CN104887694A

CN104887694A - Antisense oligonucleotides targeting non-coding RNAs and application thereof in preparation of anti-influenza virus medicament

Info

Publication number: CN104887694A
Application number: CN201510280396.4A
Authority: CN
Inventors: 陈吉龙; 陈玉海; 李芳�; 张兆园
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2015-05-27
Filing date: 2015-05-27
Publication date: 2015-09-09
Anticipated expiration: 2035-05-27
Also published as: CN104887694B

Abstract

The invention discloses antisense oligonucleotides targeting non-coding RNAs and an application thereof in preparation of an anti-influenza virus medicament. The anti-influenza virus medicament consists of antisense oligonucleotide ASO-mvtRNA1, antisense oligonucleotide ASO-mvtRNA2 and antisense oligonucleotide ASO-mvtRNA3. Experiments prove that after the anti-influenza virus medicament is used for interfering with vtRNAs, the replication capacity of influenza viruses obviously declines, which shows that the infection of the influenza viruses controls the expression of the vtRNAs to facilitate respective replication, so that the sensitivity of hosts to the infection of the influenza viruses can be reduced by reducing the expression of the vtRNAs; and the antisense oligonucleotides targeting the vtRNAs can be used as a potential anti-influenza virus medicament.

Description

A kind of antisense oligonucleotide of targeting non-coding RNA and preparing the application in anti-influenza virus medicament

Technical field

The invention belongs to biological technical field, be specifically related to a kind of antisense oligonucleotide of targeting non-coding RNA and preparing the application in anti-influenza virus medicament.

Background technology

Influenza virus (influenza virus) is the important diseases affecting human health and economic development 21 century, along with global economic integration development with exchange between every country day by day frequent, influenza virus produces increasing negative effect to every country and even global economy.3 flu outbreaks occurred in history, and the large influenza of Spain of wherein outburst in 1918 causes 5,000 ten thousand people dead, and the Asia influenza of nineteen fifty-seven outburst causes 2,000,000 people dead, and the Mao flu that nineteen sixty-eight is broken out causes 1,000,000 people dead.There is a kind of novel influenza A H1N1 influenza virus at California, USA and Mexico in April, 2009, this virus propagates rapid spread in the world by human-to-human transmission, and result in the flu outbreak first since entering 21 century.In addition, the seasonal influenza that annual winter-spring season is multiple, frequently and come new subtype influenza virus and bird flu virus serious threat the health of the mankind and the development of animal husbandry.

Influenza virus belongs to RNA viruses, in its reproduction process, the RNA polymerase of virus does not possess proofreading function (3' → 5' 5 prime excision enzyme activity), and can reset by producer in intermediate host body between different influenzae strain virus, so influenza virus morphs continuously, simultaneously along with the selection pressure of anti-influenza virus medicament, drug resistance strain occurs and spread and epidemic thereupon.There is 25-50 ten thousand people in the current whole world every year because of influenza virus death, and so far, the mankind not yet find an effective way controlling influenza infection and propagation.Given this, study flu virus with the relation of host and seek wide spectrum, effective drug target seems especially most important.

Influenza infection relates to the interaction of virus and host, host utilizes self-defensive system to support antiviral invasion on the one hand, on the other hand virus manages the defensive barrier walking around host, and the cellular machineries kidnapping host is to complete oneself infection and reproduction process.In this course, a large amount of host factor is participated.Non-coding RNA (ncRNA) is as novel host factor, and take part in copying and the regulation and control of host anti-virus reaction of influenza virus, but up to now, people know little to its function and mechanism.

VtRNA is that a class is present in vault ribonucleoprotein complex (vault ribonucleoprotein particles, vaults) non-coding RNA in, vault ribonucleoprotein complex is as a kind of ribonucleoprotein complexes, comprise 96 main body of fornix albumen (major vault proteins, MVP), two secondary body of fornix albumen (minor vault proteins, be respectively VPARP and TEP1), in addition containing the vtRNAs of 6 or more.Research finds to knock out the classical architecture that vtRNAs does not change vault complex tubbiness, thus vtRNAs is likely that in vault complex the vtRNAs of research discovery more than 95% further exists with free state in Cytoplasm as a kind of non-structural composition existence.

