CN104892737B - Plant stress tolerance correlative protein GmNF-YA15 and its encoding gene and application - Google Patents

Abstract

The invention discloses a kind of plant stress tolerance correlative protein GmNF YA15 and its encoding gene and applications.Protein provided by the invention is as follows（a）Or（b）：（a）The protein that amino acid sequence forms shown in sequence in sequence table 1；（b）By the amino acid sequence of sequence 1 by one or several amino acid residues substitution and/or lack and or add and with the relevant protein derived from sequence 1 of plant stress tolerance.The present invention is cloned from soybean obtains gene GmNF YA15, it is expressed under the induction of mannitol, salt, drought, hydrogen peroxide and ABA, the albumen of coding navigates in cytoplasm, the transcriptional expression of gene of the regulation and control containing CCAAT box cis elements that can be special, and the GmNF YA15 of the present invention can improve the drought tolerance of plant, for people, degeneration-resistant and the correlation gene of resistance to anti-phase expression provides the foundation in order to control, will play an important role in the plant breeding for cultivating resistance and resistance of reverse enhancing.

Description

Plant stress tolerance correlative protein GmNF-YA15 and its encoding gene and application

Technical field

The present invention relates to biotechnology more particularly to a kind of plant stress tolerance correlative protein GmNF-YA15 and its volumes Code gene and application.

Background technology

The environment stresses such as arid, with high salt and low temperature seriously restrict the growth of soybean, development.Therefore, soybean is understood to inverse The response of border condition and signal transduction mechanism improve the resistance of soybean varieties, becomes soybean heredity research and breed improvement One of vital task.

A series of responsing reactions are will produce in plant under environment stress, along with many Physiology and biochemistries and developmentally Variation.Reaction mechanism of the plant to adverse circumstance is specified, science argument will be provided for adversity gene engineering research and application.Currently, planting The degeneration-resistant Journal of Sex Research of object is gradually deep into cell, molecular level, and is combined with science of heredity and genetic engineering research, exploration life Object technology improves plant growth characteristics, and the purpose is to improve adaptability of the plant to adverse circumstance.

Under the adverse environmental factor of the environment-stress such as arid, with high salt and low temperature, plant can be in molecule, cell and integral level On make corresponding adjustment, to reduce injury caused by environment and existence to the full extent.Many genes are lured by stress Expression is led, the product of these genes can not only directly participate in the stress response of plant, and can adjust other related genes Expression or participate in signal transduction path, to make plant avoid or reduce injury, resistance of the enhancing to stressful environmental.With stress Relevant gene outcome can be divided into two major classes：The product of first kind gene code include ionophorous protein, aquaporin, Osmotic factor（Sucrose, proline and glycine betaine etc.）Synzyme etc. directly participates in the gene outcome of plant stress response；The The product of two genoids coding includes the protein factor for participating in coercing relevant signal transmission and Gene expression and regulation, as albumen swashs Enzyme, transcription factor etc..Wherein, transcription factor plays an important role in the gene expression regulation of plant stress response.

Transcription factor is also referred to as trans-acting factor, is that can be sent out with cis-acting elements in eukaryotic gene promoter region The DNA binding protein of raw specific effect, by the interaction between them and between other GAP-associated protein GAPs, activation or Inhibit transcription.The combined areas DNA of transcription factor determine the specificity that it is combined with cis-acting elements, and transcription regulatory region is determined It is determined and activation or inhibiting effect is risen to gene expression.In addition, its own activity also by nuclear location and oligomerization the effects that Influence.

Being currently known in plant mainly has with the relevant transcription factor of stress：AP2 with AP2 structural domains (APETALA2)/EREBP (element responsive to ethylene binding protein, ethylene responsive element binding Protein) transcription factor family, the bZIP containing basic region and leucine zipper（basic region/leucine zipper motif transcription factors）Class transcription factor, the WRKY containing conservative WRKY amino acid sequences Transcription factor family, in conjunction with CCAAT-box main nuclear factor CBF（CCAAT binding factor）Class transcription because Son contains basic helix-loop-helix（bHLH）With the MYC families of leucine zipper and with tryptophan cluster（Trp cluster） MYB families.These transcription factor families, in addition to WRKY families are not involved in the water Stress responses of plant, other four families are equal Participate in the environment stress reaction for adjusting plant to arid, with high salt and low temperature etc..NF-Y is a kind of in conjunction with cis-acting elements The transcription factor of CCAAT-box, special identification simultaneously combine many eucaryote composing types, inductivity and cell cycle dependant The promoter of gene or the cis-acting elements CCAAT-box in enhancer, and then in the table of these genes of transcriptional level control It reaches.The heterozygosis tripolymer that NF-Y is made of tri- different subunits of NF-YA, NF-YB and NF-YC.The group egg of NF-YB and NF-YC White fold motif（HFM）Interaction is allowed to form dimer, and the NF-Y that heterotrimer is formed then in conjunction with NF-YA is compound Object adjusts the transcription of its target gene to combine CCAAT-box.At least there are two the knots that structural domain is used for protein by NF-YA It closes：Structural domain rich in glutamine（Q-rich domain）With the structural domain of subunit interaction（subunit interaction domain）.Also there are two protein bound structural domains by NF-YB：Histone fold motif（histone-fold motif）With TATA binding proteins（TATA-binding protein）Binding structural domain（TBP-binding domain）.NF- There are three the binding structural domains of protein by YC：Histone fold motif, TBP binding structural domains and the structure rich in glutamine Domain.The structural amino acid sequence and histone fold motif of NF-YA and NF-YC is homologous, NF-YB and H2B histone fold motifs Correlation, and NF-YC is related in H2A histones fold motif, which is made of three α spirals and two rings, is responsible for H2A/H2B The formation of dimer.

Currently, the report about the function of NF-Y transcription factors in plant is less, all risen in drought stress important Effect（Nelson et al, 2007）.Nelson etc. thinks, the ZmNF-YB2 with arabidopsis AtNF-YB1 transcription factor homologs, The transgenic corns of ZmNF-YB2 are overexpressed under conditions of water shortage can be remarkably reinforced drought resistance, since ZmNF-YB2 can be It is multiple to there is related parameter to change with plant arid, including chlorophyll content, gas port degree of leading, leaf temperature, reduction wilting and dimension Photosynthesis is held, to improve drought resistance（Nelson,Peter P.Repetti,Tom R.Adams,Jingrui Wu, 2007）.The research of Wen-Xue Li, Youko Oono etc. confirms that the expression of AtNF-YA5 is lured by arid and ABA processing It leads.To its promoter GUS analysis shows part induced reaction is happened at transcriptional level.NF-YA5 there are one target site miR169, Under drought condition, miR169 expression is suppressed.NF-YA5 has very high expression in micro-pipe tissue and guard cell, therefore, The expression for promoting multiple functional genes using a transcription factors critical has become plant to enhance the resistance of plant The research hotspot of object adversity gene engineering.

