CN104893993A - Application of Verticillum dahliae conidium yield related protein VdpdaA2 - Google Patents
Application of Verticillum dahliae conidium yield related protein VdpdaA2 Download PDFInfo
- Publication number
- CN104893993A CN104893993A CN201510297266.1A CN201510297266A CN104893993A CN 104893993 A CN104893993 A CN 104893993A CN 201510297266 A CN201510297266 A CN 201510297266A CN 104893993 A CN104893993 A CN 104893993A
- Authority
- CN
- China
- Prior art keywords
- vdpdaa2
- verticillium dahliae
- gene
- transgenic plant
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses application of a Verticillum dahliae conidium yield related protein VdpdaA2. The conidium yield of the VdpdaA2 gene knockout mutant obtained by knocking VdpdaA2 gene out of a Verticillum dahliae wild-type V592 strain is obviously lower than that of the Verticillum dahliae wild-type V592 strain, which indicates that the VdpdaA2 gene participates in the formation of conidia. The invention identifies the Verticillum dahliae conidium yield related protein VdpdaA2 and gene thereof, provides basis for further illuminating pathopoiesis mechanism of Verticillum dahliae, provides a pathogen resource for interaction mechanism research of Verticillum dahliae mutant (obtained by knocking VdpdaA2 gene out of the wild-type Verticillum dahliae strain) and host, and has important application value for control of cotton greensickness and culture of anti-Verticillum dahliae cotton new species.
Description
Technical field
The present invention relates to the purposes of verticillium dahliae conidium output associated protein VdpdaA2 in biological technical field.
Background technology
Cotton verticillium wilt is the fibrovascular system disease that a kind of soil passes, and caused by verticillium dahliae, it causes serious harm to the production of cotton.From nineteen thirty-five, cotton verticillium wilt imports China into along with the introduction of cotton seeds, just starts subsequently to spread the whole nation gradually.Especially after the nineties in 20th century, cotton verticillium wilt spreads very rapid in China's expansion, and wherein cotton verticillium wilt in 1993 is the most serious, and onset area reaches 266.67 ten thousand hm
2, break out continuously nationwide in 1995,1996,1999,2000,2002,2003 subsequently, loss is very serious, and cotton verticillium wilt has produced Cotton in China and Sustainable development forms great threat.
Cotton verticillium wilt belongs to (Verticillium) fungi by Deuteromycotina (Deutermycotina) light color Cordycepps (Mmonilaceae) Verticillium to cause, have several kinds in genus, that wherein endangers cotton has verticillium dahliae (V.dahliae) and black and white Verticillium (V.albo-atum) two kinds.Cotton in China verticillium is mainly caused by verticillium dahliae.Verticillium dahliae does not have host speciality, can endanger various plants, from annual herbaceous plant to perennial xylophyta.Verticillium dahliae can form a kind of dormancy structure being called black Microsclerotia, survival can reach the several years in the soil lacking host.
Verticillium dahliae is mainly survived the winter with the form of Microsclerotia, and Microsclerotia, as its topmost primary infection inoculum, just can be sprouted when being subject to the stimulation of plant root secretory product.Mycelia generally from plant root invade, along with the transpiration of plant expand in the cauline leaf of plant, field planting, finally infect whole plant.Generally all can be shown wilting by the plant that verticillium dahliae infected, the symptoms such as withered, vein is eclipsed, downright bad, vascular bundle browning is the most typical symptom of verticillium.
The research of Tian Li etc. thinks that the quantity of Microsclerotia is closely related in the generation development of cotton verticillium wilt and soil.Verticillium dahliae Microsclerotia number usually relevant with resistance to its virulence.There is research display, when Verticillium Dahliae Microsclerotia in soil reaches 0.03/g soil, cotton will be caused to occur wilting symptom, when Microsclerotia content in soil reaches 0.3/g soil ~ 1.0/g soil, just have the cotton plants morbidity of 20% ~ 50%, when Microsclerotia content in soil reaches more than 3.5/g soil, cotton plants all can be fallen ill.Separately there are some researches show, when Microsclerotia content in soil reaches the threshold value of 0.5/g soil for causing cotton to fall ill.Face down on the farm, when Huang withers after bacterium infects lettuce, the Microsclerotia quantity in soil is at least 50/g soil, and the field that disease is very heavy, Microsclerotia number is up to 2400/g soil.
Cotton is the insutrial crop that cultivated area is maximum in the world at present, is the second largest farm crop being only second to grain in China.Cotton verticillium wilt is the destructive fungal disease of most in current Cotton in China production process.Owing to not yet developing pesticide control and the disease-resistant variety of Be very effective so far, be called as " cancer " of cotton, therefore how control the Rampant damage of verticillium, become the key issue of Cotton Production Sustainable development.In this case, the pathogenesis of research verticillium dahliae, the mechanism of doing mutually understanding verticillium dahliae and host just seems even more important.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of verticillium dahliae conidium output associated protein VdpdaA2 or its gene.
For solving the problems of the technologies described above, the present invention provide firstly a kind of method preparing the restructuring verticillium dahliae that conidium output reduces.
A kind of method preparing the restructuring verticillium dahliae that conidium output reduces provided by the present invention, be the expression of the gene suppressing verticillium dahliae conidium output associated protein VdpdaA2 in object verticillium dahliae, obtain the restructuring verticillium dahliae of conidium output lower than described object verticillium dahliae;
Described verticillium dahliae conidium output associated protein VdpdaA2 is a) or b):
A) aminoacid sequence is the protein shown in SEQ ID No.1;
B) by the aminoacid sequence shown in SEQ ID No.1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation obtain have verticillium dahliae conidium output associated protein VdpdaA2 activity by a) derivative protein.
Wherein, SEQ ID No.1 is made up of 395 amino-acid residues.
Above-mentioned b) described in one or several amino-acid residue replacement and/or disappearance and/or be added to the replacement and/or disappearance and/or interpolation that are no more than 10 amino-acid residues.
Above-mentioned b) described in protein can synthetic, also can first synthesize its encoding gene, then carry out biological expression and obtain.
Above-mentioned b) described in the encoding gene of protein by the codon by lacking one or several amino-acid residue in the DNA sequence dna shown in SEQ ID No.2, and/or the missense mutation carrying out one or several base pair obtains.
In aforesaid method, the conidium output of the restructuring verticillium dahliae that described conidium output reduces is lower than described object verticillium dahliae; Described object verticillium dahliae is the verticillium dahliae of the gene containing described verticillium dahliae conidium output associated protein VdpdaA2, as verticillium dahliae wild type strain V592.
In aforesaid method, the expression of the gene of verticillium dahliae conidium output associated protein VdpdaA2 described in described suppression object verticillium dahliae is realized by the mode of the gene knockout by described verticillium dahliae conidium output associated protein VdpdaA2.
In aforesaid method, described gene knockout realizes by homologous recombination.