Up to now, four family members having transcription product are had: vtRNA1-1, vtRNA1-2, vtRNA1-3 and vtRNA2-1 (also referred to as nc886) in human cell, they are by rna plymerase iii (RNA polymerase III, Pol III) catalyze and synthesize, the 2nd type internal promoter elements boxA in its sequence and boxB high conservative.Corresponding vtRNAs is all there is in the species such as mice, rat and bull frog.

Due to vaults in several drug resistance tumor cell line high expressed and have height evolutionary conservatism, recent people start the functional mechanism paying close attention to vaults.But correlational study mainly concentrates on main body of fornix albumen, also relatively deficient to the functional study of vault RNAs.2009, the people such as Persson report vtRNA1-1 can produce little body of fornix RNA (small vault RNA by DICER mechanism, svRNA), a svRNAb is wherein had to be similar to the mechanism of action of miRNA to lower the expression of CYP3A4 gene (a kind of enzyme needed in drug metabolism).Recently, research worker finds great expression in the host cell that vtRNAs infects at gamma herpes viruses, this means that vtRNAs probably take part in host and viral mutual work.Ironically, vtRNA2-1 was reported as a newfound tumor antioncogene successively in recent years, and research finds that it plays a role in a lot of tumors, and this cancer suppressing action is by suppressing the activity of PKR to realize.But also there is not been reported for the function of vtRNAs in influenza infection and the mechanism of action.

Summary of the invention

The technical problem to be solved in the present invention how to prevent and/or treat influenza virus.

In order to solve the problems of the technologies described above, the present invention provide firstly the novelty teabag of the material suppressing vault rna expression.

The invention provides and suppress the material of vault rna expression to have the application in the product of the middle at least one function in (1)-(4) as follows in preparation:

(1) influenza virus is prevented and/or treated;

(2) copying of influenza virus is suppressed;

(3) redness degree of animal lungs after influenza infection is reduced;

(4) virus load of animal lungs after influenza infection is reduced.

In above-mentioned application, the material of described suppression vault rna expression is following 1) or 2):

1) compositions;

2) containing 1) test kit of described compositions;

Described compositions is made up of ASO-mvtRNA1, ASO-mvtRNA2 and ASO-mvtRNA3; Or described compositions is by ASO-mvtRNA1 solution, ASO-mvtRNA2 solution and ASO-mvtRNA3 solution composition;

Described ASO-mvtRNA1 is the single strand RNA molecule shown in sequence 1 in sequence table;

Described ASO-mvtRNA2 is the single strand RNA molecule shown in sequence 2 in sequence table;

Described ASO-mvtRNA3 is the single strand RNA molecule shown in sequence 3 in sequence table.

In above-mentioned application, the mass ratio of described ASO-mvtRNA1, described ASO-mvtRNA2 and described ASO-mvtRNA3 is 1:1:1;

The mass ratio of the ASO-mvtRNA2 in the ASO-mvtRNA1 in described ASO-mvtRNA1 solution, described ASO-mvtRNA2 solution and the ASO-mvtRNA3 in described ASO-mvtRNA3 solution is 1:1:1;

The complete nucleotide of described ASO-mvtRNA1, described ASO-mvtRNA2 and described ASO-mvtRNA3 all carries out D2EHDTPA modification;

And the 1-6 position nucleotide of described ASO-mvtRNA1 and 20-25 position nucleotide carry out 2'-O-Methyl modification;

1-6 position nucleotide and the 20-25 bit base of described ASO-mvtRNA2 carry out 2'-O-Methyl modification;

1-5 position nucleotide and the 16-20 bit base of described ASO-mvtRNA3 carry out 2'-O-Methyl modification.