Invention content

It is an object of the present invention to provide a kind of plant stress tolerance correlative protein GmNF-YA15 and its encoding genes.

Protein provided by the invention, to combine the nuclear factor albumen of CCAAT-box, entitled GmNF-YA15 Derived from Glycine soybean（Glycine max L.）, it is as follows（a）Or（b）：

（a）The protein that amino acid sequence forms shown in sequence in sequence table 1；

（b）The amino acid sequence of sequence 1 by the substitution of one or several amino acid residues and/or missing and/or is added Add and with the relevant protein derived from sequence 1 of plant stress tolerance.

The protein that the amino acid residue sequence of sequence 1 is made of 217 amino acid residues in sequence table, from aminoterminal 123-148 amino acids residue sequences be with NFYB/C interactions region, from aminoterminal 162-188 amino acids residue sequences It is classified as possible nuclear localization signal, is conservative NF-YA structural domains from aminoterminal 123-183 amino acids residue sequence.

In order to make a）In GmNF-YA15 convenient for purifying, amino acid sequence shown in sequence 1 can be formed in by sequence table Protein amino terminal or the upper label as shown in Table 1 of carboxyl terminal connection.

The sequence of 1. label of table

Label	Residue	Sequence
			Poly-Arg	5-6（Usually 5）	RRRRR
Poly-His	2-10（Usually 6）	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned 1）In GmNF-YA15 can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression and obtain It arrives.The encoding gene of GmNF-YA15 in above-mentioned 1 can by by sequence in sequence table 2 from 5 ' end 150-803 bit bases Shown in the codon of one or several amino acid residues is lacked in DNA sequence dna, and/or carry out the mistake of one or several base-pairs Justice mutation, and/or hold the coded sequence for connecting label shown in table 1 to obtain at its 5 ' end and/or 3 '.

The DNA molecular for encoding above-mentioned albumen is also the scope of protection of the invention.

Above-mentioned DNA molecular is following 1）-5）In any DNA molecular：

1）Code area is the DNA molecular shown in sequence 2 in sequence table；

2）Code area is the DNA molecular shown in the nucleotide of 5 ' end the 147th to 803 of sequence 2；

3）Code area is the DNA molecular shown in the nucleotide of 5 ' end the 150th to 803 of sequence 2；

4）Under strict conditions with 1）Or 2）Or 3）The DNA sequence dna of restriction hybridizes and encodes resistance of reverse and/or inoxidizability The DNA molecular of GAP-associated protein GAP；

5）With 1）Or 2）Or 3）The DNA sequence dna of restriction has 90% or more homology, and encodes resistance of reverse and/or anti-oxidant The DNA molecular of property GAP-associated protein GAP.

Above-mentioned stringent condition can be to hybridize at 65oC in 6 × SSC, the solution of 0.5%SDS, then with 2 × SSC, It is primary that 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film.

Recombinant vector, expression cassette, transgenic cell line or recombinant bacterium containing above-mentioned DNA molecular are also that the present invention protects Range.

Above-mentioned recombinant vector is that above-mentioned DNA molecular is inserted into expression vector, obtains the carrier for expressing above-mentioned protein.

The recombinant expression carrier of the gene can be contained with existing plant expression vector construction.The plant expression vector Including double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.The plant expression vector also may include external source base 3 ' end untranslated regions of cause include polyadenylation signals and any other DNA pieces for participating in mRNA processing or gene expression Section.The bootable polyadenylic acid of polyadenylation signals is added to 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti) Plasmid gene (such as kermes synzyme Nos genes), plant gene（Such as soybean storage protein genes）The non-translational region of 3 ' end transcriptions All have similar functions.When using the gene constructed recombinant plant expression vector, it can be added before its transcription initiation nucleotide The enhanced promoter of any type or constitutive promoter, such as cauliflower mosaic virus（CAMV）The ubiquitin of 35S promoter, corn Promoter（Ubiquitin）, they can be used alone or are used in combination with other plant promoters；In addition, using the present invention Gene constructed plant expression vector when, enhancer, including translational enhancer or transcriptional enhancer, these enhancers also can be used Region can be ATG initiation codon or neighboring region initiation codon etc., but must be identical as the reading frame of coded sequence, with Ensure the correct translation of entire sequence.The source of the translation control signal and initiation codon is extensive, can be natural , can also be synthesis.Translation initiation region can come from transcription initiation region or structural gene.For the ease of to transgenosis Plant cell or plant are identified and are screened, and can be processed to plant expression vector used, as be added can in plant table The coding reached can generate the enzyme of color change or the gene of luminophor（Gus gene, luciferase genes etc.）, it is resistant Antibiotic marker（Gentamicin marker, kanamycins marker etc.）Or anti-chemical reagent marker gene（It is removed as anti- Green bristlegrass agent gene）Deng.From the security consideration of genetically modified plants, it can be not added with any selected marker, directly screened with adverse circumstance Transformed plant.

In an embodiment of the present invention, expression vector YEP-GAP, corresponding recombinant vector are YEP-GAP-GmNF- YA15, YEP-GAP-GmNF-YA15 are the recombinant plasmid that above-mentioned DNA molecular is inserted into the multiple cloning sites of YEP-GAP and is obtained, excellent Be selected as the DNA fragmentation shown in the nucleotide of the 150th to 803, the ends 5' by the sequence 2 of sequence table be inserted into YEP-GAP BamHI and The recombinant vector obtained between XhoI digestion recognition sites；

Expression vector is pBI121, and corresponding recombinant vector is pBI121-GmNF-YA15, and pBI121-GmNF-YA15 is Above-mentioned DNA molecular is inserted into the obtained recombinant plasmid of multiple cloning sites of pBI121, preferably by the sequence of sequence table 2 from the ends 5' DNA fragmentation shown in 150th to 803 nucleotide is inserted into the weight obtained between Sma I and SacI the digestion recognition site of pBI121 Group carrier.

Expand the primer pair of above-mentioned DNA molecular or its arbitrary segment.

