CN105506066B - Cell identification method for new-generation noninvasive prenatal diagnosis field - Google Patents

Abstract

The invention provides a cell identification method applied to the field of new-generation noninvasive prenatal diagnosis, which comprises the following steps: (1) extracting samples of pregnant women and partners thereof, extracting DNA, and carrying out STR genotyping on the DNA; (2) subjecting the blood sample of the pregnant woman to density gradient centrifugation to obtain a cell suspension or a cervical secretion sample, and screening the cell suspension through a cell screen to obtain a cell suspension; (3) sorting target cells, carrying out whole-gene amplification, carrying out high-throughput sequencing, and carrying out STR genotyping; (4) and judging whether the fetal cells are successfully separated from the mother or not according to the STR genotyping result.

Description

Cell identification method for new-generation noninvasive prenatal diagnosis field

Technical Field

The present invention relates to the field of prenatal diagnosis. More particularly, the invention relates to identification of fetal cells.

Background

The current prenatal diagnosis methods are mainly divided into invasive prenatal diagnosis and noninvasive prenatal diagnosis according to different material taking methods. The invasive prenatal diagnosis mainly comprises villus puncture and amniotic fluid puncture, the method can obtain complete fetal genome, obtain accurate diagnosis results and become the gold standard of prenatal diagnosis, but the sampling process is traumatic, so that potential harm is brought to pregnant women and fetuses. The non-invasive diagnosis method mainly comprises ultrasonic examination, maternal peripheral serum marker determination, fetal cell detection and the like. Among them, the ultrasonic inspection is more used in combination with other detection methods due to the limitations of resolution and accuracy, and is mainly used as a primary screening method. Until 1997, Luyuming et al discovered that fetal free DNA was present in the plasma of pregnant women [1], and subsequently, studies for detecting fetal chromosomal abnormalities using free DNA in the peripheral blood of pregnant women in combination with high throughput sequencing technologies have been increasing [2,3,4,5 ]. The method has the advantages of high sensitivity and specificity, and no wound to fetus. Therefore, noninvasive prenatal diagnosis techniques based on maternal peripheral blood free DNA are increasingly accepted by hospitals and pregnant women [6 ].

However, the utilization of fetal free DNA has its own drawbacks, since the peripheral blood of pregnant women has a large background of maternal DNA in addition to fetal-derived free DNA, and DNA is present in small fragments, which is not conducive to the detection of other genetic mutations such as monogenic diseases. Because of this, scientists are looking for a non-invasive method to obtain the complete fetal genome. Research shows that the peripheral blood and cervical secretion of pregnant women contain fetal cells [7,8,9,10,11 ]]The fetal cells are completely derived from the fetus, contain the complete fetal genome, and cover all the genetic information of the fetus. Thus, the use of fetal cells present in the mother for prenatal diagnosis would be an extension and complement of current prenatal diagnoses based on fetal free DNA. However, because of the extreme rarity of fetal cells in the peripheral blood of pregnant women, there are only about 1-2 fetal nucleated red blood cells per ml of whole blood, about 10⁵-10⁷Only one foetal cell of a maternal cell [7,8 ]](ii) a The cervical secretion is rich in fetal cells, and about 2000 maternal cells contain one fetal cell [10, 11%](ii) a To obtain a complete fetal genome, the target fetal cells are isolated from a large background population of cells in the mother.

Many technical methods for isolating fetal cells from mothers have been reported, and mainly used methods include density gradient centrifugation [12,13,14,15], flow cytometry and fluorescence-activated cell sorting (FACS) [16,17,18,19,20], magnetically-activated cell sorting (MACS) [21,22,23,24,25,26,27], micromanipulation separation [28,29], and microfluidic separation [30,31 ]. These methods have advantages and disadvantages, respectively, and are generally used in combination. Fetal cells are isolated by the technical means, and after whole genome amplification, enough DNA is obtained for sequencing, so that various genetic variations of a fetus, including chromosome number abnormality, point mutation and the like, can be detected. The technology combines the accuracy of invasive prenatal diagnosis, namely that fetal cells are completely from fetuses and the noninvasive property of noninvasive prenatal diagnosis, only needs the peripheral blood of pregnant women, and can be called as a new-generation noninvasive prenatal diagnosis technology.