The restructuring verticillium dahliae that the conidium output of the method acquisition of the restructuring verticillium dahliae utilizing described preparation conidium output to reduce provided by the invention reduces also belongs to the scope of protection of the invention.
The material that suppression provided by the present invention described verticillium dahliae conidium output associated protein VdpdaA2 expresses, the material that suppresses the material of the genetic expression of described verticillium dahliae conidium output associated protein VdpdaA2 or reduce described verticillium dahliae conidium output associated protein VdpdaA2 activity also belong to the scope of protection of the invention cultivating the application in anti-verticillium dahliae plant.
In above-mentioned application, described anti-verticillium dahliae plant can be transgenic plant.
In above-mentioned application, described plant can be the host of verticillium dahliae; The host of described verticillium dahliae can be dicotyledons or monocotyledons; Described dicotyledons can be cotton, tomato, Sunflower Receptacle, cucumber etc.; Described monocotyledons can be paddy rice, corn, Chinese sorghum, wheat class, millet etc.; The host of described verticillium dahliae specifically can be cotton.
The material that suppression provided by the present invention described verticillium dahliae conidium output associated protein VdpdaA2 expresses, the application of material in preparation verticillium dahliae inhibitor suppressing the material of the genetic expression of described verticillium dahliae conidium output associated protein VdpdaA2 or reduce described verticillium dahliae conidium output associated protein VdpdaA2 activity also belong to the scope of protection of the invention.
In above-mentioned application, described verticillium dahliae inhibitor is that target spot screens by the gene of described verticillium dahliae conidium output associated protein VdpdaA2 or described verticillium dahliae conidium output associated protein VdpdaA2.
Above, the material of the genetic expression of described suppression verticillium dahliae conidium output associated protein VdpdaA2 can be the material of the genetic expression of interference verticillium dahliae conidium output associated protein VdpdaA2, the RNA that the inverted defined gene as the gene of microRNA, VdpdaA2 is expressed.
Present invention also offers described verticillium dahliae conidium output associated protein VdpdaA2, or the application of biomaterial in regulation and control verticillium dahliae conidium output that described verticillium dahliae conidium output associated protein VdpdaA2 is correlated with;
The biomaterial that described verticillium dahliae conidium output associated protein VdpdaA2 is relevant is following A 1) to A20) in any one:
A1) nucleic acid molecule; Described nucleic acid molecule is the nucleic acid molecule of coding verticillium dahliae conidium output associated protein VdpdaA2;
A2) containing A1) expression cassette of described nucleic acid molecule;
A3) containing A1) recombinant vectors of described nucleic acid molecule;
A4) containing A2) recombinant vectors of described expression cassette;
A5) containing A1) recombinant microorganism of described nucleic acid molecule;
A6) containing A2) recombinant microorganism of described expression cassette;
A7) containing A3) recombinant microorganism of described recombinant vectors;
A8) containing A4) recombinant microorganism of described recombinant vectors;
A9) containing A1) the transgenic plant cells system of described nucleic acid molecule;
A10) containing A2) the transgenic plant cells system of described expression cassette;
A11) containing A3) the transgenic plant cells system of described recombinant vectors;
A12) containing A4) the transgenic plant cells system of described recombinant vectors;
A13) containing A1) Transgenic plant tissue of described nucleic acid molecule;
A14) containing A2) Transgenic plant tissue of described expression cassette;
A15) containing A3) Transgenic plant tissue of described recombinant vectors;
A16) containing A4) Transgenic plant tissue of described recombinant vectors;
A17) containing A1) the transgenic plant organ of described nucleic acid molecule;
A18) containing A2) the transgenic plant organ of described expression cassette;
A19) containing A3) the transgenic plant organ of described recombinant vectors;
A20) containing A4) the transgenic plant organ of described recombinant vectors.
In above-mentioned application, described regulation and control verticillium dahliae conidium output can be and reduces verticillium dahliae conidium output.
In above-mentioned application, described nucleic acid molecule can be DNA, as cDNA, genomic dna or recombinant DNA; Described nucleic acid molecule can be also RNA, as mRNA or hnRNA etc.
Described nucleic acid molecule is following 1)-5) in arbitrary shown in gene:
1) its encoding sequence is cDNA molecule or the DNA molecular of SEQ ID No.2;
2) sequence is cDNA molecule or the DNA molecular of SEQ ID No.3;
3) with 1) nucleotide sequence that limits has more than 75% or 75% identity, and the cDNA molecule of the described verticillium dahliae conidium output associated protein VdpdaA2 that encodes or genomic DNA molecule;
4) with 2) nucleotide sequence that limits has more than 75% or 75% identity, and the cDNA molecule of the described verticillium dahliae conidium output associated protein VdpdaA2 that encodes or genomic DNA molecule;
5) under strict conditions with 1) or 2) or 3) or 4) nucleotide sequence hybridization that limits, and the cDNA molecule of the described verticillium dahliae conidium output associated protein VdpdaA2 that encodes or genomic DNA molecule.
The above-mentioned nucleic acid molecule for the described verticillium dahliae conidium output associated protein VdpdaA2 that encodes, those of ordinary skill in the art can adopt known method easily, the method of such as orthogenesis and point mutation, suddenlys change to the nucleotide sequence of the nucleic acid molecule of coding of the present invention described verticillium dahliae conidium output associated protein VdpdaA2.Those are through manually modified, the nucleotide sequence being separated the nucleic acid molecule of the coding obtained described verticillium dahliae conidium output associated protein VdpdaA2 with the present invention has 75% or higher identity and the described verticillium dahliae conidium output associated protein VdpdaA2 that encodes, and is all be derived from nucleotide sequence of the present invention and be equal to sequence of the present invention.
Term used herein " identity " refers to the sequence similarity with native sequence nucleic acid." identity " comprises and has 75% or higher with the DNA molecular shown in the 1-1188 position Nucleotide of SEQ ID No.2 of the present invention or cDNA molecule, or 85% or higher, or 90% or higher, or the nucleotide sequence of 95% or higher identity.75% or higher is had with the DNA molecular shown in the 1-1359 position Nucleotide of SEQ ID No.3 of the present invention or cDNA molecule, or 85% or higher, or 90% or higher, or the nucleotide sequence of 95% or higher identity.Identity can with the naked eye or computer software evaluate.Use computer software, the identity between two or more sequence can represent with per-cent (%), and it can be used for evaluating the identity between correlated series.
Described stringent condition is in the solution of 2 × SSC, 0.1%SDS, hybridizes and wash film 2 times, each 5min at 68 DEG C, again in the solution of 0.5 × SSC, 0.1%SDS, hybridizes and wash film 2 times, each 15min at 68 DEG C.
More than above-mentioned 75% or 75% identity, can be the identity of more than 80%, 85%, 90% or 95%.