The primer pair is GmNF-YA15-BI and GmNF-YA15-XI or GmNF-YA15-121F and GmNF-YA15- 121R：

GmNF-YA15-BI：5'-CGCGGATCCATGGTTTGGACAGTGT-3'

GmNF-YA15-XI：5'-CCGCTCGAGTTAGGATGCCCTATCT-3'

GmNF-YA15-121F：5'-TCCCCCGGGATGGTTTGGACAGTGTTACGTG-3'；

GmNF-YA15-121R：5'-GCCGAGCTCTTAGGATGCCCTATCTGATGAAG-3'；

Above-mentioned protein, above-mentioned DNA molecular or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombination Application of the bacterium in adjusting plant stress tolerance or adjusting plant anti-oxidation is also the scope of protection of the invention.

In above application, the adjusting plant stress tolerance is to improve plant stress tolerance；The adjusting plant anti-oxidation is Improve plant anti-oxidation；

In above application, the resistance of reverse is salt tolerance and/or drought tolerance；

The plant is dicotyledon or monocotyledon；The dicotyledon is specially arabidopsis.

It is a further object to provide a kind of methods for cultivating genetically modified plants.

Method provided by the invention is to import above-mentioned DNA molecular in purpose plant, obtains genetically modified plants；Described turn The resistance of reverse and/or inoxidizability of gene plant are higher than the purpose plant.

In the above method, above-mentioned DNA molecular imports the purpose plant by above-mentioned recombinant vector；

The resistance of reverse is drought tolerance and/or salt tolerance；

The salt tolerance is embodied under NaCl stress, and the main root length of the genetically modified plants is more than the purpose plant；

The drought tolerance is embodied under PEG stress, and the main root length of the genetically modified plants is more than the purpose plant；

The inoxidizability is embodied in H₂O₂Under stress, the main root length of the genetically modified plants is more than the purpose plant.

The purpose plant is dicotyledon or monocotyledon；The dicotyledon is specially arabidopsis.

Above-mentioned albumen is also the scope of protection of the invention as the application of transcription factor.

The experiment proves that the present invention is cloned from soybean obtains gene GmNF-YA15, mannitol, salt, Drought, hydrogen peroxide and ABA induction under express, the albumen of coding navigates in cytoplasm, can special regulation and control contain CCAAT- Box cis elements（Core sequence：CCAAT）Gene transcriptional expression, and the present invention GmNF-YA15 can improve plant Drought tolerance is that degeneration-resistant and the correlation gene of resistance to anti-phase expression provides the foundation people in order to control, will cultivate resistance and resistance of reverse increasing It plays an important role in strong plant breeding.

Description of the drawings

Fig. 1 is the sequence analysis result of GmNF-YA15 and arabidopsis amino acid AtNF-YA5 amino acid sequences

Fig. 2 is the fluorescence real-time quantitative that GmNF-YA15 is expressed by stress-inducing（Real-time）PCR collection of illustrative plates

Fig. 3 is positioning results of the GmNF-YA15 in onion epidermis cell

Fig. 4 is target gene of the Molecular Detection in transgenic arabidopsis

Fig. 5 is wildtype Arabidopsis thaliana and turns GmNFYA-15 arabidopsis salt-resistance, drought resistance compared with inoxidizability.

Specific implementation mode

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

% in following embodiments is unless otherwise specified mass percentage.Quantitative test in following embodiment, Three repeated experiments are respectively provided with, results are averaged.

The acquisition of embodiment 1, gene GmNF-YA15

One, the acquisition of gene GmNF-YA15

20 days or so rich No. 8 of soybean iron will be grown in sandy soil（National germplasm resource bank, number ZM242；It is documented in as follows In document：The town Wang Caijie, Sun Shi, Wu Baomei, Chang Ru, Chinese large area plants soybean product since Han Tian richnesses .20 forties in century The pedigree analysis of kind.Chinese oil crops journal.2013,35 (3):246-252, the public can be from Chinese Academy of Agricultural Sciences crops Science Institute obtains）Four leaf stage seedling Osmotic treatment 2 hours, with liquid nitrogen flash freezer, -80 DEG C save backup.Using Quikprep Micro mRNA Purification Kit（Pharmacia）Carry out the separation of mRNA.First chain cDNA synthesis reverse transcriptase XL（AMV）.Ds cDNA are synthesized using SMART methods, PCR product carries out 1.0% agarose gel electrophoresis detection.

The nuclear factor C races full length gene sequence of soybean CCAAT-box is obtained by the method for 5 ' RACE and 3 ' RACE Sequence 2 in sequence table.

Unnamed gene shown in sequence 2 is GmNF-YA15 in the sequence table, and open reading frame is the sequence from sequence table 5 ' the 150th to 803 nucleotide in end of row 2, the albumen of the gene code are named as GmNF-YA15, the amino acid of the albumen Sequence is the sequence 1 in sequence table, and sequence 1 is made of 218 amino acid residues, has conservative histone fold motif.

Above-mentioned sequence 2 can also be by artificial synthesized.

The sequence of GmNF-YA15 is compared on Genabnk, has with the albumin A tNF-YC11 in arabidopsis higher Homology（Fig. 1）, and not finding homologous protein in soybean, it was demonstrated that GmNF-YA15 albumen is a new albumen.

Two, the expression characterization of real-time fluorescence quantitative PCR analysis GmNF-YA15

1, Stress treatment

Rich No. 8 seedling of iron that seedling age is 10 days carry out following processing:

（1）Osmotic treatment（Fig. 2A）：The soybean seedling of potting is taken out to the moisture blotted on root, is placed in dry filter paper On, arid culture takes out material after 30 minutes, 1 hour, 2 hours, 5 hours, 12 hours, 24 hours, with liquid nitrogen flash freezer, -80 DEG C It saves backup.

（2）High salt treatment（Fig. 2 B）：By soybean seedling be placed in 200mM by NaCl solution, illumination cultivation 30 minutes, 1 Hour, 2 hours, 4 hours, 6 hours, 12 hours take out material respectively after 24 hours, and with liquid nitrogen flash freezer, -80 DEG C save backup.

（3）High-temperature process（Fig. 2 C）：Soybean seedling is placed at 42 DEG C, illumination cultivation 30 minutes, 1 hour, 2 hours, it is 5 small When, 12 hours, take out respectively after 24 hours and with liquid nitrogen flash freezer, -80 DEG C save backup.