In the noninvasive prenatal diagnosis of the new generation, most importantly, various technical methods are used for separating fetal cells, all the existing separation methods need to distinguish the cells by virtue of antigen-antibody reaction, and are limited by antigen specificity, the separated target cells have a plurality of false positives which are not all fetal cells, if the target cells are male fetus, the specific primers on the Y chromosome can be used for identifying whether the cells contain Y specific genes, and meanwhile, exogenous pollution cannot be eliminated; in the case of female fetus, it cannot be identified by Y. If all the separated cells are sequenced, the cost is higher and the period is longer. This requires cell identification after cell isolation and before on-machine sequencing, which can accurately determine which cells are the target fetal cells, which are the maternal cells, and which are contaminated with foreign DNA regardless of fetal sex.

Disclosure of Invention

In view of the above, the present invention provides a cell identification method applied to the field of new-generation noninvasive prenatal diagnosis, comprising the steps of:

(1) extracting samples of pregnant women and partners thereof, extracting DNA, and carrying out STR genotyping on the DNA;

(2) subjecting the blood sample of the pregnant woman to density gradient centrifugation to obtain a cell suspension, and screening the cervical secretion sample through a cell screen to obtain a cell suspension;

(3) sorting target cells, carrying out whole-gene amplification, carrying out high-throughput sequencing, and carrying out STR genotyping;

(4) and (3) detecting whether the separated cell gene amplification (such as multiple displacement amplification) products have the father-specific STR types or not according to the STR genotyping result and the STR types of different parents under the same STR locus, and if so, determining that the fetal cells are successfully separated from the mother.

In a specific embodiment, the STR gene of the method of the invention is selected from the 16 loci DYS456, DYS 389I, DYS390, DYS389 II, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA _ H4, DYS437, DYS438, DYS448 on the 8 autosomal loci D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA and Y chromosomes.

The invention is a perfect combination of the cell identification method in the field of new-generation noninvasive prenatal diagnosis, integrates an effective cell identification method between fetal cell separation and sequencing, can more accurately judge the cell source, eliminate pollution, improve the effectiveness of sequencing data and further improve the accuracy of noninvasive prenatal detection.

Drawings

FIG. 1: after microfluidic sorting, target cells (400X) were searched under a fluorescence microscope, and our target cells were cells positive for hochests, positive for CD71 and negative for CD45, and the upper row from left to right was the hochests staining result and the CD71 fluorescence respectively, and the lower row from left to right was the overlapping effect graph of CD45 fluorescence, hochests, CD71 and CD45 respectively.

FIG. 2: the separated cells are subjected to whole genome amplification products and parental genome DNA, 8-pair of the parental genes are subjected to quality control, the amplification effect is roughly evaluated, from left to right, the results show that the cell-1 and the cell-2 have more than 5 bands respectively through a marker, the cell-1, the cell-2, maternal gDNA, paternal gDNA, a positive control, a blank control and a marker, and the whole genome amplification effect is preliminarily considered to be better.

FIG. 3: the cellular MDA products were STR typed separately from the parental genome, including 16 loci DYS456, DYS 389I, DYS390, DYS389 II, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA _ H4, DYS437, DYS438, and DYS448 on the 8 autosomal loci D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA and Y chromosomes, which intercepted only the detection of the mother 8 STR loci.

FIG. 4: and (3) calculating the copy rate of each chromosome from data obtained after high-throughput sequencing of the target cells identified by the STR, wherein 1-24 in the table respectively refer to number 1-22 autosomes and X, Y chromosomes, the vertical axis represents the copy rate, the dark color represents the sample cell-1, and the light color represents the cell-2, and the two cells are shown as 18-trisome.

Detailed Description

In recent years, a number of studies have shown that genotyping methods are the most efficient and accurate methods for identifying cell contamination. STR (short tandem repeat) is a short tandem repeat structure with a core sequence of 2-6 bases [32], STR sequences in a human genome are abundant, one STR sequence appears every 6kb-10kb on average [33], and most STRs are located in non-coding regions. About half of the STRs have genetic polymorphisms. While not wishing to be bound by a particular theory, the inventors believe that this provides a basis for personal identification and characterization. STR genotyping has the following advantages: the method has the advantages that firstly, the information is highly abundant, a plurality of STR loci can be analyzed simultaneously, and pollution can be judged accurately; secondly, the kit is highly sensitive, can detect the lowest 0.1ng DNA (about 15 diploid genomes), can meet the requirements of a micro sample, and can detect early pollution; thirdly, a high-throughput and systematization platform: the automatic analysis system can be used for detecting and analyzing a large amount of data, and the result is more accurate and objective. In addition to STR genotyping, SNP (Single Nucleotide polymorphism) genotyping can also achieve the same effect, SNP (Single Nucleotide polymorphism) is polymorphism of a DNA sequence caused by Single Nucleotide variation at the genome Nucleotide level, one SNP exists in every 1000 nucleotides in a human genome, theoretically, each SNP site can have three different variation forms, and SNP genotyping can also be applied to cell identification.