Wherein, SEQ ID No.2 is made up of 1188 Nucleotide, and its encoding sequence is 1-1188 position, the protein shown in coding SEQ ID No.1.
In the biomaterial that above-mentioned and described verticillium dahliae conidium output associated protein VdpdaA2 is relevant, described expression cassette refers to the DNA that can express respective egg white matter in host cell, this DNA not only can comprise the promotor starting genes involved and transcribe, also can comprise the terminator that Stopping Phase correlation gene is transcribed, as A2) as described in containing the expression cassette of verticillium dahliae conidium output associated protein VdpdaA2 as described in coding, refer to the DNA that can express described verticillium dahliae conidium output associated protein VdpdaA2 in host cell.
In the biomaterial that above-mentioned and described verticillium dahliae conidium output associated protein VdpdaA2 is relevant, A5)-A8) in arbitrary described recombinant microorganism specifically can be bacterium, yeast, algae and fungi.Wherein, bacterium can from Escherichia (Escherichia), Erwinia (Erwinia), agrobacterium tumefaciens belongs to (Agrobacterium), Flavobacterium (Flavobacterium), Alcaligenes (Alcaligenes), Rhodopseudomonas (Pseudomonas), Bacillus (Bacillus) etc.A9)-A12) in arbitrary described transgenic cell line, A13)-A16) in arbitrary described Transgenic plant tissue, A17)-A20) in arbitrary described transgenic plant organ all do not comprise the reproductive material of plant.
Experiment proves, the VdpdaA2 knock out mutants body sporulation quantity obtained after VdpdaA2 gene knockout in verticillium dahliae wild type strain V592 bacterial strain is starkly lower than verticillium dahliae wild type strain V592 bacterial strain, VdpdaA2 gene is relevant to conidium output, shows that VdpdaA2 gene take part in conidial formation.In actual applications, the material (RNA that the inverted defined gene as microRNA, VdpdaA2 gene is expressed) can expressing interference VdpdaA2 genetic expression in object plant (as cotton) improves the resistance of object plant to verticillium dahliae, specifically the DNA (inverted defined gene as VdpdaA2 gene) of interference VdpdaA2 genetic expression can be imported in recipient plant the transgenic plant obtaining improving verticillium dahliae resistance.In actual applications, also can with verticillium dahliae conidium output associated protein VdpdaA2 or its gene for Sites Screening prevents and treats the medicine of verticillium dahliae.First identified of the present invention and verticillium dahliae conidium output associated protein VdpdaA2 and gene thereof, for the pathogenesis of illustrating verticillium dahliae further provides basis, by the verticillium dahliae mutant that the VdpdaA2 gene knockout of wild-type verticillium dahliae obtains be verticillium dahliae and host provide pathogenic bacteria resource as study mechanism mutually, the present invention has important using value to the control of cotton verticillium wilt and the new cotton variety of cultivating anti-verticillium dahliae.
Accompanying drawing explanation
Fig. 1 is pRF-HU2 carrier structure schematic diagram.
Fig. 2 is the structure schema of recombinant vectors pRF-HU2-PDA2.
Fig. 3 is the construction strategy figure of knockout carrier.
Fig. 4 is phenotype and the Southern hybridization verification result that verticillium dahliae VdpdaA2 knocks out mutant.Wherein, A is the phenotype that verticillium dahliae VdpdaA2 knocks out mutant; B is the Southern hybridization verification collection of illustrative plates that verticillium dahliae VdpdaA2 knocks out mutant: swimming lane 1 is verticillium dahliae wild type strain V592, and swimming lane 2 and 3 is respectively verticillium dahliae VdpdaA2 and knocks out mutant △ VdpdaA2-a and △ VdpdaA2-b.
The transcriptional level that Fig. 5 is VdpdaA2 gene in the sclerotium of verticillium dahliae wild type strain V592, mycelia and conidium.Wherein, 1 is conidium, and 2 is mycelia, and 3 is sclerotium.
Fig. 6 is the biological character that verticillium dahliae VdpdaA2 knocks out mutant.Wherein, scheming A is phenotypic results; Figure B is the measurement result of conidium output; Figure C is hypha form result; WT and V592 is verticillium dahliae wild type strain V592, and △ VdpdaA2 is for knocking out mutant △ VdpdaA2-a, and EC2 is the complementary transformant knocking out mutant VdpdaA2-a.
Fig. 7 is for knocking out the conidial sprouting of mutant △ VdpdaA2.WT is that verticillium dahliae wild type strain V592, △ VdpdaA2 are for knocking out mutant △ VdpdaA2-a.
Fig. 8 is for primer pair to carry out the agarose gel electrophoresis figure of the pcr amplification product that pcr amplification obtains to the genomic dna of V592 bacterial strain with PDA2-s and PDA2-x.Wherein, swimming lane M is marker2000; Swimming lane 1 is negative control, and swimming lane 2-7 is the pcr amplification product of VdpdaA2 full length gene.
Fig. 9 is the structural representation of carrier pSULPH-mut-RG#PB.
Figure 10 is the phenotype of complementary transformant.
Embodiment
Below in conjunction with embodiment, the present invention is further described in detail, the embodiment provided only in order to illustrate the present invention, instead of in order to limit the scope of the invention.
Experimental technique in following embodiment, if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Cotton verticillium wilt bacterial strain verticillium dahliae (V.dahliae) wild type strain V592 (Peng Shan in following embodiment, Lv Xuelian, peak etc. the research [J] of a kind of new cotton yellow, the quick inoculation method of blight. Cotton Science, 2008,20 (3): 174 ~ 178.) public can obtain from Shihezi Univ, this biomaterial related experiment of the present invention of only attaching most importance to again is used, not can be used as other purposes and uses.
Carrier pRF-HU2 (Ronnie de Jonge in following embodiment, H.Peter van Esse, Karunakaran Maruthachalam, et al.Tomato immune receptor Ve1recognizes effector of multiple fungal pathogens uncovered by genome and RNA sequencing [J] .PNAS, 2012,4 (27): 5110 ~ 5115.) public can obtain from Shihezi Univ, this biomaterial related experiment of the present invention of only attaching most importance to again is used, not can be used as other purposes and uses.This carrier there are two restriction enzyme site PacI and Nt.BbvCI do not had in any fungal organism genome, also containing fungi selected marker-Hygromycin marker and bacterial selectable marker-kantlex (Kan) mark, the schematic diagram of this carrier as shown in Figure 1.
Agrobacterium tumefaciens EHA105 (Feng Gao in following embodiment, Bang-Jun Zhou, Guo-Ying Li, et al.A Glutamic Acid-Rich Protein Identified in Verticillium dahliae from an Insertional Mutagenesis Affects icrosclerotial Formation and Pathogenicity [J] .PLos One, 2010, 12 (5): e15319) public can obtain from Shihezi Univ, this biomaterial related experiment of the present invention of only attaching most importance to again is used, not can be used as other purposes to use.