In above-mentioned application, the solvent of described ASO-mvtRNA1 solution, described ASO-mvtRNA2 solution and described ASO-mvtRNA3 solution is PBS buffer; The formula (1L) of described PBS buffer: NaCl 8.18g; KCl 0.20g; Na ₂hPO ₄12H ₂o 3.58g; KH ₂pO ₄0.24g, pH 7.4.

In above-mentioned application, described vault RNA derives from the cell of human or animal; Described cell is specially A549 cell, NIH/3T3 cell, LLC cell or 4T1 cell; Described animal is specially mice.

In above-mentioned application, the sequence of described vault RNA is as shown in Gene bank Number NR_027885.1.

In order to solve the problems of the technologies described above, the present invention provides again a kind of product.

The active component of product provided by the invention is suppress the material of vault rna expression: described product has at least one function in (1)-(4) as follows:

(1) influenza virus is prevented and/or treated;

(2) copying of influenza virus is suppressed;

(3) redness degree of animal lungs after influenza infection is reduced;

(4) virus load of animal lungs after influenza infection is reduced.

In the said goods, the material of described suppression vault rna expression is following 1) or 2):

1) compositions;

2) containing 1) test kit of described compositions;

In the said goods,

The mass ratio of described ASO-mvtRNA1, described ASO-mvtRNA2 and described ASO-mvtRNA3 is 1:1:1;

In the said goods, the solvent of described ASO-mvtRNA1 solution, described ASO-mvtRNA2 solution and described ASO-mvtRNA3 solution is PBS buffer; The formula (1L) of described PBS buffer: NaCl 8.18g; KCl 0.20g; Na ₂hPO ₄12H ₂o 3.58g; KH ₂pO ₄0.24g, pH 7.4.

In the said goods, described vault RNA derives from the cell of human or animal; Described cell is specially A549 cell, NIH/3T3 cell, LLC cell or 4T1 cell; Described animal is specially mice.

In the said goods, the sequence of described vault RNA is as shown in Gene bank Number NR_027885.1.

In order to solve the problems of the technologies described above, present invention also offers the novelty teabag of vtRNA.

The invention provides vault RNA as the application in the target spot of resisiting influenza virus or vault RNA as the application of target spot in the medicine of exploitation resisiting influenza virus.

In above-mentioned application or the said goods, described influenza virus is influenza A virus; Described influenza A virus is influenza A H1N1 influenza virus.

After the present invention is infected by infected by influenza, in alveolar epithelial cells system A549, non-coding RNA carries out chip analysis, find that there is the non-coding RNA family entirety that a class is called vault RNAs (vtRNAs) and there occurs remarkable rise, influenza infection also can cause the up-regulated of mvtRNA (mouse vtRNA) in Mus source cell system NIH/3T3, LLC, 4T1 and c57 mouse lung tissue; The present invention is also using the new target drone of vtRNAs a kind of resisiting influenza virus, obtain the antisense oligonucleotide for vtRNAs, prove by experiment: after antisense oligonucleotide interference vtRNAs, the replication capacity of influenza virus obviously declines, illustrate that influenza infection has handled the expression of vtRNAs, be beneficial to copying of self, thus the expression reducing vtRNAs can reduce the sensitivity of host's infected by influenza infection, and the antisense oligonucleotide that the present invention is directed to vtRNAs design can as a kind of potential anti-influenza virus medicament.

Accompanying drawing explanation

Fig. 1 is chip cluster analysis result.

Fig. 2 is the expression of mvtRNA in the mouse cell lines and mice lung tissue of influenza infection.Fig. 2 A is the expression of vtRNA in the mouse cell lines of influenza infection; Fig. 2 B is the expression of mvtRNA in the mice lung tissue of influenza infection; Fig. 2 C is the expression of mvtRNA in the mice lung tissue of influenza infection.

Fig. 3 is the expression of mvtRNA in mice lungs after ASO interference mvtRNA.Fig. 3 A is the expression of the mvtRNA after ASO interference mvtRNA in mice lungs; Fig. 3 B is the expression of the mvtRNA after ASO interference mvtRNA in mice lungs.