Compared with the existing noninvasive prenatal diagnosis technology, the new generation noninvasive prenatal diagnosis technology has the following advantages that high-throughput sequencing is adopted to analyze fetal cells, and various information including chromosome aneuploidy, chromosome deletion and insertion, single site variation and the like can be obtained at one time. Cell identification is the most critical step in the whole new generation of noninvasive prenatal diagnosis and has the following meanings:

firstly, whether the cells are separated into fetal cells can be judged through cell identification, whether the cells are male or female, if the genomes of parents exist, the cell sources can be identified through STR typing, and the success or failure of the sorted cells can be judged.

Secondly, whether the sorted cells are polluted by other non-fetal cells can be judged through cell identification, such as the most common abundant maternal cell background, exogenous DNA pollution possibly introduced in the whole genome amplification process can be eliminated, and the credibility of sequencing data is ensured.

In addition, the sequencing cost can be reduced through cell identification, and if STR typing identification is not carried out, the pollution of cells or DNA cannot be eliminated, and the data effectiveness is directly influenced.

The invention relates to the separation of fetal cells commonly used at present, and combines a second generation sequencing technology to detect the aneuploidy of fetal chromosomes, the deletion and insertion of the fetal chromosomes and the Single Nucleotide Polymorphism (SNP) in a genome. The invention aims to integrate cell identification into the non-invasive prenatal diagnosis method so as to accurately judge the cell source and eliminate pollution, thereby improving the accuracy of non-invasive prenatal diagnosis.

Although the invention uses the pregnant woman peripheral blood sample in the specific embodiment, the invention can also be a cervical secretion sample, different sample processing modes are different, and the final result is that single cell suspension is obtained; in this embodiment, a platform such as a microfluidic platform is used in combination with microdissection, but not limited to this platform, a flow cytometry sorting platform, or micromanipulation, etc. may also be used; the QIAGEN whole genome Amplification kit is used in the embodiment of the invention, the Amplification principle is Multiple Displacement Amplification (MDA), and the kit can be used based on the technical principle; 8 pairs of housekeeping genes used in the embodiment of the invention are from very conservative DNA sequences in human genomes, and other housekeeping genes can also be used for primarily evaluating the whole genome amplification effect; in the present example, the cells were identified by ABI

MiniFiler^TMPCR Amplification Kit and 3130xl Genetic Analyzer analysis platform, but in the practical application is not limited by the Kit and the sequencing platform, for example, mass spectrum SNP typing and other methods can also be adopted; used in this example is

Of a companySequencing apparatus and principle method, but is not limited in practical application by the sequencing platform used, e.g., one can use

Company sequencing platform or

SOLIDTM sequencing platform, etc. In this embodiment, a second generation sequencing technology is combined, and a third generation sequencing technology and a fourth generation sequencing technology can also be combined.

The method mainly comprises the following steps:

(1) providing a family sample comprising a blood sample or a cervical secretion sample of a pregnant woman and a blood sample of a husband of the pregnant woman;

(2) subjecting the blood sample of the pregnant woman to density gradient centrifugation to obtain a cell suspension, screening the cervical secretion sample through a cell screen to obtain a cell suspension, and extracting DNAs of the pregnant woman and a pregnant woman husband respectively;

(3) sorting target cells and carrying out whole gene amplification;

(4) quality control of amplification effect and cell identification;

(5) sequencing by a high-throughput sequencer;

the method described above was specifically carried out in this experiment as follows:

collecting a proper amount of peripheral blood of a couple of a pregnant woman by using a heparin blood collection tube, reserving a part of peripheral blood, extracting DNA, and extracting the DNA by using a QIAGEN commercial kit; using the rest pregnant woman peripheral blood specimen without Ca²⁺、Mg²⁺0.1M Phosphate Buffered Saline (PBS) was diluted at a ratio of 1: 1; adding 2mL of separating medium 1119 (the separating medium is from Sigma company in the United states) into a marked 15mL centrifuge tube, then slowly adding 2mL of separating medium 1110 and 1077 (the separating medium is from Sigma company in the United states), and finally slowly adding a blood sample diluted by 1:1 volume of PBS for 800g multiplied by 20min at a lifting rate of 1 level; two cell layers can be seen after centrifugation, the cell layers at 6ml and 4ml are carefully sucked out and transferred into a new 15ml centrifuge tube, the cell layer at 6ml is preserved for standby, and the cell layer at 4ml is a target cell layer; after transfer to cellsThe pipe of (2) is added with Washing Medium1640 (gibco)^@by Life technologies ^TM) About 10mL, mix the cells gently, the movements should be gentle, prevent the cell rupture; 500g multiplied by 5min, the lifting speed is 1, the supernatant is discarded, the volume of the residual liquid is less than 50 mu L, and the cells are blown away; adding 200 mu L of capture antibody with the concentration of 5 ng/. mu.L, and incubating at room temperature for 1 h; microfluidic system for sorting cells [30 ]]First, primary antibodies including rabbit anti-human CD71 and mouse anti-human CD45 (both antibodies from ABCAM, working at 0.5mg/mL) were administered; secondary antibody immunization was then performed, against donkey anti-rabbit IgG-Alexa 488 and donkey anti-mouse IgG-Alexa 555 (antibodies from INVITROGEN, working at 1 mg/mL); finally, hochests (life technologies) are dyed, a target cell emitting green fluorescence is obtained through microdissection, the obtained target cell is subjected to whole genome Amplification, and the Amplification principle is Multiple Displacement Amplification (MDA); amplifying to obtain enough DNA, and primarily evaluating the amplification effect by using 8 pairs of primers with sequences of eight pairs of primers

18-F/GGCAACGCTTAGACTCTGTGTG(SEQ ID NO.1),

18-R/CTGCCCTTGGCCTAA-CTAACCT(SEQ ID NO.2)；

12F/GTTCCTCAAGAAGCTGCACGAG(SEQ ID NO.3),

12-R/CGTTAGA-CTCTGGATCTGGCGT(SEQ ID NO.4)；

16-F/CCAGCCAATTCATGAGTCGGTG(SEQ ID NO.5),

16-R/CCTGACAACTCGCAAGTAGCAC(SEQ ID NO.6)；

17-F/GCTCAATGGGGTACTT-CAGGGT(SEQ ID NO.7),

17-R/GTGGACGTTACGTAAAAGGCCC(SEQ ID NO.8)；

19-F/TGCTCTGG-ATGTGAAGATGCCA(SEQ ID NO.9),

19-R/TTCCAGGTAAATCCAGCCCAGG(SEQ ID NO.10)；

3-F/CAGCCAGTCAGCATCATCCAAC(SEQ ID NO.11)；

3-R/GAAAGCCGGATTGCGGTA-ACAT(SEQ ID NO.12)；

8-F/GGATAGCTCTGCAAGGGGAGAG(SEQ ID NO.13),

8-R/TCGTCGCAGTA-GAAATACGGCT(SEQ ID NO.14)；

22-F/AGAAGTCAGGCACGTAGCTCAG(SEQ ID NO.15),

22-R/GG-CACGTTGGTGTTTACGATGA(SEQ ID NO.16)。

The amplification system is as follows:

dNTP(2.5mM)3.2μL，

TAKARA 10*PCR buffer 3μL，

Housekeeping primer mix 3μL，

BSA 0.2μL，

TAKARArTaq 0.4μL，

the MDA product is 0.5 mu L,

ddH ₂30 mu L of O19.7 mu L;

the reaction conditions are as follows:

95℃ 5min；

35 cycles:

95℃ 30s，

58℃ 50s，

72℃ 1min；

72℃5min；

4℃hold。

then, commercial ABI is selected

MiniFiler^TMGenotyping was performed using PCR Amplification Kit and 3130xl Genetic Analyzer analysis software; according to the typing result of the family, detecting whether the separated cell MDA product has the STR type peculiar to the father or not under the same STR locus and different from the parents, and if so, determining that the cell is successfully separated from the mother into the fetal cell; and then breaking the target cell MDA product, building a library according to the library building requirement of a corresponding sequencer, performing on-machine sequencing, and analyzing off-machine data.