（4）Abscisic acid processing（Fig. 2 D）：Soybean seedling is placed in 100 μM of abscisic acid（ABA）In solution, illumination cultivation 30 Minute, 1 hour, 2 hours, 5 hours, 12 hours, take out respectively after 24 hours and with liquid nitrogen flash freezer, -80 DEG C save backup.

（5）Low-temperature treatment（Fig. 2 E）：Soybean seedling is placed in 4 DEG C of incubators, illumination cultivation 30 minutes, 1 hour, 2 hours, It is taken out after 5 hours, 12 hours, 24 hours and with liquid nitrogen flash freezer, -80 DEG C saves backup.

（6）Dioxygen water process（Fig. 2 F）：Wheat seedling is placed in the hydrogen peroxide solution of 20mM, illumination cultivation 30 minutes, 1 Hour, 2 hours, 5 hours, 12 hours take out material respectively after 24 hours, are saved backup with -80 DEG C after liquid nitrogen flash freezer.

（7）Injury is handled（Fig. 2 G）：Soybean seedling is subtracted into leaf top with scissors, illumination cultivation 30 minutes, 1 hour, 2 Hour, 5 hours, 12 hours, take out respectively after 24 hours and with liquid nitrogen flash freezer, -80 DEG C save backup.

（8）Treatment with mannitol（Fig. 2 H）：Soybean seedling is placed in mannitol (Mannitol) solution of 300mM, illumination Culture takes out after 30 minutes, 1 hour, 2 hours, 5 hours, 12 hours, 24 hours and respectively with liquid nitrogen flash freezer, and -80 DEG C of preservations are standby With.

（9）The processing of control：Directly -80 DEG C of the soybean seedling without any processing is taken to freeze as a contrast（0 hour）.

2, the separation of mRNA

The above-mentioned soybean seedling respectively handled is used into Quikprep Micro mRNA Purification Kit （Pharmacia）Carry out the separation of mRNA.

3, reverse transcription cDNA

It is cDNA by the mRNA reverse transcriptions of purifying.

4, real-time fluorescence quantitative PCR

CDNA is diluted to the template for being used as Q-RT-PCR after 50 times.With gene specific primer pair（Q-RT-GmNF-YA15F： 5'-GTCAATGTACAGTATGCAGCACC-3'；Q-RT-GmNF-YA15R：5'-TGATTTGTCAGCTGATGCCA-3'）To sample Product carry out Q-RT-PCR amplifications, the response situation of the various processing of gene pairs are analyzed, with actin（Q-RT-ActinF：5'- ACATTGTTCTTAGTGGTGGCT-3'；Q-RT-Q-RT-ActinR：5'-CTGTTGGAAGGTGCTGAG-3'）Do internal reference.Q- RT-PCR existsIt is carried out on 7000 real-time fluorescence quantitative PCR instrument, a parallel test sets 3 repetitions.Utilize Livak The method of KJ and Schmittgen TD (2001) reports, i.e., 2^-ΔΔCTCalculate relative expression quantity.

ΔΔC_T=（C_T.Target- C_T.Actin）_{Time x}（C_T.Target- C_T.Actin）_Time0

Time x indicate random time point, Time₀Indicate the target gene expression of 1 times of amount after actin is corrected.

As a result see Fig. 2, under Osmotic treatment, the expression quantity of GmNF-YA15 is gradually got higher with the extension of dewatering time, Reach 2.3 ± 0.33 times of control to dehydration 2h expression quantity, until dehydration 12h expression quantity reach control 8.03 ± 0.78 times, until expression quantity starts to lower dehydration for 24 hours again, see Fig. 2A.Under high salt treatment, the expression quantity of GmNF-YA15 exists When handling 2h, to 8.2 ± 0.33 times of control, expression quantity is again instantaneous later lowers expression quantity transient expression, sees Fig. 2 B.

Under high-temperature process, the expression quantity of GmNF-YA15 is slowly got higher with the extension of high-temperature time, until processing 12h tables Reach 2.2 ± 0.30 times of control up to amount, expression quantity starts slowly to lower again later, sees Fig. 2 C.

Under hormone ABA processing, the expression quantity of GmNF-YA15 is shown in Fig. 2 D without significant change trend.

Under low-temperature treatment, the expression quantity of GmNF-YA15 continues slowly to lower, and sees Fig. 2 E.

Under dioxygen water process, the expression quantity of GmNF-YA15 in 0.5h transient expressions to 7.2 ± 0.37 times of control, it Expression quantity is again instantaneous afterwards lowers, and reaches 10.4 ± 0.31 times of control in 2h expression quantity, expression quantity is slightly lowered again later, sees figure 2F。

Injury processing under, the expression quantity of GmNF-YA15 when handle 1h, expression quantity transient expression to compare 0.19 ± 0.13 times, slowly up-regulation is restored to initial expression, sees Fig. 2 G expression quantity when arriving 12h again later.

Under treatment with mannitol, the expression quantity of GmNF-YA15 is when handling 5h, expression quantity transient expression to 4.2 compareed ± 0.23 times, when handling for 24 hours, 6.4 ± 0.36 times of expression quantity transient expression to control, expression quantity continues slowly to raise Gesture is shown in Fig. 2 H.Two, GmNF-YA15 Subcellular Localizations

1, material prepares：

In 9cm culture dishes upper berth a thin layer MS culture mediums, inner surface upward, is laid in MS culture mediums center, directly after tearing Diameter is within the scope of 3cm, 25 DEG C of preculture 4h.

2, the processing of bronze：

It takes a diameter of 1.0 μM of the bronzes of 100mg to be put into 1.5ml centrifuge tubes, 1ml absolute ethyl alcohols is added, fully vibrate 3min centrifuges 1min with 12000rpm, removes supernatant, adds after 1ml sterile waters mix well, is centrifuged, repeated with 12000rpm Above-mentioned steps 3 times.Finally, bronze is suspended in 1ml ultra-pure waters, -20 DEG C save backup.

3, the structure of subcellular localization recombinant vector

1. according to the primers GmNF-YA15-BI and GmNF-YA15-XI of GmNF-YA15 genes, prime end PstI and BamHI restriction enzyme sites are introduced respectively.

GFP-GmNF-YA15F：5'-AAACTGCAGATGGTTTGGACAGTGT-3'

GFP-GmNF-YA15R：5'-CGCGGATCCGGATGCCCTATCTGAT-3'.

