandem repeats | |
CN104651488B (en) | Detect the Amplification thing and quick detection kit of chromosome aneuploid numerical abnormality | |
Yan et al. | Reliable detection of paternal SNPs within deletion breakpoints for non-invasive prenatal exclusion of homozygous α0-thalassemia in maternal plasma | |
CN106939350A (en) | Detection kit, detection method and its application of thalassemia associated gene mutation | |
CN101956004A (en) | Fluorescent-marked 16 X-STR loci multiplex amplification system and application thereof | |
CN102834525B (en) | Use the method for PCR and the HLA somatotype of crude blood | |
CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
CN106399479A (en) | SNP typing kit used for detecting susceptibility genes of type-II diabetes | |
CN104911257A (en) | AS-STR locus fluorescent labeling composite amplification system and application thereof | |
Tristezza et al. | An optimized protocol for the production of interdelta markers in Saccharomyces cerevisiae by using capillary electrophoresis | |
CN112342303A (en) | NGS-based human Y chromosome STR and SNP genetic marker combined detection system and detection method | |
CN109929936B (en) | Fluorescence labeling multiplex amplification kit for detecting human Y chromosome rapid mutation STR locus and application | |
CN101413030B (en) | Fluorescence labeled X-STR locus composite amplification system and use thereof | |
CN106701746B (en) | High-throughput malt Purity technology based on Capillary Electrophoresis and SSR marker | |
CN101787396B (en) | X-STR locus fluorescence labeling composite amplification system and application thereof | |
CN109762909A (en) | A kind of 44 site InDels composite amplification detection kits for sample medical jurisprudence individual appreciation of degrading | |
CN102146443B (en) | Specific primer for detecting Leber hereditary optic neuropathy mitochondrial DNA mutation G10680A | |
CN112011622B (en) | Method and system for analyzing non-east Asia and European population sources of individuals with unknown sources | |
CN105506066B (en) | Cell identification method for new-generation noninvasive prenatal diagnosis field | |
CN104673907B (en) | A kind of system and its detection method that STR partings are examined for high flux |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150916 |