Examples

One sample was from a pregnant woman with clinical findings and the free DNA analysis showed 18-trisomy. In this experiment, 5ml of peripheral blood of pregnant women was drawn, blood was collected with a heparin blood collection tube, and blood samples were taken with Ca-free blood²⁺、Mg²⁺0.1M Phosphate Buffered Saline (PBS) was diluted at a ratio of 1: 1; 2mL of the isolate 1119 (from the isolate) was added to a 15mL centrifuge tubeFrom Sigma company, usa), then 2mL of separating medium 1110 and 1077 (both of which are from Sigma company, usa) are added gently, and finally a blood sample diluted with PBS at a volume of 1:1 is added gently, 800g × 20min, and the lifting rate is 1 step; after centrifugation, two cell layers can be seen at 6ml and 4ml, the cell layers at 6ml and 4ml are carefully sucked out and transferred into a new 15ml centrifuge tube, the cell layer at 6ml is preserved for standby, and the cell layer at 4ml is a target cell layer; washing Medium1640 (from gibco) was added to the tube after cell transfer^@by Life technologies^TMCompany) about 10mL, gently mixing the cells, and gently moving to prevent cell rupture; 500g multiplied by 5min, the lifting speed is 1 gear, the supernatant is discarded, the volume of the residual liquid is less than 50 mu L, and the cells are blown away; the capture antibody (from R) was diluted with 200. mu.L ABDS (PBS + 2% donkey serum)&D SYSTEMS company), the capture antibody mainly comprises goat anti-human CD71 and goat anti-human CD147, the capture antibody can be specifically combined with the cell surface antigen, the other end of the capture antibody can be combined with the microfluidic chip, and the capture antibody with a certain concentration and the cell suspension are uniformly mixed for 1h in a dark manner for later use.

In addition according to requirements [30 ]]Assembling the chip, checking for leaks, and checking for leaks with 200 μ L ddH, if no leaks are determined₂Dissolving 8mg EDC (1-ethyl- (3-dimethylaminopropyl) carbodiimide hydrochloride) by O, dissolving NHS (N-hydroxy thiosuccinimide sodium salt) by using the dissolved EDC solution, modifying the microfluidic surface chemical substance by using the solution through a microfluidic device at the speed of 200 muL/h, washing by using PBS after the modification is finished, then modifying the chip again by using 20 muL enzyme avidin (SA, INVROGEN) dissolved by using 200 muL PBS, washing by using PBS after the chip modification is finished, adding 800uL ABDS (PBS + 2% donkey serum) into the cells incubated with the capture antibody, centrifuging by 300g multiplied by 5min after the mixing, abandoning the supernatant, suspending the cells in 200 muLLoading Buffer (1640Medium + 10%), passing the cell suspension through the FBS at the speed of 200 muL/h, washing the chip by using ABDS after the cell suspension is finished, then using 200 uL ABDS diluted primary antibody, the primary antibody mainly comprises rabbit anti-human CD71 and mouse anti-human CD45 (the antibody is from ABCAM company, the working concentration is 0.5mg/mL), and passing through the chip at the speed of 200 uL/h; the chip was washed with ABDS as above, and secondary antibody diluted with 200. mu.L of ABDS, which was primaryIncluding donkey anti-rabbit IgG-Alexa 488 and donkey anti-mouse IgG-Alexa 555 (antibodies from INVITROGEN corporation, working concentration 1 mg/mL); passing through the chip at a speed of 200 muL/h; after washing the chip with ABDS as above, the chip was detached and 1 drop of dye hochests (Life technologies) was added to 500. mu.L of PBS, and after half an hour, it was dried in the dark.

After drying, cells positive to hochests and positive to CD71 and negative to CD45 were selected as target cells as indicated in FIG. 1 and transferred to a 0.2ml PCR tube by operating according to Arcturus XT software instructions of the microdissector of ABI. Whole genome amplification was then performed using REPLI-g kit according to the instructions.

The product after whole genome amplification, which is called MDA product, uses 8 genes on human genome to carry out preliminary quality control on housekeeping genes, and the PCR quality control result of the housekeeping genes is shown in figure 2, so that the whole genome amplification effect is evaluated. We prefer more than 5 bands of MDA products for STR identification. STR identification is typically performed in a pedigree, in this example, because of the known males, STR loci include loci on the autosomal and Y chromosomes, 16 loci DYS456, DYS 389i, DYS390, DYS389 ii, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392, GATA _ H4, DYS437, DYS438, DYS448 on the 8 autosomes, D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, FGA, and Y chromosomes, respectively. The DNA of the pregnant woman and the husband and the ABI company used for STR identification are also identified

MiniFiler^TMPCR Amplification Kit and 3130xl Genetic Analyzer analysis STR results, the specific results are shown in FIG. 3, the results after arrangement are shown in Table 1, but the invention is not limited to the Kit and the platform; the detailed operation is shown in the instruction book of the kit and the instruction of the corresponding instrument. Taking the detected cell MDA product of the pregnant woman husband specific STR type as our target cell, and mixing the target cell MDA product

Hiseq2000 library construction published by the company official requires library construction and sequencing, the sequencing type is unilateral sequencing 50bp, and each sample obtains about 0.5G of data.