In following embodiment, cotton is cotton variety 108 husband (Gossypium hirsutum L.) (Peng Shan, Lv Xuelian, peak etc. the research [J] of a kind of new cotton yellow, the quick inoculation method of blight. Cotton Science, 2008,20 (3): 174 ~ 178.) public can obtain from Shihezi Univ, this biomaterial related experiment of the present invention of only attaching most importance to again is used, not can be used as other purposes and uses.
USER enzyme mix in following embodiment is NEB Products.
Being formulated as follows of associated antibiotic solution in following embodiment:
Totomycin (Hyg, Roche Holding Ag) working concentration 100 μ g/mL, cephamycin (Cef) working concentration is 300 μ g/mL, and kantlex (Kan) working concentration is 50 μ g/mL, and Rifampin (Rif) working concentration is 10 μ g/mL;
Syringylethanone (AS, 10mM): take 19.62mg Syringylethanone, dissolves with 10mL distilled water, and employing concentration is that the KOH solution of 5M regulates pH to 8 ,-20 DEG C of preservations after filtration sterilization.
2-N-agate beautiful jade ethyl sulfonic acid (MES, 1M): take 19.52g MES, dissolves with 80mL distilled water, and employing concentration is that the KOH solution of 5M regulates pH to 5.3, is then settled to 100mL and uses metre filter sterilizing ,-20 DEG C of preservations.
The glycerine of 10% (v/v): 10mL pure glycerin, 90mL distilled water, mixing.
The glycerine of 20% (v/v): 20mL pure glycerin, 80mL distilled water, mixing.
The altheine of 50mM: 6.6g altheine is dissolved in 1L distilled water, filtration sterilization.
200 × Trace solution for Vogels salts:5g citric acid, 5gZnSO
47H
2o, 1g Fe (NH
4)
2(SO
4)
26H
2o, 0.25g CuSO
45H
2o, 0.05g MgSO
4h
2o, 0.05g H
3bO
3, 0.05g Na
2mo O
42H
2o, 1000mL distilled water, filtration sterilization.
50 × Vogels salts:125g C
6h
9na
3o
9, 250g KH
2pO
4, 9.3g MgSO
46H
2o, 5g CaCl
22H
2o, 5mL 200 × Trace solution, is settled to 1000mL, filtration sterilization.
1000 × Trace elements for DFM medium:40mg Na
2b
4o
710H
2o, 400mg CuSO
45H
2o, 1.2g FeSO
47H
2o, 700mg MnSO
4h
2o, 800mg Na
2moO
42H
2o, 10g ZnSO
47H
2o, 1000mL distilled water, filtration sterilization.
2.5 × Salt solution:3.625g KH
2pO
4, 5.125g K
2hPO
4, 0.375g NaCl, 1.160g MgSO
46H
2o, 0.165g CaCl
22H
2o, 0.0062g FeSO
47H
2o, 1.250g (NH
4)
2sO
4, 1000mL distilled water, filtration sterilization.Often kind of component need take a dissolving one and avoid the formation of insolubles.
RA substratum: 50g Soduxin (C
4h
4o
4na
26H
2o), 12.1g NaNO
3, 20mL 50 × Vogels salts (– N ， – C), 950mL distilled water, autoclaving, with adding that the sterilized concentration of 50mL is the D/W of 20g/100mL before.
Water agar IMAS substratum: by 6g agar powder and the mixing of 146mL distilled water, autoclaving is preserved.Time microwave oven melt after add other composition of IMAS substratum.
IMAS solid medium: by 120.0mL 2.5 × Salt solution (60 DEG C of preheatings), 7mL concentration is the D/W of 20g/100mL, the glycerine of 7.5mL 20% (v/v) and the mixing of 146mL water agar IMAS substratum, make the ultimate density 2g/100mL of agar powder in mixed solution.When liquid to be mixed is cooled to 55 DEG C, then add 12.0mL MES (concentration is 1M), 6.0mL Syringylethanone (concentration is 10mM).
IMAS liquid nutrient medium: 120.0mL 2.5 × Salt solution (60 DEG C of preheatings), 7mL concentration is the D/W of 20g/100mL, the glycerine of 7.5mL 20% (v/v), 12.0mL MES (concentration is 1M), 6.0mL Syringylethanone (concentration is 10mM).
Water agar DFM substratum: by 10g agar powder and the mixing of 358mL distilled water, autoclaving is preserved.Time microwave oven melt after add other composition of DFM substratum.
DFM solid medium: be the D/W of 20g/100mL by 31.25mL concentration, 100.0mL concentration is the altheine (60 DEG C of preheatings) of 50mM, and 5.0mL concentration is the MgSO of 210mM
4, (pH value of solution A is 6 to 5.0mL solution A, is made up of solvent and solute, and solvent is water, and solute and concentration thereof are: the KH of 1.12M
2pO
4with the KCL of 0.7M), the water agar DFM substratum mixing of 0.5mL 1000 × Trace elements and 358mL, makes the final concentration of agar in mixed solution be 2g/100mL.Liquid to be mixed is cooled to 55 DEG C to add required microbiotic.
1% (w/v) water agar: mixed by the distilled water of the agar powder of 1g and 99mL, autoclaving is preserved.
Cha Shi liquid nutrient medium: 2g NaNO
3, 1g K
2hPO
4, 0.5g KCl, 0.5g MgSO
47H
2o, 0.01g FeSO
47H
2o, 30g sucrose, distilled water is settled to 1000mL; Autoclaving.
Table 1, primer sequence (underscore represents restriction enzyme site)
| Primer | Sequence (5 ' → 3 ') |
| PDA2up-s | GGTCTTAAUTAGAGCCCATCGACGAGGAGC |
| PDA2up-x | GGCATTAAUGAATATGTAGAGAGTGACTGAGGG |
| PDA2down-s | GGACTTAAUTGTAGTTCTTGCGCGCTCCTC |
| PDA2down-x | GGGTTTAAUACACTGATGCCGCGTTTGCAA |
| PDA2-s | ACGCGTCGACATGCAACTCTCACGTTCTCTCAAG |
| PDA2-x | GGACTAGTCTAAGCGCAGACGCCAAAGG |
| PDA2-qs | TCAAGACGGTGCTGGTG |
| PDA2-qx | CACAGAACTGGCGATGC |
| PDA2-ts | CTCTCAAGACGGTGCTGGTGT |
| PDA2-tx | ACGTGATCCGTAAAGCTGAAAGGG |
| β-tubline-f | TCACCAGCCGTGGCAAGGTTG |
| β-tubline-r | AGCAAAGGGCGGTCTGGACGTTG |
Embodiment 1, verticillium dahliae VdpdaA2 knock out the preparation of mutant
One, the preparation of recombinational agrobacterium pRF-HU2::PDA2
With the genomic dna of cotton verticillium wilt bacterial strain verticillium dahliae (V.dahliae) wild type strain V592 (being called for short V592 bacterial strain) for template, with PDA2up-s and PDA2up-x for primer carries out pcr amplification, obtain pcr amplification product, by the left homology arm fragment of its called after VdpdaA2 gene;
With the genomic dna of V592 bacterial strain for template, carry out pcr amplification with PDA2down-s and PDA2down-x for primer, obtain pcr amplification product, by the right homology arm fragment of its called after VdpdaA2 gene.