Fig. 4 is mouse tissue organ change after ASO interference mvtRNA, lung inner virus carrying capacity and lungs pathological change situation.Fig. 4 A disturbs mouse tissue organ situation of change after mvtRNA for utilizing ASO; Fig. 4 B disturbs mouse lung inner virus carrying capacity situation after mvtRNA for utilizing ASO; Fig. 4 C disturbs mouse lung disease of ZANG-organs reason situation of change after mvtRNA for utilizing ASO.

Detailed description of the invention

The experimental technique used in following embodiment if no special instructions, is conventional method.

Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

H1N1 type influenza virus A/WSN/33 strain derives from the biological product collecting center (American type culture collection, ATCC) of Unite States Standard, is numbered VR-825.The virus liquid of H1N1 type influenza virus A/WSN/33 strain is that instar chicken embryo 48h on the 9th is inoculated in H1N1 type influenza virus A/WSN/33 strain, get allantoic fluid obtain.

A549 cell derived, in the biological product collecting center (American type culture collection, ATCC) of Unite States Standard, is numbered CCL-185; Mouse cell lines NIH/3T3 derives from the biological product collecting center (American type culture collection, ATCC) of Unite States Standard, is numbered CRL-165; Mouse cell lines LLC derives from Shanghai Inst. of Life Science, CAS cellular resources center, is numbered: 3131C0001000800007; Mouse cell lines 4T1 derives from the biological product collecting center (American type culture collection, ATCC) of Unite States Standard, is numbered CRL-2539.

The formula (1L) of PBS buffer: NaCl 8.18g; KCl 0.20g; Na ₂hPO ₄12H ₂o 3.58g; KH ₂pO ₄0.24g, pH 7.4.

The expression analysis of the vtRNAs family of the cell of embodiment 1, influenza infection

The chip analysis of vtRNAs family in the alveolar epithelial cells system A549 of one, influenza infection

1, test material and method

1) preparation of the cell of influenza infection

A549 cell is inoculated in containing 10% hyclone (Gibco company, Cat.NO.10270-106) culture medium DMEM (Gibco company, Cat.NO.12800-017) cultivate, culture medium is changed into viral infection maintenance medium (DMEM+2 μ g/mL trypsin) in time growing into density and be 80%, obtain treating infection cell culture medium; With the influenza virus A/WSN/33 strain of viral infection maintenance medium dilution H1N1 type, obtain the virus liquid after diluting, by dilution after virus liquid with treat that infection cell culture medium mixes, virus is made to be 2 with the ratio (MOI value) of cell quantity, every 25min jiggles, and viruses adsorption discards culture medium after infecting 1 hour, and PBS washes 2 times, change viral maintenance medium into cultivate, obtain the cell of influenza infection.

2) preparation of the mice lung tissue after influenza infection

The mice that H1N1 type influenza virus A/WSN/33 strain is infected is taken off cervical vertebra put to death, dissect mice and get lung tissue, tissue wet 30-50mg/ pipe subpackage, place-80 degree cryogenic refrigerators after liquid nitrogen flash freezer and preserve.

3) chip analysis of the cell of influenza infection

Extract above-mentioned steps 1) RNA of the cell of influenza infection that obtains, in vitro transcription is cRNA, and by after its fragmentation, be sent to the biomedical Science and Technology Ltd. of Shanghai Ou Yi and carry out chip hybridization and chip analysis, the name of chip is called Agilent Sureprint G3Human Gene Expression Microarray V2.0.

2, result of the test

Chip cluster analysis result is as shown in Figure 1: wherein WSN-represents matched group; WSN+ represents infection group and viral infection group.As can be seen from the figure, the vtRNAs in the cell of influenza infection all there occurs rise, illustrates that influenza infection can cause the expression of vtRNAs in A549 cell significantly to raise.

The expression analysis of vtRNA in the mouse cell lines of two, influenza infection

1, test material and method

1) extraction of RNA

Extract the RNA of mouse cell lines NIH/3T3, mouse cell lines LLC and mouse cell lines 4T1 respectively, obtain the RNA of mouse cell lines NIH/3T3, mouse cell lines LLC and mouse cell lines 4T1 respectively.