Comparing the sequenced DNA sequence with a human genome reference sequence in an NCBI database by using comparison software SOAP2 (obtained from SOAP. genetics. org. cn), so as to obtain the location of the sequenced DNA on the genome, and only selecting a sequencing sequence (read) which is uniquely compared with the human genome reference sequence in order to avoid the interference of a repetitive sequence on detection analysis. Defining windows with the length of W according to the reference genome, calculating the GC content of each window and calculating the number UR of sequencing sequence fragments falling on each window in a sample to be tested_sample. Because of GC bias, copy number bias can occur in high GC or low GC regions in the genome, and removal of bias is beneficial to improve accuracy. For UR_sampleAnd GC_refPlotting, fitting the scatter diagram into a smooth curve by using the Smoth spline method, and obtaining the unique alignment sequencing number, namely M, corresponding to each GC value from the fitted curve_fit，WGC＝M/M_fitAnd M is the number of UR of the sample to be detected falling in the windows with the same GC value, and the number of the corrected sequencing sequences of each window is calculated as follows: UR_fit＝UR_sample×W_GC. The total number of sequencing sequences and the total number of windows on 22 autosomes are calculated, the average number of sequencing sequences in each window is calculated, and the copy rate is set to be 1. The average number of sequencing sequences per window on each chromosome is then calculated and divided by the overall average number of sequencing sequences to obtain the copy rate of the entire chromosome. For sex first for the X and Y chromosomes, women were directly divided by the average number of sequenced sequences per window for the other 22 autosomes, and men were multiplied by 2. If the copy rate is abnormal, the result can be visually obtained through analysis, as shown in fig. 4.

TABLE 1

Genetic loci	Mother	Father and father	cell-1	cell-2
					D21S11	26/28/29	27/29/30	29/30	/26/28/29/30
D7S820	10/12	8/10	8/10	8/10/12
					CSF1P0	10/11	10/12	12	10/11/12
D13S317	8/10	9/11	9/11	8/9/11
					D16S539	11/12.2-13	11/13	11	11
D2S1338	17/20	24/25	20/24/25	17/20/25
					D18S51	13	13/20/21	13/20	13/20
AMEL	X	XY	XY	XY
					FGA
	22/23	23/25	23/25	22/23/25

Genetic loci	Mother	Father and father	cell-1	cell-4
					DYS456	Is free of	13/15/16	15	13/15/16
DYS389Ⅰ	Is free of	13	13	13
					DYS390	Is free of	24	24	24
DYS389Ⅱ	Is free of	29/30	29	29
					DYS458	Is free of	16	16	16
DYS19	Is free of	14	14	14
					DYS385	Is free of	11/14	11/14	11/14
DYS393	Is free of	13/14	13	13
					DYS391	Is free of	11	11	11
DYS439	Is free of	12	12	12
					DYS635	Is free of	25	25	25
DYS392	Is free of	13/14	13	13/14
					GATA_H4	Is free of	10/OL	10	10
DYS437	Is free of	15	15	15
					DYS438	Is free of	12	12	12
DYS448	Is free of	19	19	19

Table 1: based on the results in FIG. 3, the table shows the results of typing a total of 24 STR loci on autosomal and Y-staining of this line, with red markers considered as a heteropeak. From the table, it can be seen that both cell-1 and cell-2 contain STR types specific to the pregnant woman husband, indicating that we successfully sorted fetal cells, but that the sorted cells are not single homozygous cells because some STR sites of cell-1 and cell-2 have three different types.

Reference to the literature

[1]Lo YM,Corbetta NP,Chamberlain F,Rai V,Sargent IL,Redman CW,Wainscoat JS.(1997).Presence of fetal DNA in maternal plasma and serum.Lancet,350:485-487.

[2]Costa JM,Ernault P.(2002).Automated assay for fetal DNA analysis in maternal serum Clin Chem,48:679-680.

[3]Finning KM,Martin PG,Soothill PW,Avent ND.(2002).Prediction of fetal D status from maternal plasma:introduction of a new noninvasive fetal RHD genotyping service.Transfusion,42:1079-1085.