PacI and Nt.BbvCI restriction enzymes double zyme cutting pRF-HU2 carrier (Fig. 1) is adopted to obtain two linearized fragment of pRF-HU2 carrier.
Left for VdpdaA2 gene homology arm fragment, the right homology arm fragment of VdpdaA2 gene are connected with two linearized fragment of the pRF-HU2 carrier of acquisition, linked system is as shown in table 2,20min is hatched at 37 DEG C, then 20min is hatched at 25 DEG C, namely recombinant vectors is obtained, called after recombinant vectors pRF-HU2-PDA2 (Fig. 2).Checked order by recombinant vectors pRF-HU2-PDA2, result is correct, shows that VdpdaA2 gene left homology arm fragment and the right homology arm fragment of VdpdaA2 gene are inserted into pRF-HU2 carrier respectively.The nucleotide sequence of the left homology arm fragment of the VdpdaA2 gene in pRF-HU2-PDA2 is as shown in SEQ ID NO.4, and the nucleotide sequence of the right homology arm fragment of VdpdaA2 gene is as shown in SEQ ID NO.5.
Recombinant vectors pRF-HU2-PDA2 is transformed in agrobacterium tumefaciens EHA105, obtains recombinational agrobacterium, by its called after recombinational agrobacterium pRF-HU2::PDA2.
Table 2, USER clone system
Two, verticillium dahliae VdpdaA2 knocks out the preparation of mutant
1, the conidial acquisition of verticillium dahliae
Cultured V592 bacterial strain is bought bacterium cake some, and is inoculated in the 1L triangular flask containing 250mL RA substratum, 26 DEG C, the horizontal shaker of 200rpm shakes training 5d, obtain the culture of V592 bacterial strain.With in the 50mL centrifuge tube that the culture of sterilized micropore filter-cloth filtering V592 bacterial strain is extremely aseptic, then by filtrate centrifugal 40min under 14000g, 4 DEG C of conditions, abandon supernatant, collect bacterial sediment.Use 10mL ddH
20 Eddy diffusion bacterial sediment, then centrifugal 40min again under 14000g, 4 DEG C of conditions, abandons supernatant, collects bacterial sediment; Use 5mL ddH
20 Eddy diffusion bacterial sediment, obtains the conidial suspension of V592 bacterial strain.Use the conidium concentration in the conidial suspension of opticmicroscope and blood counting chamber mensuration V592 bacterial strain, then by the conidial suspension of V592 bacterial strain under 14000g, 8 DEG C of conditions after centrifugal 30min, collect conidium precipitation, with the conidium that the glycerine Eddy diffusion of 10% (v/v) precipitates, the conidium concentration finally obtained is 1 × 10
8the conidial suspension of cfu/mL.Conidial suspension is placed in-80 DEG C of preservations with every part of 1mL, 1 year can be preserved, treat that conidium concentration is adjusted to 1 × 10 with IMAS liquid nutrient medium by the used time
7cfu/mL.
2, the cultivation of recombinational agrobacterium
Single colony inoculation of recombinational agrobacterium pRF-HU2::PDA2 step one prepared is in 50mL triangular flask, 10mL being housed to contain concentration be 50 μ g/mL Kan (kantlex) and concentration is the LB liquid nutrient medium of 10 μ g/mL Rif (Rifampin), 28 DEG C, cultivate 1-2d under 100rpm condition, obtain the seed liquor of recombinational agrobacterium pRF-HU2::PDA2; The seed liquor of 100 μ L recombinational agrobacterium pRF-HU2::PDA2 is inoculated in 50mL Erlenmeyer flask, 10mL is housed and contains the IMAS liquid nutrient medium that concentration is 50 μ g/mL Kan, 28 DEG C, shake training under 100rpm condition to OD
600reach 0.5-0.7 (generally by second day), obtain recombinational agrobacterium pRF-HU2::PDA2 bacterium liquid.
3, recombinational agrobacterium pRF-HU2::PDA2 bacterium liquid step 2 obtained and the conidium concentration of step 1 are 1 × 10
7the conidial suspension equal-volume of cfu/mL mixes, and obtains mixed solution.Drawing 200 μ L mixed solutions and using spreader it to be coated uniformly is covered with on the IMAS solid medium of NC film, then 26 DEG C of light culture 36 hours.(Totomycin concentration is 150mg/mL aseptically NC film to be transferred to DFM from IMAS solid medium after cultivation terminates, cephamycin concentration is 300mg/mL) solid medium cultivates 6-8d, after growing transformant, transformant being transferred to PDA, (Totomycin concentration is 150mg/mL again, cephamycin concentration is 300mg/mL) continue in substratum to cultivate, its construction strategy is as Fig. 3.Select 2 transformants called after △ VdpdaA2-a and △ VdpdaA2-b respectively, its phenotype is as shown in A in Fig. 4.The gene of the verticillium dahliae pathogen-relatedprotein VdpdaA2 in V592 bacterial strain (being called for short VdpdaA2 gene) is knocked out the restructuring verticillium dahliae obtained by △ VdpdaA2-a and △ VdpdaA2-b.The aminoacid sequence of verticillium dahliae pathogen-relatedprotein VdpdaA2 is as shown in SEQ ID No.1, the genomic gene of verticillium dahliae pathogen-relatedprotein VdpdaA2 is as shown in SEQ ID No.3, and the cDNA gene of verticillium dahliae pathogen-relatedprotein VdpdaA2 is as shown in SEQ ID No.2.
Three, verticillium dahliae VdpdaA2 knocks out the checking of mutant
With the genomic dna of V592 bacterial strain for template, with PDA2-ts and PDA2-tx for primer carries out pcr amplification, obtain the PCR primer of V592 bacterial strain, using the PCR primer (the 17th in SEQ ID NO.3 to the nucleotide sequence shown in 422) of V592 bacterial strain as DNA probe, reference Riboprobe Systtem-SP6 probe mark test kit (is Promega product, catalog number is P1420) specification sheets, use α-[
32p] dCTP carries out the mark of DNA probe.The genomic dna of transformant (△ VdpdaA2-a and △ VdpdaA2-b) that obtains of extraction step two respectively, with PDA2-ts and PDA2-tx for primer, carry out Southern hybridization verification, whether the VdpdaA2 gene detected in transformant is knocked.