2. the pcr amplification product recycled with restriction enzyme PstI and BamHI digestion step 1, recycles the digestion of 669bp Product；With restriction enzyme PstI and BamHI digestion expression vector 16318GFP, the carrier framework of about 4kbp is recycled；

3. the digestion products of step 2. are connected with the carrier framework of step；

4. the connection product freeze-thaw method of step 3. is converted coli strain（Purchased from Tiangen companies）, 37 DEG C overnight Culture, picking positive colony extraction plasmid are sequenced；

Sequencing result shows that plasmid is the DNA pieces shown in the nucleotide of 150-800, the ends 5' by the sequence 2 of sequence table Section is inserted into the recombinant vector obtained between PstI the and BamHI restriction enzyme sites of carrier 16318GFP, is named as 16318GFP- GmNF-YA15。

4, particle bullet is prepared：

3 μ g recombinant plasmid dnas（16318GFP-GmNF-YA15 and 16318GFP empty carriers）It is added separately to a diameter of 1.0 μM of 6 μ l of bronze suspension（50mg/ml）, 0.1M spermidines（spermidine）4 μ l, 2.5M CaCl₂6 μ l, by bronze, DNA, spermidine and calcium chloride first vibrate mixing respectively, then after mixing oscillation mixing 3min, stand 15min on ice. 12000rpm centrifuges 10s（Refer to rotating speed and reaches 10s after 12000rpm）, abandon supernatant.140 μ l absolute ethyl alcohols are added, after thick oscillation（It beats Dissipate bronze）12000rpm centrifuges 10s, collects bronze precipitation.20 μ l absolute ethyl alcohols, which suspend, to be precipitated, and film is put.

5, biolistic bombardment acceptor material：

1. that selects certain pressure splits film（This experiment 1100psi）, together with bombardment film, soaked in 70% alcohol 1~2h is steeped, taking-up is dried；

2. metal baffle is impregnated with alcohol, sterilize on alcolhol burner, the superclean bench ultraviolet sterilization of particle gun；

3. taking the above-mentioned bronze-plasmid complex prepared of 20 μ l, it is spread evenly across on the centre position of bombardment film, it should not It is applied on entire film, size is consistent with the pore diameter range on carrier retainer plate, dries, and is then attached on carrier retainer plate；

4. above-mentioned carrier retainer plate is installed on emitter；

5. can split film is installed to gas accelerating tube lower end；

6. onion epidermis culture dish is put into vacuum chamber, culture ware lid is removed；

7. vacuumizing pointer to 26In/Hg；

8. put helium in gas accelerating tube, until in pipe pressure reach can split pressure that film can bear when, it is broken that film can be split It opens；

9. gas is flushed on bombardment film, carrier moves downward, and is blocked by metal baffle, and following bronze-plasmid is compound Body but penetrates the mesh directive target cell of metal baffle；

10. the onion epidermis cell bombarded is put into 25 DEG C of incubators, in laser co-focusing after light culture 16~for 24 hours Microscopically observation.

6, onion epidermis cell microscopy：

It is then micro- in laser scanning co-focusing by the onion epidermis tabletting after biolistic bombardment, light culture 16-24h Mirror（Bio-Rad MicroRadiance）It is (green that (Laser scanning confocal microscopy, LSMC) observes GFP Color fluorescin) fluorescence, and it is scanned photograph.The running parameter of LSCM is：Ex=488nm, Em=525 ± 15nm, Power= 10%, Zoom7, medium sweep, Frame512 × 512.Software is TIME-COURSE and PHOTOSHOP5.0.

The results are shown in Figure 3, A：GmNF-YA15 is positioned in nucleus；B：16318hGFP empty vector controls are positioned at carefully In after birth and core.

Embodiment 2, GmNF-YA15 are as the application in transcription factor

Prove that the cardinal principle of the activation characteristic of transcription factor is as follows with yeast-one-hybrid system：By CCAAT cis actings Element and mutant CCAAT cis-acting elements are building up to the basic promoter of pHISi-1 carriers and pLacZi carriers respectively Pmin（minimal promoter）Upstream, Pmin promoter downstream connection reporters（His3, LacZ and URA3）.Work as connection There is the expression vector YEP-GAP of the target gene of encoding transcription factors（Without activation function）It is transformed into that be connected with CCAAT suitable respectively After the yeast cells of formula functional element and mutant CCAAT cis-acting elements, if being connected with mutant CCAAT cis acting members Reporter in the yeast cells of part cannot express, and be connected in the yeast cells of specific CCAAT cis-acting elements Reporter can express, and illustrate that the transcription factor can be combined with CCAAT cis-acting elements, and have the function of activation, activation Pmin promoters, promote reporter to express.To demonstrate the Binding in vivo specificity and activation work(of purpose transcription factor Energy.

Expression vector YEP-GAP:Institute of Crop Science, Chinese Academy of Agricultural Science ensures to provide to the public；Bibliography Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki K, Shinozaki K.Two transcription factors,DREB1and DREB2,with an EREBP/AP2DNA binding domain separate two cellular signal transduction pathways in drought-and low- temperature-responsive gene expression,respectively,in Arabidopsis,Plant Cell1998Aug;10(8):1391-1406。

YPD fluid nutrient mediums：Bacteria Culture yeast extract（Bacto-Yeast Extract）10g/L, Bacteria Culture Use tryptone（Bacto-Peptone）20g/L, adjusts pH to 5.8, and 121 DEG C/15min sterilizings are added after being down to 60 DEG C 40% Glucose makes its final concentration of 20g/L.

SD/His^-/Ura^-/Trp^-Selective medium：Yeast nitrogen without amino acid（Yeast nitrogen base）6.7g/L, auxotroph mixture（drop-out media without His/Ura/Trp）100ml, agar powder （Bacteriological agar）20g/L, adjusts pH to 5.8, and 121 DEG C/15min sterilizings are added 40% after being down to 60 DEG C Glucose makes its final concentration of 20g/L.

Auxotroph mixture（Drop-out mix）：（10×）：L-Isoleucine（Isoleucine）300mg/L, L-Valine（Valine）1500mg/L, L-Adenine（Adenine）200mg/L, L-Arginine（Arginine）200mg/L, L-Histidine Hcl monohydrate（Histidine）200mg/L, L-Leucine（Leucine）1000mg/L, L-Lysine Hcl（Lysine）300mg/L, L-Methionine（Methionine）200mg/L, L-Phenylalanine（Phenylalanine） 500mg/L, L-Threonine（Threonine）2000mg/L, L-Tyrosine（Tyrosine）300mg/L.

1×PEG/LiAc：50%PEG33508ml, 10 × TE buffer1ml, 10 × LiAc1ml.