[4]C.Wright,PHG Foundation,2009,http://www.phgfoundation.org/pages/ffdna.html.

[5]Maddocks,Biochem.Soc.Trans.37(2009)460.

[6]Fan HC,Blumenfeld YJ,Chitkara U,Hudgins LS,Quake R.(2008).Noninvasive diagnosis of fetal aneuploidy by shotgun sequencing DNA from maternal blood.PNAS,105:16266-16271.

[7]Takabayashi H,Kuwabara S,Ukita T,Ikawa K,Yamafuji K,Igarashi T.(1995).Development of non-invasive fetal DNA diagnosis from maternal blood.Prenat Diagn,15:74-77.

[8]Bianchi DW,Williams JM,Sullivan LM,Hanson FW,Klinger KW,Shuber AP.(1997).PCR quantitation of fetal cells in maternal blood in normal and aneuploid pregnancies.Am J Hum Genet,61:822-829.

[9]Imudia AN,Kumar S,Diamond MP,Decherney AH,Armant DR.Transcervical retrieval of fetal cells in the practice of modern medicine:a review of the current literature and future direction.Fertil Steril 2010；93:1725–30.

[10]Imudia AN,Suzuki Y,Kilburn BA,Yelian FD,Diamond MP,Romero R,et al.Retrieval of trophoblast cells from the cervical canal for prediction of abnormal pregnancy:a pilot study.Hum Reprod 2009；24:2086–92.

[11]Bolnick JM1,Kilburn BA1,Bajpayee S1,Reddy N1,Jeelani R1,Crone B1,Simmerman N1,Singh M,et al.Trophoblast retrieval and isolation from the cervix(TRIC)for noninvasive prenatal screening at 5to 20weeks of gestation.Fertil Steril.2014Jul；102(1):135-142

[12]Kuo PL,Guo HR.(1999).Nucleated red blood cells in maternal blood during pregnancy.J Obstet Gynaecol,94:464–468.

[13]Sekizawa A,Farina A,Zhen DK,et al.(1999).Improvement of fetal cell recovery from maternal blood:suitable density gradient for FACS separation.Fetal Diagn Ther,14:229–233.

[14]Samura O,Sekizawa A,Zhen DK,Falco VM,Bianchi DW.(2000).Comparison of fetal cell recovery from maternal blood using a high density gradient for the initial separation step:1.090versus 1.119g/ml.Prenat Diagn,20:281–286.

[15]Smits G,Holzgreve W,Hahn S.(2000).An examination of different Percoll density gradients and magnetic activated cell sorting(MACS)for the enrichment of fetal erythroblasts from maternal blood.Arch Gynecol Obstet,263:160–163.

[16]Iverson GM,Bianchi DW,Cann HM,Herzenberg LA.(1981).Detection and isolation of fetal cells from maternal blood using the fluorescence-activated cell sorter(FACS).Prenat Diagn,1:61–73.

[17]Bianchi DW,Flint AF,Pizzimenti MF,Knoll JH,Latt SA.1990.Isolation of fetal DNA from nucleated erythrocytes in maternal blood.Proc Natl Acad Sci U S A 87:3279–3283.

[18]Price JO,Elias S,Wachtel S,et al.(1991).Prenatal diagnosis with fetal cells isolated from maternal blood by multiparameter flow cytometry.Am J Obstet Gynecol,165:1731–1737.

[19]Lewis DE,Schober W,Murrell S,et al.(1996).Rare event selection of fetal nucleated erythrocytes in maternal blood by flow cytometry.Cytometry,23:218–227.

[20]Wang JY,Zhen DK,Falco VM,et al.(2000).Fetal nucleated erythrocyte recovery:fluorescence activated cell sorting-based positive selection using anti-gamma globin versus magnetic activated cell sorting using anti-CD45depletion and anti-gamma globin positive selection.Cytometry,39:224–230.

[21]Ganshirt-Ahlert D,Borjesson-Stoll R,Burschyk M,et al.(1993).Detection of fetal trisomies 21and 18from maternal blood using triple gradient and magnetic cell sorting.Am J Reprod Immunol,30:194–201.

[22]Ganshirt-Ahlert D,Burschyk M,Garritsen HS,et al.(1992).Magnetic cell sorting and the transferrin receptor as potential means of prenatal diagnosis from maternal blood.Am J Obstet Gynecol,166:1350–1355.