In Fig. 4, the result of B shows, can hybridize in V592 bacterial strain and obtain a bright band, the i.e. object fragment of VdpdaA2 gene, and two knock out in mutant △ VdpdaA2-a and △ VdpdaA2-b and do not hybridize corresponding band in corresponding position, this result illustrates that the VdpdaA2 gene knocked out in mutant △ VdpdaA2-a and △ VdpdaA2-b is knocked.
Four, the expression analysis of VdpdaA2 gene in V592 bacterial strain
Extract the sclerotium of V592 bacterial strain, mycelia and conidial RNA respectively, and reverse transcription is cDNA, take cDNA as template respectively, with PDA2-qs and PDA2-qx for primer, carries out fluorescent quantitation qRT-PCR.Using β-tubline gene (DQ266153) as reference gene, β-tubline-f and β-tubline-r is as primer.
In Fig. 5, result shows, the transcriptional level of VdpdaA2 gene in the mycelia of V592 bacterial strain is apparently higher than the transcriptional level in conidium and sclerotium, transcriptional level in sclerotium is minimum, shows that the expression of VdpdaA2 gene in V592 bacterial strain has tissue specificity.
Five, verticillium dahliae VdpdaA2 knocks out the biological character of mutant
First the verticillium dahliae VdpdaA2 that step 2 obtains being knocked out mutant △ VdpdaA2-a and △ VdpdaA2-b is transplanted on common PDA substratum respectively, 10d is cultivated at 26 DEG C, then respectively each bacterial strain is carried out to observation and the mensuration of following biological characteristics, with V592 bacterial strain for contrast.
1, cultural colony is observed
Buy at bacterial strain colony edge the bacterium cake that cut-off footpath is 1cm with punch tool, by pure culture biscuits involvng inoculation in PDA culture medium flat plate central authorities, at 26 DEG C of light culture 10d, according to the feature such as the colonial morphology of mutant strain and the number of black Microsclerotia, phenotype classification of type is carried out to mutant strain, criteria for classification reference: Peng Shan, Lv Xuelian, peak etc. the research [J] of a kind of new cotton yellow, the quick inoculation method of blight. Cotton Science, 2008,20 (3): 174 ~ 178.Result, as A in Fig. 6, shows to knock out mutant △ VdpdaA2-a and the phenotype of △ VdpdaA2-b on PDA substratum is sclerotium type, all produces the Microsclerotia of black, do not have obvious difference with V592 bacterial strain at the front and back of substratum.
2, colony growth rate measures
Buy at bacterial strain colony edge the bacterium cake that cut-off footpath is 1cm with punch tool, by pure culture biscuits involvng inoculation in PDA culture medium flat plate central authorities, 26 DEG C of light culture, the colony diameter of each bacterial strain is measured by right-angled intersection method, from the 3rd day to the 9th day, every day measured a colony diameter, and survey 7 times altogether, each bacterial strain establishes three repetitions, the each colony diameter of often kind of bacterial strain is its three mean values repeated, colony growth rate=(the 9th day diameter-five days diameters) ÷ 4.
Colony growth rate measurement result shows:
A. on common PDA culture medium flat plate, the speed of growth of V592 bacterial strain is 3.667mm/d, what knock out mutant △ VdpdaA2-a and △ VdpdaA2-b is respectively 3.83mm/d, 3.82mm/d, and the colony growth rate knocking out mutant △ VdpdaA2-a and △ VdpdaA2-b is faster than the colony growth rate of wild type strain.
The colony diameter of B.V592 bacterial strain the 9th day time is 37mm, and what knock out mutant △ VdpdaA2-a and △ VdpdaA2-b is respectively 39mm, 39mm, is greater than the colony diameter of V592 bacterial strain.
3, sporulation quantity measures
To beat at bacterial strain colony edge with punch tool and get the bacterium cake that 10 diameters are 1cm, by pure culture biscuits involvng inoculation in the Erlenmeyer flask that Cha Shi liquid nutrient medium is housed, 26 DEG C, shake training 5 days under 200rpm condition, with aseptic micropore filter-cloth filtering culture in aseptic centrifuge tube, again with 250mL ultrapure washing Erlenmeyer flask and with micropore filter-cloth filtering in new sterile centrifugation tube, collection conidium.By the conidium of collecting at 4 DEG C, under 1200rpm condition centrifugal 30 minutes, abandon supernatant, by 10mL ultrapure water Eddy diffusion precipitation, be transferred to sterile centrifugation tube, at 4 DEG C, under 1200rpm condition centrifugal 30 minutes, abandon supernatant, collecting precipitation, obtain conidium.With sterilized water, the conidium concentration of collection is adjusted to 1 × 10
6cfu/mL, then accurately draws 1mL conidial suspension, is seeded in the triangular flask of the 150mL that 100mL Cha Shi liquid nutrient medium is housed, at 26 DEG C, and light culture under 200rpm condition.Measure conidium concentration with blood counting chamber under the microscope, from second day to the 9th day, every 24h measured 1 conidium concentration, and survey 8 times altogether, each bacterial strain establishes three repetitions, and each conidium concentration of often kind of bacterial strain is the mean values of its three repetitions.
Result shows from the 3rd day, the sporulation quantity knocking out mutant △ VdpdaA2-a and △ VdpdaA2-b is all starkly lower than V592 bacterial strain (in Fig. 6 B), knock out mutant △ VdpdaA2-a and △ VdpdaA2-b does not have significant difference at the sporulation quantity that each detection time puts, this shows that VdpdaA2 gene is relevant to conidium output, and VdpdaA2 gene take part in conidial formation.
4, conidium and hypha form are observed
Conidium morphologic observation: the conidium knocking out mutant △ VdpdaA2-a, △ VdpdaA2-b and V592 bacterial strain under collecting contemporaneity same culture conditions is examined under a microscope, with V592 bacterial strain for contrast, observe the difference knocked out between the conidium of mutant and V592 bacterial strain.
Conidium morphologic observation result: the conidium form knocking out mutant △ VdpdaA2-a and △ VdpdaA2-b mostly is oval, and there is oil droplet most of the inside, does not have difference compared with V592 bacterial strain.
Hypha form is observed: adopt the method (slide glass culture method) that cell is cultivated, the form of bacterial strain mycelia is observed, namely buy at bacterial strain colony edge the bacterium cake that cut-off footpath is about 5mm with the toothpick of sterilizing, being inverted is placed on aseptic slide glass, slide glass is placed in the culture dish of moisturizing, 26 DEG C of light culture 3 days, take out the mycelia microtexture that mycelia and the V592 bacterial strain knocking out mutant examined under a microscope by slide glass.
After result shows to cultivate 3 days in the culture dish of moisturizing, knock out the hypha form of mutant △ VdpdaA2-a and △ VdpdaA2-b formation and the hypha form no significant difference (in Fig. 6 C) of V592 bacterial strain.