10×TE Buffer：100mM Tris-Hcl, 10mM EDTA, pH=7.5,121 DEG C of high pressure sterilizations, room temperature preservation.

1×TE/LiAc：10 × TE buffer1ml, 10 × LiAc1ml, ddH₂O8ml。

Z Buffer：Na₂HPO₄·7H₂O16.1g/L, NaH₂PO₄·H₂O5.5g/L, KCl0.75g/L, MgSO₄· 7H₂O0.246g/L adjusts pH to 7.0,121 DEG C/15min sterilizings, 4 DEG C of preservations.

X-gal storing liquids（X-gal Stock Solution）：With N, N-dimethyl-formamide（DMF）Dissolve X- Gal makes its final concentration of 20mg/ml, -20 DEG C of storages.

Z buffer buffer solutions 100ml containing X-gal（Z buffer with X-gal）, matching while using：Z Buffer98ml, beta -mercaptoethanol（β-mercaptoethanol）0.27ml, X-gal storing liquid（X-gal stocksolution）1.67ml.

10×LiAc：100Mm Tris-Hcl,100mM EDTA,pH=7.5.121 DEG C of high pressure sterilizations, room temperature preservations.

One, the structure of recombinant vector

1, the acquisition of GmNF-YA15 genes

According to the primers GmNF-YA15-BI and GmNF-YA15-XI of GmNF-YA15 genes, prime end point It Yin Ru not BamHI and XhoI restriction enzyme sites.

GmNF-YA15-BI：5'-CGCGGATCCATGGTTTGGACAGTGT-3'

GmNF-YA15-XI：5'-CCGCTCGAGTTAGGATGCCCTATCT-3'

Using the cDNA of rich No. 8 entire plant of soybean varieties iron as template, with primer GmNF-YA15-BI and GmNF- YA15-XI carry out PCR amplification.

Obtain the pcr amplification product of 672bp or so.

Recycle pcr amplification product.

2, the structure of recombinant vector

1. the pcr amplification product recycled with restriction enzyme BamHI and XhoI digestion step 1, recycles the digestion of 672bp Product；

2. with restriction enzyme BamHI and XhoI digestion expression vector YEP-GAP, the carrier framework of recycling；

3. the digestion products of step 1. are connected with the carrier framework of step 2.；

4. by the electroporated JM109 bacterial strains of the connection product of step 3.（Purchased from Clontech companies）, 37 DEG C are incubated overnight, Picking positive colony extraction plasmid is sequenced；

Sequencing result shows that plasmid is the DNA pieces shown in the nucleotide of 150-803, the ends 5' by the sequence 2 of sequence table Section is inserted into the recombinant vector obtained between BamHI the and XhoI restriction enzyme sites of carrier YEP-GAP, is named as YEP-GAP-GmNF- YA15。

Two, the verification of the Binding in vivo specificity and activation characteristic of GmNF-YA15

1, the structure of yeast reporter

（1）The structure of normal dual yeast reporter

DNA fragmentation A (contains 4 CCAAT elements):

5’-GAATTC-CCAAT-CCAAT-CCAAT-CCAAT-GTCGAC-3'。

DNA fragmentation A is building up to pHis-1 carriers（MATCHMAKER One-Hybrid System, Clontech companies） Pmin_HIS3Promoter upstream obtains recombinant vector pHis-1-CCAAT, with Xho I and I restriction endonucleases of Nco by pHis-1-CCAAT Carrier is cut into threadiness.

DNA fragmentation A is building up to pLacZi carriers（MATCHMAKER One-Hybrid System, Clontech companies） P_CYCIPromoter upstream obtains recombinant vector pLacZi-CCAAT, with Xho I and I restriction endonucleases of Nco respectively by pLacZi-CCAAT Carrier is cut into threadiness.

Linear pHis-1-CCAAT carriers are first transformed into yeast cells（YM4271 strains, MATCHMAKER One- Hybrid System, Clontech companies）Interior, acquisition can be in SD/His^-The yeast transformant of normal growth on culture medium （Yeast transformant）.Then using this yeast transformant as host cell, continue conversion and contain 4 repetition CCAAT The linear pLacZi-CCAAT carriers of element.Lack the SD/His of histidine and uracil at the same time in this way^-/Ura^-On culture medium, Selection obtains normal dual yeast reporter containing pHis-1-CCAAT and pLacZi-CCAAT.

（2）The structure of dual yeast reporter of mutant

DNA fragmentation B (the mutant TTTTA for containing 4 CCAAT elements):5’-GAATTC-TTTTA-TTTTA-TTTTA- TTTTA-GTCGAC-3'。

DNA fragmentation A, the same step of method are replaced with DNA fragmentation B（1）, obtain dual yeast reporter of mutant.

2, PEG/LiAc methods transformed yeast and interpretation of result

(1) the above-mentioned 1 normal dual yeast reporter containing pHis-1-CCAAT and pLacZi-CCAAT obtained is inoculated with respectively In son and mutant dual yeast reporter to 1ml YPD fluid nutrient mediums, acutely concussion 2 minutes, will suspend after disperseing agglomerate Liquid is gone in the triangular flask containing 50ml YPD fluid nutrient mediums, and 30 DEG C/250rpm shakes overnight, surveys OD600=1.7-1.8（It counts About 4 × 10⁷A/mL）；

(2) 30ml steps are taken（1）Overnight culture is connected in the fresh YPD culture mediums of 300ml, 30 DEG C/250rpm cultures, About 3 hours（To OD600=0.5 ± 0.1）, room temperature 1000g centrifuges 5min, collects thalline, abandon supernatant, outstanding with 1/2 1 × TE of volume It is floating, 1000g/5min centrifugations；

(3) inhale and abandon supernatant, with 1 × TE/LiAc solution suspensions of 1.5ml Fresh, oscillation mixing is spare；

(4) take out 0.1ml competent yeasts to be converted, add following solutions successively：The recombinant vector that 0.1 μ g are prepared by one YEP-GAP-GmNF-YA15、0.1mg ssDNA（Salmon sperm dna, SiTaa）, 0.6mlPEG/LiAc high speed oscillation 1 minute, 30 DEG C/200rpm shaken cultivations 30 minutes；

(5) 70ul DMSO are added（siTaa#D8779）, gently it is inverted mixing, 42 DEG C of heat shocks 30 minutes are gently shaken therebetween It swings, ice bath 2 minutes, room temperature 1000g centrifuges 5min；

(6) inhale and abandon supernatant, 0.5ml1 × TE buffer suspension cells are added；

(7) suspension is dipped with oese, respectively in the SD/His containing 0,15mmol/L3-AT^-/Ura^-/Trp^-Selectivity Setting-out culture on culture medium.