[23]Busch J,Huber P,Pfluger E,Miltenyi S,Holtz J,Radbruch A.(1994).Enrichment of fetal cells from maternal blood by high gradientmagnetic sorting(double MACS)for PCR-based genetic analysis.Prenat Diagn,14:1129–1140.

[24]Campagnoli C,Multhaupt HA,Ludomirski A,Haut MJ,Warhol MJ.(1997).Noninvasive prenatal diagnosis:use of density gradient centrifugation,magnetically activated cell sorting and in situ hybridization.J Reprod Med,42:193–199.

[25]Valerio D,Aiello R,Altieri V.(1997).Isolation of fetal erythroid cells from maternal blood based on expression of erythropoietin receptors.Mol Hum Reprod,3:451–455.

[26]Troeger C,Holzgreve W,Hahn S.(1999b).A comparison of different density gradients and antibodies for enrichment of fetal erythroblasts by MACS.Prenat Diagn,19:521–526.

[27]Mavrou A,Kouvidi E,Antsaklis A,Souke A,Kitsiou Tzeli S,Kolialexi A.(2007).Identification of nucleated red blood cells in maternal circulation:A second step in screening for fetal aneuploidies and pregnancy complications.Prenat Diagn,27:150–153.

[28]Takabayashi H,Kuwabara S,Ukita T,Ikawa K,Yamafuji K,Igarashi T.(1995).Development of non-invasive fetal DNA diagnosis from maternal blood.Prenat Diagn,15:74–77.

[29]Sekizawa A,Purwosunu Y,Farina A,et al.(2007).Development of noninvasive fetal DNA diagnosis from nucleated erythrocytes circulating in maternal blood.Prenat Diagn,27:846–848.

[30]Zhao L1,Lu YT,Li F,Wu K,Hou S,Yu J,Shen Q,Wu D,Song M,Ouyang WH,Luo Z,Lee T,Fang X,Shao C,Xu X,Garcia MA,Chung LW,Rettig M,Tseng HR,Posadas EM.High-Purity Prostate Circulating Tumor Cell Isolation by a Polymer Nanofiber-Embedded Microchip for WholeExome Sequencing.Adv Mater.2013Mar 26.

[31]Hou S1,Zhao H,Zhao L,Shen Q,Wei KS,Suh DY,Nakao A,Garcia MA,Song M,Lee T,Xiong B,Luo SC,Tseng HR,Yu HH.Capture and stimulated release of circulating tumor cells on polymer-grafted silicon nanostructures.Adv Mater.2013Mar 20；25(11):1547-51

[32]Edwards A1,Civitello A,Hammond HA,Caskey CT.DNA typing and genetic mapping with trimeric and tetrameric tandem repeats.Am J Hum Genet.1991Oct；49(4):746-56.

[33]Lins AM1,Sprecher CJ,Puers C,Schumm JW.Multiplex sets for the amplification of polymorphic short tandem repeat loci--silver stain and fluorescence detection.Biotechniques.1996May；20(5):882-9.

Claims (2)

1. A method for non-invasive prenatal cell identification, the method comprising the steps of:

(1) extracting samples of pregnant women and partners thereof, extracting DNA, and carrying out STR genotyping on the DNA;

(2) carrying out density gradient centrifugation on a blood sample of the pregnant woman to obtain a cell suspension or passing a cervical secretion sample through a cell sieve to obtain a cell suspension;

(3) sorting target cells, carrying out whole-gene amplification, carrying out high-throughput sequencing, and carrying out STR genotyping;

(4) according to the STR genotyping result, detecting whether the separated cell gene amplification product has the STR type specific to the father under the same STR locus and different parents, and if so, successfully separating fetal cells from the mother;

the STR genes are loci D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, 16 loci DYS456, DYS 389I, DYS390, DYS 389II, DYS458, DYS19, DYS385, DYS393, DYS391, DYS439, DYS635, DYS392 YS, GATA _ H4, DYS437, DYS438, DYS448 on 8 autosomes;

the gene amplification is a multiple displacement amplification.

2. A set of STR genes for non-invasive prenatal cell identification, said STR genes being at loci D21S11, D7S820, CSF1P0, D13S317, D16S539, D2S1338, D18S51, 16 loci DYS456, DYS389 i, DYS390, DYS389 ii, DYS458, DYS19, DYS393, DYS391, DYS439, DYS635, DYS392, GATA _ H4, DYS437, DYS438, DYS448 on the 8 autosomes.

Images