5, microscopic examination knocks out the conidial sprouting situation of mutant
The bacterium cake knocking out mutant △ VdpdaA2-a, △ VdpdaA2-b and V592 bacterial strain is seeded in Cha Shi substratum respectively, 26 DEG C, cultivate 24h in the shaking table of 200rpm, conidial suspension is collected with aseptic filter cloth, draw quantitative conidial suspension with liquid-transfering gun, examine under a microscope the situation of conidia germination.
Result shows, V592 bacterial strain does not have notable difference (Fig. 7) with the conidia germination knocking out mutant △ VdpdaA2-a and △ VdpdaA2-b.
The phenotype of embodiment 2, complemented mutant body
One, the structure of complementing vector
1, with the genomic dna of V592 bacterial strain for template, with PDA2-s and PDA2-x for primer carries out pcr amplification, obtain pcr amplification product, pcr amplification product is accredited as VdpdaA2 gene (Fig. 8) through agarose gel electrophoresis, comprise initiator codon ATG and terminator codon TAG, size is 1359bp.Take water as template, carry out above-mentioned experiment, as negative control.The nucleotide sequence of this PCR primer is the nucleotide sequence shown in the 1st-1359 of SEQ ID No.3.
The pcr amplification product of the VdpdaA2 gene 2, using restriction enzyme SalI and SpeI double digestion step 1 to obtain, obtains goal gene fragment; By between SalI and the SpeI recognition site of goal gene fragment insertion vector pSULPH-mut-RG#PB (its nucleotide sequence is as shown in SEQ ID No.6), keep other sequence of carrier pSULPH-mut-RG#PB constant, obtain recombinant vectors, by its called after recombinant vectors VdpdaA2::pSULPH-mut-RG#PB.Recombinant vectors VdpdaA2::pSULPH-mut-RG#PB is checked order, result shows the gene order (VdpdaA2 shown in coding SEQ ID No.1) that on recombinant vectors VdpdaA2::pSULPH-mut-RG#PB, 12617bp is VdpdaA2 to 13976bp position from 5 ' end, this gene is between ToxA promotor and its terminator, and goal gene fragment is inserted successfully.
Two, the acquisition of complemented mutant body and phenotypic evaluation
Step one is obtained recombinant vectors VdpdaA2::pSULPH-mut-RG#PB and transform importing agrobacterium tumefaciens EHA105 by electric shocking method, obtain recombinational agrobacterium pSULPH-mut-RG#PB::PDA2.According to the method for embodiment 1, mutant △ VdpdaA2-a Dual culture will be knocked out in recombinational agrobacterium pSULPH-mut-RG#PB::PDA2 and embodiment 1, obtain the complementary transformant (hereinafter referred to as complementary transformant) knocking out mutant △ VdpdaA2-a.By complementary transformant with knock out mutant △ VdpdaA2-a and △ VdpdaA2-b cultivates respectively on PDA solid medium, carry out Phenotypic Observation.Result as shown in Figure 10, and knocks out mutant △ VdpdaA2-a and compares with △ VdpdaA2-b, and the phenotype of complementary transformant and the phenotype knocking out mutant △ VdpdaA2-a and △ VdpdaA2-b do not have obvious difference, all basically identical with the phenotype of V592 bacterial strain.
Three, sporulation quantity measures
To beat at bacterial strain colony edge with punch tool and get the bacterium cake that 10 diameters are 1cm, by pure culture biscuits involvng inoculation in the Erlenmeyer flask that Cha Shi liquid nutrient medium is housed, 26 DEG C, shake training 5 days under 200rpm condition, with aseptic micropore filter-cloth filtering culture in aseptic centrifuge tube, again with 250mL ultrapure washing Erlenmeyer flask and with micropore filter-cloth filtering in new sterile centrifugation tube, collection conidium.By the conidium of collecting at 4 DEG C, under 1200rpm condition centrifugal 30 minutes, abandon supernatant, by 10mL ultrapure water Eddy diffusion precipitation, be transferred to sterile centrifugation tube, at 4 DEG C, under 1200rpm condition centrifugal 30 minutes, abandon supernatant, collecting precipitation, obtain conidium.With sterilized water, the conidium concentration of collection is adjusted to 1 × 10
6cfu/mL, then accurately draws 1mL conidial suspension, is seeded in the triangular flask of the 150mL that 100mL Cha Shi liquid nutrient medium is housed, at 26 DEG C, and light culture under 200rpm condition.Measure conidium concentration with blood counting chamber under the microscope, from second day to the 9th day, every 24h measured 1 conidium concentration, and survey 8 times altogether, each bacterial strain establishes three repetitions, and each conidium concentration of often kind of bacterial strain is the mean values of its three repetitions.
Result shows from the 6th day, the conidium output of complementary transformant, apparently higher than knocking out mutant △ VdpdaA2-a and △ VdpdaA2-b (in Fig. 6 B), illustrates that VdpdaA2 gene VdpdaA2 gene relevant to conidium output take part in conidial formation.
Claims (9)
1. prepare a method for the restructuring verticillium dahliae that conidium output reduces, be the expression of the gene suppressing VdpdaA2 in object verticillium dahliae, obtain the restructuring verticillium dahliae of conidium output lower than described object verticillium dahliae;
Described VdpdaA2 is a) or b):
A) aminoacid sequence is the protein shown in SEQ ID No.1;
B) by the aminoacid sequence shown in SEQ ID No.1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation obtain have VdpdaA2 activity by a) derivative protein.
2. method according to claim 1, is characterized in that: in described suppression object verticillium dahliae, the expression of the gene of VdpdaA2 is realized by the mode of the gene knockout by described VdpdaA2.
3. the restructuring verticillium dahliae that the conidium output utilizing method described in claim 1 or 2 to obtain reduces.
4. suppress the application of material in the anti-verticillium dahliae plant of cultivation of VdpdaA2 activity described in the material that described in claim 1, VdpdaA2 expresses, the material suppressing the genetic expression of VdpdaA2 described in claim 1 or reduction claim 1.
5. application according to claim 4, is characterized in that: described plant is the host of verticillium dahliae.
6. application according to claim 5, is characterized in that: the host of described verticillium dahliae is cotton.
7. suppress the application of the material of VdpdaA2 activity described in the material that described in claim 1, VdpdaA2 expresses, the material suppressing the genetic expression of VdpdaA2 described in claim 1 or reduction claim 1 in preparation verticillium dahliae inhibitor.