(8) normally dual yeast reporter is sub for the half culture of tablet, dual yeast reporter of the other half culture mutant, with Just check analysis is done.

(9) it is placed upside down in incubator, 30oC is cultivated 3-4 days.

As a result, it has been found that 0mmol/L3-AT SD/His^-/Ura^-/Trp^-Culture medium flat plate on normal yeast reporter Son and yeast reporter of mutation have growth, but the diameter for yeast reporter being mutated is obviously small；And in 15mmol/L3-AT SD/His^-/Ura^-/Trp^-Culture medium flat plate on normal yeast reporter energy normal growth, but yeast reporter being mutated It is suppressed and does not grow.

3, galactosidase activity detects

(1) from the SD/His of 0mmol/L3-AT^-/Ura^-/Trp^-Culture medium flat plate on respectively the normal yeast reporter of picking The yeast reporter daughter colony of son and mutation.It goes in YPD fluid nutrient mediums, in 30 DEG C of shaken cultivations, after length to logarithmic growth Phase takes 1.5ml bacterium solutions, 3000rpm to centrifuge 30s；

(2) supernatant is abandoned, liquid in pipe is drained, centrifuge tube is placed in quick-frozen 10min in liquid nitrogen, taking-up makes it melt naturally, adds 50ul Z/X-gal solution, 30 DEG C of incubations, as a result, it has been found that normal yeast reporter becomes yeast report that is blue, and being mutated in 6-8h Line does not change in 12h, is still white.

Illustrate that transcription factor GmNF-YA15 can be combined with CCAAT cis-acting elements, and have the function of activation, has activated Pmin promoters, promote reporter to express.To demonstrate the Binding in vivo specificity and activation function of GmNF-YA15, GmNF-YA15 is transcription factor.

The application of embodiment 3, GmNF-YA15 in the resistance of reverse for improving plant

One, turn the acquisition of GmNF-YA15 arabidopsis

1, the structure of recombinant vector

1）The clone of GmNF-YA15 genes

According to the primers pair of GmNF-YA15 genes（GmNF-YA15-121F and GmNF-YA15-121R）, draw Object end introduces Sma I and SacI digestion recognition sites respectively,

GmNF-YA15-121F：5'-TCCCCCGGGATGGTTTGGACAGTGTTACGTG-3'；

GmNF-YA15-121R：5'-GCCGAGCTCTTAGGATGCCCTATCTGATGAAG-3'；

With Glycine soybean（Glycine max L.）（Rich No. 8 of iron）CDNA is template, with GmNF-YA15-121F and GmNF-YA15-121R carries out PCR amplification, obtains the PCR product of size about 1Kb（GmNF-YA15 genes）.

Recycle above-mentioned PCR product.

2）, recombinant vector structure

1. the PCR product recycled with restriction endonuclease sma I and SacI digestion steps 1, recycles 672bp digestion products；

2. with restriction enzyme sma I and SacI digestions pBI121（Clontech companies buy）, recycle 672bp carriers Skeleton；

3. the digestion products of step 1. are connected with the carrier framework of step 2.；

4. by the electroporated TOP10 bacterial strains of the connection product of step 3.（Purchased from Beijing Tiangeng company）, 37 DEG C are incubated overnight, Picking positive colony extraction plasmid is sequenced.

Sequencing result shows that plasmid is the DNA pieces shown in the nucleotide of 150-803, the ends 5' by the sequence 2 of sequence table Section is inserted into the recombinant vector obtained between the Sma I and SacI restriction enzyme sites of carrier pBI121, is named as pBI121-GmNF- YA15。

3, the acquisition of recombinational agrobacterium

With recombinant plasmid pBI121-GmNF-YA15 genetic transformation Agrobacteriums C58C1（Beijing Baeyer enlightening biotech company Purchase）, obtain recombinational agrobacterium C58C1/pBI121-GmNF-YA15（Extraction plasmid sends to sequencing, is pBI121-GmNF- YA15, then the recombinant bacterium containing the plasmid is the positive）.

4, turn the acquisition of GmNF-YA15 arabidopsis

1) recombinational agrobacterium that 3 obtain is inoculated in LB (rifampin containing 50mg/ml, 100mg/ml kanamycins, 50mg/ Ml gentamicins) in fluid nutrient medium, 28 DEG C, 3000rpm cultivate about 30 hours, obtain bacterium solution；

2) bacterium solution is gone in LB (rifampin containing 50mg/ml, 100mg/ml kanamycins, 50mg/ml gentamicins), 28 DEG C, 300rpm cultivate about 14 hours（Bacterium solution OD600 reaches 1.5-3.0）；

3) thalline, 4 DEG C, 4000g centrifugation 10min, with containing 10% sucrose MS fluid nutrient mediums are collected（Containing 0.02%silwet） It is about 0.8-1.0 to be diluted to OD600；

4) by arabidopsis（Columbia ecotype Col-0, SALK companies buy, also referred to as wildtype Arabidopsis thaliana）Whole strain with Flowerpot is tipped upside down on together in the container for the bacterium solution for filling step 4, and flower is made to impregnate 50s or so, after immersion, takes out flowerpot, side It is put in pallet, covers black plastic cloth, open plastic cloth after r for 24 hours, uprightly place flowerpot, carry out normal illumination cultivation, receive Obtain T₁For seed, kanamycins screening（A concentration of 50 μ g/L kanamycins）Positive plant is T₁For regeneration plant, pass on, until Obtain T₃For regeneration plant.

T₂T is shown in representative₁The generation selfing seed generated and the plant grown up to by it, T₃T is shown in representative₂The kind that generation selfing generates Son and the plant grown up to by it.

Extract T₃For regeneration plant entire plant DNA as template, use primer pair：F:5'- ATGGTTTGGACAGTGTTACGTG；R:5'-TTAGGATGCCCTATCTGATGAAG-3'；Carry out PCR amplification, part sample knot Fruit is as shown in Figure 4 A, and P Plasmid, M Marker, C are Columbia ecotype arabidopsis Col-0, L1-L3 T₃In generation, is again Raw plant, H H₂O；It is the positive to obtain 654bp.

Extract T₃For the RNA of the entire plant of regeneration plant, reverse transcription obtains cDNA as template, uses primer pair：F:5'- ATGGTTTGGACAGTGTTACGTG；R:5'-TTAGGATGCCCTATCTGATGAAG-3'；Carry out PCR amplification.

The result of part sample is shown in Fig. 4 B, and P Plasmid, M Marker, C are Columbia ecotype arabidopsis Col- 0, L1-L3 T₃For regeneration plant, H H₂O；It is the positive that obtain size, which be 915bp segments,.

Identification is positive as T in above-mentioned DNA and cDNA levels₃In generation, turns GmNF-YA15 arabidopsis.

Plasmid pBI121 is transferred in wildtype Arabidopsis thaliana using same method, obtains turning empty carrier arabidopsis, is cultivated Obtain T₃In generation, turns empty carrier arabidopsis, is identified using same method, does not obtain 915bp segments.

Two, the resistance of reverse identification of genetically modified plants

1, Salt-Tolerance Identification

Respectively by T₃In generation, turns GmNF-YA15 arabidopsis strains GmNF-YA15-1, GmNF-YA15-2, GmNF-YA15-3, T₃ In generation, turns empty carrier arabidopsis and wildtype Arabidopsis thaliana（Each 60 plants）Carry out Salt-Tolerance Identification.Three repeated experiments are set, are as a result taken Average value.

It is overexpressed effects of the GmNF-YA15 because of plant seed Seedling Salt-tolerance for evaluation.

By T₃In generation, turns GmNF-YA15 arabidopsis strains GmNF-YA15-1, GmNF-YA15-2, GmNF-YA15-3, T₃In generation, turns Empty carrier arabidopsis and wildtype Arabidopsis thaliana（WT）The consistent seedling of picking growth conditions after seed sprouting 4d（Fig. 5 A）, it is transferred to It is cultivated vertically on 1/2MS culture mediums containing 150mM NaCl 14 days, observe phenotype, take pictures and counts main root and is long.

Photo is shown in Fig. 5 B.

The a length of 3.62cm of main root of wildtype Arabidopsis thaliana Col-0；

The a length of 5.80cm of main root of GmNF-YA15-1；

The a length of 5.82cm of main root of GmNF-YA15-2；

The a length of 5.85cm of main root of GmNF-YA15-3.

T₃In generation, turns empty carrier arabidopsis and wildtype Arabidopsis thaliana result without significant difference.

Illustrate that gene GmNF-YA15 has salt tolerance.

2, inoxidizability is identified

It is overexpressed GmNF-YA15 because of plant seed seedling stage inoxidizability effects for evaluation.By T₃It is quasi- that in generation, turns GmNF-YA15 Southern mustard strain GmNF-YA15-1, GmNF-YA15-2, GmNF-YA15-3, T₃In generation, turns empty carrier arabidopsis and wildtype Arabidopsis thaliana （WT）Seed（Each 60 plants）Carry out inoxidizability identification.Three repeated experiments are set, and results are averaged.

T₃In generation, turns GmNF-YA15 arabidopsis strains GmNF-YA15-1, GmNF-YA15-2, GmNF-YA15-3, T₃In generation, turns sky The seedling that picking growth conditions are consistent after carrier arabidopsis sprouts 4d with wildtype Arabidopsis thaliana seed, is transferred to containing 7mM H₂O₂ 1/2MS culture mediums on cultivate 14d vertically.Observation phenotype is taken pictures and to count main root long.

Photo is shown in Fig. 5 C.

The a length of 2.91cm of main root of wildtype Arabidopsis thaliana Col-0；

The a length of 5.42cm of main root of GmNF-YA15-1；

The a length of 5.36cm of main root of GmNF-YA15-2；

The a length of 5.38cm of main root of GmNF-YA15-3.

T₃In generation, turns empty carrier arabidopsis and wildtype Arabidopsis thaliana result without significant difference.

Illustrate that gene GmNF-YA15 has inoxidizability.

3, drought tolerance is identified

It is overexpressed GmNF-YA15 because of plant seed seedling stage inoxidizability effects for evaluation.The consistent place of 4 DEG C of growths will be passed through Arabidopsis adjoining tree and the transfer-gen plant for managing 3d are sprouted the consistent seedling of picking growth conditions after 4d, are transferred to containing 4% 14d is cultivated on the 1/2MS culture mediums of PEG vertically, phenotype is observed, take pictures and counts main root is long.Three repeated experiments are set, as a result It is averaged.

Photo is shown in Fig. 5 D.

The a length of 2.30cm of main root of wildtype Arabidopsis thaliana Col-0；

The a length of 4.22cm of main root of GmNF-YA15-1；

The a length of 4.22cm of main root of GmNF-YA15-2；

The a length of 4.22cm of main root of GmNF-YA15-3.

T₃In generation, turns empty carrier arabidopsis and wildtype Arabidopsis thaliana result without significant difference.

Illustrate that gene GmNF-YA15 has drought tolerance.

Claims (8)

1. the encoding gene of a kind of protein or the protein is in adjusting plant stress tolerance or adjusting plant anti-oxidation Using；The resistance of reverse is salt tolerance and/or drought tolerance；

Protein amino acid sequence shown in sequence in sequence table 1 forms.

2. application according to claim 1, it is characterised in that：The encoding gene be it is following 1) or 2)：

1) DNA molecular in sequence table shown in sequence 2；

2) DNA molecular shown in the nucleotide of 5 ' end the 150th to 803 of sequence 2.

3. application according to claim 1 or 2, it is characterised in that：The plant is dicotyledon or monocotyledon.

4. application according to claim 3, it is characterised in that：The dicotyledon is arabidopsis.

5. a kind of method for cultivating genetically modified plants, is the protein for forming amino acid sequence shown in sequence in sequence table 1 Encoding gene imports in purpose plant, obtains genetically modified plants；The resistance of reverse and/or inoxidizability of the genetically modified plants are higher than The purpose plant；

The resistance of reverse is drought tolerance and/or salt tolerance.

6. according to the method described in claim 5, it is characterized in that：The encoding gene be it is following 1) or 2)：

1) DNA molecular in sequence table shown in sequence 2；

2) DNA molecular shown in the nucleotide of 5 ' end the 150th to 803 of sequence 2.

7. method according to claim 5 or 6, it is characterised in that：Described in the encoding gene is imported by recombinant vector Purpose plant；

The purpose plant is dicotyledon or monocotyledon.

8. according to the method described in claim 7, it is characterized in that：The dicotyledon is arabidopsis.