2) preparation of cDNA

Respectively with above-mentioned RNA for template, adopt the Reverse Transcriptase kit of Promega company to carry out reverse transcription and obtain cDNA.

3)RT-PCR

Respectively with above-mentioned steps 2) cDNA of the cell of viral infection that obtains is template, the primer in employing table 1 carries out pcr amplification, obtains pcr amplification product; Electrophoresis detection pcr amplification product, obtains the expression of vtRNA.

Table 1, Primer and sequence

Primer	Primer sequence
		mvtRNA_F	GGACCCGATTGGTCTGTCAT
mvtRNA_R	GATTCGCAGCGGCAAAAGG
		Internal reference GAPDH (mice) _ F	GCCTCGTCCCGTAGACAAAA
Internal reference GAPDH (mice) _ R	CCCTTTTGGCTCCACCCTTC

2, result of the test

The expression of vtRNA in the mouse cell lines NIH/3T3, LLC, 4T1 of influenza infection be as shown in Figure 2 A: as can be seen from the figure: in these three kinds of cell lines, the expression of vtRNA all there occurs remarkable rise.

The expression analysis of mvtRNA in the mice lung tissue of three, influenza infection

1, test material and method

1) extraction of RNA

Extract the RNA of the mice lung tissue after influenza infection, obtain the RNA of mice lung tissue.

2) preparation of cDNA

With above-mentioned RNA for template, adopt the Reverse Transcriptase kit of Promega company to carry out reverse transcription and obtain cDNA.

3)RT-PCR

With above-mentioned steps 2) cDNA of the mice lung tissue of influenza infection that obtains is template, the primer in employing table 1 carries out RT-PCR amplification, obtains pcr amplification product, electrophoresis detection pcr amplification product, obtains the expression of vtRNA.

4)Realtime PCR

Real time-PCR adopts the Super-real PreMix test kit of Tian Gen biochemical corp, with the cDNA of mice lung tissue for template, primer in employing table 1 carries out Realtime pcr amplification, utilizes quantitative real time PCR Instrument (ABI7500) to detect the expression of vtRNA.

In mice lung tissue, the testing result of vtRNA expression as illustrated by figures 2 b and 2 c: as can be seen from the figure: in the mice lung tissue of influenza infection, vtRNA there occurs remarkable rise equally, the matched group of non-influenza virus infection is compared, and mvtRNA has raised 3.5 times.

The Antisensedigonucleotsequence sequence of embodiment 2, interference mvtRNA and application thereof

One, design and the synthesis of the Antisensedigonucleotsequence sequence of mvtRNA is disturbed

According to AntiSense Design design software (the http://www.idtdna.com/Scitools/Applications/AntiSense/Antisense .aspx that Integrated Device Technology, Inc. provides? source=menu), the antisense oligonucleotide interference sequence of design targeting mice mvtRNA (Gene bank Number:NR_027885.1 and submission day: 2013-11-5), the antisense oligonucleotide interference sequence designed for mice mvtRNA is as shown in table 2.Antisense oligonucleotide interference sequence synthesizes in Sangon Biotech (Shanghai) Co., Ltd..All nucleotide of the antisense oligonucleotide of synthesis carry out D2EHDTPA modification, and underscore nucleotide also carries out 2'-O-Methyl modification.

Table 2, antisense oligonucleotide interference sequence

Title	Sequence
		ASO-GFP	5'- TCACCTTCACCCTCT CCACT-3'(sequence 4)
ASO-mvtRNA1	5'- GGGTTAGGTAAGTGGTTGG TTGTGT-3'(sequence 1)
		ASO-mvtRNA2	5'- GCTGGCCCGTCTATCTCTT CCTGGA-3'(sequence 2)
ASO-mvtRNA3	5'- CGGGTTAGGTAAGTG GTTGG-3'(sequence 3)

Two, the Antisensedigonucleotsequence sequence of mvtRNA is disturbed to suppress the application in the copying of influenza virus

1, test material and processing method

1) antisense oligonucleotide ASO-mvtRNA1, ASO-mvtRNA2 and the ASO-mvtRNA3 in PBS buffer solution table 2 is utilized, make ASO-mvtRNA1, ASO-mvtRNA2 and ASO-mvtRNA3 concentration in PBS buffer be 100 μ g/mL, obtain antisense oligonucleotides acid solution.

2) by the mode process 4-5 week age female mice (purchased from dimension tonneau China company) of above-mentioned antisense oligonucleotides acid solution (ASO-mvtRNA group) by atomized medicine introducing, dosage 3.0mg/kg body weight, with ASO-GFP (ASO-GFP matched group, ASO-GFP is the arbitrary sequence be not combined with vtRNA) for contrast.After 24h, collunarium infects 1 × 10 ⁴pFU A/WSN/33 influenza virus, gets mice lungs after 72h and spleen is taken pictures.

Mice collunarium infects 1 × 10 ⁴the method of PFU A/WSN/33 influenza virus: first use the rapid anesthetized mice of the ether of suitable concentration, make it suck 1 × 10 by nasal drip ⁴the A/WSN/33 virus liquid of PFU.

2, the detection of RT-PCR and Realtime PCR

1)RT-PCR

With the cDNA of the mice lung tissue of influenza infection (ASO-GFP matched group and ASO-mvtRNA group) for template, primer in employing table 1 carries out RT-PCR, obtain pcr amplification product, electrophoresis detection pcr amplification product, obtains the situation of change of mvtRNA in the rear mice lung tissue of ASO process.

The testing result of RT-PCR is as shown in Figure 3A: as can be seen from the figure: the expression of the mvtRNA in ASO-mvtRNA group is starkly lower than ASO-GFP matched group, after illustrating that the RNA of lung tissue disturbs, the expression of the mvtRNA in Mice Body obviously reduces.

2)Realtime PCR

With the cDNA of the mice lung tissue of viral infection (ASO-GFP matched group and ASO-mvtRNA group) for template, adopt the Super-real PreMix test kit of Tian Gen biochemical corp, and adopt the primer in following table 1 to carry out Realtime PCR, utilize quantitative real time PCR Instrument (ABI 7500) to detect the situation of change of mvtRNA in mice lung tissue.

The testing result of Realtime PCR is as shown in Figure 3 B: as can be seen from the figure, the expression of the mvtRNA in ASO-mvtRNA group is starkly lower than ASO-GFP matched group, compares with matched group, and the expression of ASO-mvtRNA group mvtRNA reduces 3 times.

3, histoorgan pathological changes is observed

The result of mice lungs and spleen is got as shown in Figure 4 A: as can be seen from the figure after 72h, the lungs of the matched group of non-influenza virus infection and the influenza virus infection group (ASO-mvtRNA group) of interference mvtRNA do not have hyperemia substantially, and ASO-GFP matched group is obviously congested.

4, plaque detects

The method adopting plaque to detect detects the impact copied of the Antisensedigonucleotsequence sequence infected by influenza in vitro of interference mvtRNA, and concrete steps are as follows:

1) by density be 50% mdck cell be inoculated in 12 well culture plates, when it grows to 80-90% degree of converging, use viral infection mdck cell.Concrete step: the lung tissue lapping liquid getting influenza virus infection carries out doubling dilution, gets different dilution factor (10 ², 10 ³with 10 ⁴dilution) virus liquid infect mdck cell;

2) virus liquid infection mdck cell changed liquid after 1 hour, 3 times are washed with PBS, every hole add preheating 1000 μ L be mixed with low melting-point agarose without phenol red DMEM solution (dual anti-+ 0.1%TPCK pancreatin of 20% agarose+80%DMEM+0.1%), gently be placed in 4 DEG C of condensation 30min, to be condensed fully after Tissue Culture Plate is inverted in cell culture incubator, 37 DEG C of constant temperature culture 48h, observe and record result.

Plaque assay result is as shown in Figure 4 B: as can be seen from the figure, in the lung of ASO-mvtRNA group, virus load is starkly lower than ASO-GFP matched group, illustrates that after utilizing ASO-mvtRNA to disturb mvRNA, the levels of replication of influenza virus obviously reduces.

5, staining examine

Get mice lung tissue and carry out hematoxylin-eosin (hematoxylin-eosin, HE) dyeing (400 ×).Concrete steps are as follows:

(1) dewax: main dimethylbenzene dewaxes.

(2) graded ethanol aquation.

(3) tap water.

(4) brazilwood extract dyeing: hematoxylin dye liquor leaching 5 ~ 20min is put in the section after aquation, transfect cell core.Tap water 3 ~ 5min.

(5) 1% acidic alcohol differentiation 5 ~ 30s.Tap water 1 ~ 3min.

(6) weak alkaline aqueous solution returns blue 30s ~ 1min.Tap water fully rinses 5 ~ 10 minutes.

(7) eosin stains: the section fully after aquation directly enters in eosin stains liquid, transfect cell matter about 5 ~ 15min.

(8) graded ethanol dehydration.

(9) dimethylbenzene is transparent.

(10) neutral gum mounting.

The coloration result of mice lung tissue is as shown in Figure 4 C: the alveolar epithelial cells hypertrophy of viral infection ASO-GFP matched group under high power lens, alveolar septum thicken and telangiectasis is wherein congested and with obvious hemorrhage, edema phenomenon, have the cell component such as more erythrocyte, lymphoid cell, macrophage in the edematous fluid of red light dye, and viral infection ASO-mvtRNA experimental group has than the symptom of ASO-GFP matched group and obviously alleviates.

Claims

1. suppress the material of vault rna expression to have the application in the product of the middle at least one function in (1)-(4) as follows in preparation:

(1) influenza virus is prevented and/or treated;

(2) copying of influenza virus is suppressed;

(3) redness degree of animal lungs after influenza infection is reduced;

(4) virus load of animal lungs after influenza infection is reduced.

2. application according to claim 1, is characterized in that: the material of described suppression vault rna expression is following 1) or 2):

1) compositions;

2) containing 1) test kit of described compositions;

3. application according to claim 1 and 2, is characterized in that: the mass ratio of described ASO-mvtRNA1, described ASO-mvtRNA2 and described ASO-mvtRNA3 is 1:1:1;

4., according to described application arbitrary in claim 1-3, it is characterized in that: described vault RNA derives from the cell of human or animal; Described cell is specially A549 cell, NIH/3T3 cell, LLC cell or 4T1 cell; Described animal is specially mice.

5. a product, its active component is suppress the material of vault rna expression: described product has at least one function in (1)-(4) as follows:

(1) influenza virus is prevented and/or treated;

(2) copying of influenza virus is suppressed;

(3) redness degree of animal lungs after influenza infection is reduced;

(4) virus load of animal lungs after influenza infection is reduced.

6. product according to claim 5, is characterized in that: the material of described suppression vault rna expression is following 1) or 2):

1) compositions;

2) containing 1) test kit of described compositions;

7. the product according to claim 5 or 6, is characterized in that:

8., according to described product arbitrary in claim 5-7, it is characterized in that: described vault RNA derives from the cell of human or animal; Described cell is specially A549 cell, NIH/3T3 cell, LLC cell or 4T1 cell; Described animal is specially mice.

9.vault RNA as the application in the target spot of resisiting influenza virus or vault RNA as the application of target spot in the medicine of exploitation resisiting influenza virus;

Described vault RNA derives from the cell of human or animal; Described cell is specially A549 cell, NIH/3T3 cell, LLC cell or 4T1 cell; Described animal is specially mice.

10., according to arbitrary described product or application according to claim 9 in described application arbitrary in claim 1-4 or claim 5-8, it is characterized in that: described influenza virus is influenza A virus; Described influenza A virus is influenza A H1N1 influenza virus.