8. VdpdaA2 described in claim 1, or the application of biomaterial in regulation and control verticillium dahliae conidium output that VdpdaA2 described in claim 1 is correlated with;
The biomaterial that described VdpdaA2 is relevant is following A 1) to A20) in any one:
A1) nucleic acid molecule; Described nucleic acid molecule is the nucleic acid molecule of VdpdaA2 described in coding claim 1;
A2) containing A1) expression cassette of described nucleic acid molecule;
A3) containing A1) recombinant vectors of described nucleic acid molecule;
A4) containing A2) recombinant vectors of described expression cassette;
A5) containing A1) recombinant microorganism of described nucleic acid molecule;
A6) containing A2) recombinant microorganism of described expression cassette;
A7) containing A3) recombinant microorganism of described recombinant vectors;
A8) containing A4) recombinant microorganism of described recombinant vectors;
A9) containing A1) the transgenic plant cells system of described nucleic acid molecule;
A10) containing A2) the transgenic plant cells system of described expression cassette;
A11) containing A3) the transgenic plant cells system of described recombinant vectors;
A12) containing A4) the transgenic plant cells system of described recombinant vectors;
A13) containing A1) Transgenic plant tissue of described nucleic acid molecule;
A14) containing A2) Transgenic plant tissue of described expression cassette;
A15) containing A3) Transgenic plant tissue of described recombinant vectors;
A16) containing A4) Transgenic plant tissue of described recombinant vectors;
A17) containing A1) the transgenic plant organ of described nucleic acid molecule;
A18) containing A2) the transgenic plant organ of described expression cassette;
A19) containing A3) the transgenic plant organ of described recombinant vectors;
A20) containing A4) the transgenic plant organ of described recombinant vectors.
9. application according to claim 8, is characterized in that: described nucleic acid molecule is following 1)-5) in arbitrary shown in gene:
1) its encoding sequence is cDNA molecule or the DNA molecular of SEQ ID No.2;
2) sequence is cDNA molecule or the DNA molecular of SEQ ID No.3;
3) with 1) nucleotide sequence that limits has more than 75% or 75% identity, and the cDNA molecule of VdpdaA2 described in coding claim 1 or genomic DNA molecule;
4) with 2) nucleotide sequence that limits has more than 75% or 75% identity, and the cDNA molecule of VdpdaA2 described in coding claim 1 or genomic DNA molecule;
5) under strict conditions with 1) or 2) or 3) or 4) nucleotide sequence hybridization that limits, and the cDNA molecule of VdpdaA2 described in coding claim 1 or genomic DNA molecule.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510297266.1A CN104893993B (en) | 2015-06-02 | 2015-06-02 | Verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 purposes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510297266.1A CN104893993B (en) | 2015-06-02 | 2015-06-02 | Verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 purposes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104893993A true CN104893993A (en) | 2015-09-09 |
| CN104893993B CN104893993B (en) | 2017-12-08 |
Family
ID=54026955
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510297266.1A Expired - Fee Related CN104893993B (en) | 2015-06-02 | 2015-06-02 | Verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA2 purposes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104893993B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609485A (en) * | 2019-01-02 | 2019-04-12 | 吉林中粮生化有限公司 | A kind of chitin deacetylase and its application |
| CN113717956A (en) * | 2021-09-09 | 2021-11-30 | 石河子大学 | Application of verticillium dahliae acetolactate synthase catalytic subunit gene VdIV 2B |
-
2015
- 2015-06-02 CN CN201510297266.1A patent/CN104893993B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| MA,L.-J.J. ET AL.: "polysaccharide deacetylase family protein [Verticillium dahliae VdLs.17]", 《NCBI REFERENCE SEQUENCE: XP_009654927.1》 * |
| 谷素静 等: "棉花黄萎病菌T-DNA插入突变体库的构建及致病缺陷突变体筛选", 《河南农业科学》 * |
| 邓晟 等: "蛋白激酶A 催化亚基VdPKAC1对菌丝型大丽轮枝菌V07DF2 培养性状及致病力的调控", 《中国农业科学》 * |
| 韩帅 等: "落叶型大丽轮枝菌T-DNA插入突变体库的构建", 《西北农业学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609485A (en) * | 2019-01-02 | 2019-04-12 | 吉林中粮生化有限公司 | A kind of chitin deacetylase and its application |
| CN109609485B (en) * | 2019-01-02 | 2022-06-28 | 吉林中粮生化有限公司 | Chitin deacetylase and application thereof |
| CN113717956A (en) * | 2021-09-09 | 2021-11-30 | 石河子大学 | Application of verticillium dahliae acetolactate synthase catalytic subunit gene VdIV 2B |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104893993B (en) | 2017-12-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104928314A (en) | Use of verticillium dahliae pathogenicity associated protein VdpdaAl | |
| CN104480085B (en) | VdUDG gene and application thereof in reducing pathogenicity of verticillium dahliae | |
| CN109825457B (en) | Salt-tolerant bacillus E40207a2 and application thereof | |
| CN105199996B (en) | A kind of bacillus amyloliquefaciens and its application for preventing graw mold of tomato | |
| CN105176894B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention graw mold of tomato | |
| CN112195186B (en) | Application of SlBBX20 gene in regulation and control of tomato gray mold resistance | |
| US20220369648A1 (en) | Endophytic falciphora oryzae fo-r20 and its application | |
| CN110437324A (en) | Banana blight bacteria transcription factor FoRlm1 and its application | |
| CN105176837A (en) | Application of protein fogac in regulating and controlling toxicity of fusarium oxysporum f.sp.cubense on banana plants | |
| CN105238723B (en) | A kind of bacillus amyloliquefaciens and its microbial bacterial agent of prevention crop verticillium wilt | |
| CN111543440B (en) | Method for increasing yield and preventing diseases of wheat and application thereof | |
| CN113355245B (en) | Application of endophytic fungus FO-R20 in prevention and treatment of rice panicle blast | |
| CN110468150A (en) | RGS1 gene is improving widow according to the application under environment in tomato bacterial leaf spot resistance as negative regulatory factor | |
| CN104893993A (en) | Application of Verticillum dahliae conidium yield related protein VdpdaA2 | |
| CN104894156B (en) | Verticillium dahliae conidium yield GAP-associated protein GAP VdpdaA3 purposes | |
| CN109694876A (en) | Cultivate the method for low Cd accumulation rice and its purposes of associated materials | |
| CN110172424B (en) | Bacillus methylotrophicus and application thereof in preventing and controlling root-knot nematodes | |
| CN109666655B (en) | Fusarium graminearum single-stranded circular DNA virus FgGMTV1/HB58 and application thereof | |
| CN108587969B (en) | Preparation and application of verticillium dahliae strain HCX-01 capable of preventing and treating cotton verticillium wilt | |
| CN115287194B (en) | Medicinal wild rice endophytic fungi YYA21 and application thereof | |
| CN110606877A (en) | Transcription factor for improving wheat rust-resistant varieties and screening method thereof | |
| CN100372935C (en) | Cloning of gene against meloidogyne of capsicum and application thereof | |
| CN102746391A (en) | Arsenic-resistance related protein PvArrp1, and coding gene and application thereof | |
| CN102942621B (en) | Plant powdery mildew resistance related protein TaCAF1 and its coding gene and application | |
| CN102586168B (en) | Novel pathogenic gene PCG16 of pathogenic fungi and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171208 Termination date: 20190602 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |