CN116555257A

CN116555257A - siRNA for inhibiting olympic Nsp13 gene and application thereof

Info

Publication number: CN116555257A
Application number: CN202310324666.1A
Authority: CN
Inventors: 李萍; 徐维勇; 蒙羽涵
Original assignee: Guiyi Technology Shanghai Co ltd
Current assignee: Guiyi Technology Shanghai Co ltd
Priority date: 2023-03-30
Filing date: 2023-03-30
Publication date: 2023-08-08

Abstract

The invention discloses siRNA for inhibiting an olympic games Nsp13 gene and application thereof. The sequence of the invention is aimed at the Nsp13 gene of 2019-nCOV, and can effectively inhibit the function of RNA uncoiling enzyme when the novel coronavirus replicates. Wherein part of the phosphoric acid of SS1 has thio-modification. Wherein the partial ribose of SS2 has 2' -F and 2' -OMe modification, and the partial ribose of AS2 has 2' -OMe modification. Wherein, part of ribose of SS3 is modified by 2'-OMe, and part of ribose of AS3 is modified by 2' -OMe. The siRNA provided by the invention can reduce proliferation of novel coronaviruses, can be used as an effective target point for developing anti-novel coronavirus medicaments, and provides an effective technical means for resisting 2019-nCOV-ommicro-BA.1/BA.2 viruses.

Description

siRNA for inhibiting olympic Nsp13 gene and application thereof

Technical Field

The invention relates to siRNA for inhibiting an olympic games Nsp13 gene and application thereof, belonging to the technical field of biological medicine.

Background

The novel coronavirus SARS-CoV-2, the disease caused by which is known as COVID-19. The novel coronaviruses are transmitted mainly by direct contact, droplets and aerosol routes. In terms of health effects, novel coronavirus infections can affect multiple organs of the body, including the kidneys, heart and lungs. Clinical manifestations of novel coronavirus infections are often fever, headache, weakness, etc. Severe cases may develop febrile syncope, organ failure, and even death. Although some patients can be cured, some infected persons may have irreversible life-long sequelae, such as brain nervous system injury, heart injury and the like, and some patients also have pulmonary fibrosis symptoms.

The novel coronavirus nonstructural protein NSP13 is a highly evolutionarily conserved helicase and RNA 5' -triphosphatase, and moves along the direction of nucleic acid by utilizing energy generated by hydrolysis of nucleoside triphosphates to promote the melting of double-stranded nucleic acid, and plays a vital role in the viral replication process. At the same time, NSP13 is also involved in the capping of viral RNA, which protects it from attack by the human immune system. The new coronavirus vaccine prepares the immune system against the virus, while antiviral drugs treat an already initiated infection by interfering with an important part of the viral mechanism. NSP13 is one of the most promising candidate targets for the development of pan-coronavirus therapy, in combination with its established nucleotide binding site and drug formation. Although much information has been obtained about the novel coronavirus NSP13, drug development for this target is relatively lacking and no drug for this target is currently marketed.

In the pharmaceutical treatment of covd-19, nematavir and Ritonavir tablets (oral antiviral drugs of the gabion, sold under the name Paxlovid) are widely used in light and medium-grade covd-19 patients with highest risk of hospitalization. The World Health Organization (WHO) calls Paxlovid the best treatment option for high-risk patients to date and strongly suggests that Paxlovid be used in non-critically ill covd-19 patients with severe illness and highest risk of hospitalization, such as non-vaccinated patients, elderly or immunocompromised patients. Furthermore, the world health organization updated the recommendation for the gilid antiviral drug, adefovir (Remdesivir), which was conditionally recommended to non-critically ill patients at high risk of hospitalization. Reed the previous suggestion that adefovir was not conditionally recommended to any patient with COVID-19. In addition, advice for critically ill and critically ill patients is being updated with new evidence.

In recent years, gene therapy research has made remarkable progress, and has become an effective method for treating cancer. Among them, RNAi is an effective method for inhibiting gene expression using nucleic acid molecules such as RNA. RNAi has important functions in gene function research, gene therapy, drug screening and the like due to the characteristics of strong specificity, simple operation, high efficiency and the like. RNAi has been found to represent a great prospect in the treatment of disease and offers promise for the development of new molecular therapeutic agents that can interfere with pathogenic genes, particularly those encoding non-drug targets that are difficult to achieve with conventional therapies. Up to now, more and more researches prove that siRNA interference has wide application prospect in the treatment of diseases such as cancer, virus infection and the like.

Disclosure of Invention

In order to solve the technical problems, the invention provides an siRNA interfering with a novel coronavirus.

A first object of the present invention is to provide an siRNA inhibiting the Olympic Nsp13 gene, wherein the sense strand of the siRNA has the sequence of 5'-CCACCACUUAACCGAAAUUAUGU-3' (SS) and the antisense strand has the sequence of 5'-AUAAUUUCGGUUAAGUGGUGGUC-3' (AS).

The siRNA specifically targets the Nsp13 gene of 2019-nCOV. In the invention, 2019-nCOV-NSp13 specifically refers to an olympic strain BA.1 and an olympic strain BA.2, and other strains with high homology are not listed.

Further, the siRNA may further comprise chemical modification of the sense strand and/or the antisense strand.

Further, the chemical modification comprises one or more of thio modification, methoxy modification and fluoro modification.

Further, the chemical modification is to replace hydroxyl of ribose C-2' in 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 bases from the 5' end of the sense strand of siRNA with fluorine atom, and to methylate hydroxyl of ribose C-2' in 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 bases into methoxy pentose; and methylation of ribose C-2 'hydroxyl groups in 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 bases from the 5' end of the antisense strand of the siRNA into methoxy pentose.

Further, the chemical modification is to subject the sense strand of the siRNA to a thio modification from the 5' end to the phosphate at positions 2, 3, 4, 5, 6, 7, 17, 18, 19, 20 and 21, and the antisense strand is not subject to the chemical modification.

Further, the chemical modification is methylation of ribose C-2 'hydroxyl groups in 1, 2, 4, 5, 7, 8, 9, 12, 13, 18, 19, 21, 23 bases from the 5' end of the sense strand of siRNA into methoxy pentose; the antisense strand of siRNA is methylated into methoxy pentose from the hydroxyl of ribose C-2 'in the 2 nd and 22 nd bases from the 5' end.

In a second aspect, the invention provides the use of an siRNA in the preparation of a nucleic acid medicament for the treatment of a novel coronavirus infection.

Further, the siRNA is encapsulated by a delivery carrier to prepare the drug.

Further, the drug is administered by nebulization or intravenous injection.

The beneficial effects of the invention are as follows:

the invention discloses a pair of siRNA for specifically interfering novel coronaviruses, provides three effective chemical modification methods, can effectively knock down an Nsp13 gene of 2019-nCOV-ommicro-BA.1/BA.2, can be used as an effective target point for developing anti-novel coronavirus medicaments, and provides an effective technical means for resisting 2019-nCOV-ommicro-BA.1/BA.2 viruses.

Description of the drawings:

FIG. 1 is a position of the Nsp13 gene in the 2019-nCOV-ommicro-BA.1/BA.2 genome;

FIG. 2 is a chemically modified formula;

FIG. 3 is a plasmid map for constructing the expression of the Nsp13 gene;

FIG. 4 is a firefly luciferase structure;

FIG. 5 is a statistical graph of inhibition of NSp13 gene expression;

FIG. 6 is a schematic diagram of an SS1+AS1 electrophoresis running gel.

Detailed Description

The present invention will be further described with reference to specific examples, which are not intended to be limiting, so that those skilled in the art will better understand the present invention and practice it.

Example 1: design of 2019-nCOV-ommicro-BA.1/BA.2NSp13 gene siRNA

We selected the Nsp13 gene region of open reading frame ORF1a (FIG. 1), downloaded the sequences of BA.1 and BA.2, removed the easily mutated regions, and selected the common conserved region sequences of BA.1 and BA.2 (shown in SEQ ID NO. 1). The siRNA is designed, and sequences near a 5 'untranslated region, a 3' untranslated region and a start codon are not used as templates for designing the siRNA when the siRNA is designed, and finally, a specific sequence is designed. By base analysis of the sequences, we designed a chemical modification method of siRNA (fig. 2), and after screening, the sequences SS1, AS1, SS2, AS2, SS3, AS3 were finally determined (table 1). And (3) obtaining a crude product of siRNA by a nucleic acid synthesizer and adopting a solid phase synthesis method, and purifying the crude product by AKTA explorer100 to obtain a final product.

TABLE 1

Sequence number	Sequence (5 '-3')	Annotating
			SS	CCACCACUUAACCGAAAUUAUGU	/
AS	AUAAUUUCGGUUAAGUGGUGGUC	/
			SS1	CfCoAfCoCfAoCfUoUfAoAfCoCfGoAfAoAfUoUfAoUfGU	'O' is methoxy modification; 'f' is fluoro modification
AS1	AoUAoAUoUUoCGoGUoUAoAGoUGoGUoGGoUC	'O' is methoxy modification
			SS2	CCACCACUUAACCGAAAUUAU*GU	' is thio-modified
AS2	AUAAUUUCGGUUAAGUGGUGGUC	/
			SS3	CoCoACoCoACoUoUoAACoCoGAAAUoUoAUoGUo	'O' is methoxy modification
AS3	AUoAAUUUCGGUUAAGUGGUGGUoC	'O' is methoxy modification

Example 2: construction of Nsp13 Gene in vitro

The 2019-nCOV-ommicro-BA.1/BA.2NSp13 gene is taken as a target sequence, and is constructed into VB UltraStable plasmid, two ends of the NSp13 gene are connected with Sall enzyme and Xhol enzyme cleavage sites, and a plasmid map is shown in figure 3. The construction of the plasmid and the Nsp13 sequence were as expected by restriction enzyme sequencing analysis. 100ul to 150ml of liquid culture medium is taken out of the glycerol bacteria, amp is added proportionally, and shaking is carried out at 37 ℃ for overnight.

Plasmid extraction:

1) Centrifuging the bacterial liquid at 12000rpm for 1min, and discarding the supernatant;

2) Precipitating 7.5ml Buffer P1 to the thallus, and shaking and mixing;

3) 7.5ml Buffer P2 is added, the mixture is gently inverted for 6 to 8 times, and the mixture is placed for 5 minutes at room temperature;

4) Adding 7.5ml Buffer P4 into the suspension, uniformly mixing up and down, precipitating in white, centrifuging at 10000rpm for 10min, and carefully sucking the supernatant into a new 50ml centrifuge tube;

5) Adding 0.1 times of endotoxin scavenger into the supernatant, mixing, and ice-bathing for 5min;

6) Standing at room temperature for 10min, centrifuging at 12000rpm for 10min, transferring the upper water phase containing DNA to a new tube, and discarding oily layer;

7) Adding 0.5 times volume of isopropanol, mixing, transferring into an adsorption column, centrifuging at 12000rpm for 1min, and pouring out the waste liquid in the collection pipe;

8) Adding 10ml of rinsing liquid PW, centrifuging at 12000rpm for 1min, discarding the waste liquid, and repeating for one time;

9) Idling the centrifuge tube for 3min, thoroughly discarding residual liquid, and airing at room temperature for 5min;

10 Taking out the adsorption column, placing into a clean centrifuge tube, dripping 2ml of sterilized water for injection into the middle of the adsorption film, standing for 3min at room temperature, centrifuging at 10000rpm for 3min, and collecting plasmid liquid;

11 Quantitative and dilution to corresponding concentration, sub-packaging and preserving at-20 ℃ for standby.

Example 3: firefly luciferase assay

1) Plasmid and ss1+as1, plasmid and ss2+as2, plasmid and ss3+as3 co-transfect cnez2 cells, respectively;

2) After 24-48h, the culture medium is discarded, and the reporter gene cell lysate is added;

3) After full lysis, centrifuging for 5min at 12000g, and taking the supernatant to be measured;

4) Starting the chemiluminescent instrument, wherein the measurement interval is set to be 2s, and the measurement time is set to be 10s;

5) 100ul of supernatant is taken and added into an ELISA plate, and then 100ul of firefly luciferase detection reagent is added, and the mixture is uniformly mixed and read.

6) Experimental results

The value of firefly luciferase is directly read, the level of Nsp13 expression is indicated by the value, and then the effect of siRNA silencing target, namely RNA knockdown efficiency, is obtained. FIG. 4 shows that when plasmids were co-transfected with sinc (control), the fluorescence values were very high, when plasmids were co-transfected with SS1+AS1, SS2+AS2 or SS2+AS2, the fluorescence values were much lower than the control, and only less than 10% of the expression level was observed, when plasmids were co-transfected with E-siLuci (siRNA of lusiferase), the fluorescence values were very low in the positive control. This demonstrates that the effect of the SS1+as1, SS2+as2 or SS3+as3 knock-down of nsp13 gene is significant.

Example 4: real-time fluorescent quantitative PCR assay

1) Plasmid and siRNA cotransfection methods refer to example 3;

2) The cell culture solution is removed, 500ul PBS is added into each hole to rinse the cells, and the cells are discarded for 2 times;

3) 350ul of lysate RL is added into each hole, after the cells are blown, the mixture is transferred to a filter column CS, 12000rpm is multiplied by 2min, and the filtrate is collected;

4) Adding 350ul of 70% ethanol into the filtrate, mixing, transferring the mixed solution into an adsorption column CR3, 12000rpm×1min, discarding the waste liquid, and placing the adsorption column into a collecting pipe;

5) Adding 350ul deproteinized solution PW1 in CR3, 12000rpm×1min, discarding the waste liquid, and placing the adsorption column back into the collecting tube;

6) Adding 80ul DNase I into the adsorption column, and standing at room temperature for 15min;

7) Adding 350ul deproteinized solution PW1 in CR3, 12000rpm×1min, discarding the waste liquid, and placing the adsorption column back into the collecting tube;

8) Adding 500ul of rinsing liquid RW into the adsorption column, 12000rpm×1min, discarding the waste liquid, placing the adsorption column into a collecting pipe, and repeating for 2 times;

9) 2000rpm X1 min, and the residual waste liquid was removed. Airing the adsorption column at room temperature for 5min;

10 30ul DEPC water is dripped into the center of the adsorption column, and the adsorption column is placed for 2min at room temperature, 12000rpm is multiplied by 2min;

11 Quantification).

12 Experimental results

As shown in FIG. 5, the SS1+AS1, SS2+AS2, SS3+AS3 and positive groups were compared with the sinc negative control group, respectively, wherein the SS1+AS1 expression level was only 13.3% compared with sinc, the SS2+AS2 expression level was only 46.5% compared with sinc, the SS3+AS3 expression level was only 62.5 compared with sinc, and the positive group expression level was only about 25.0% compared with sinc. The results show that the effects of knocking down the NSp13 gene mRNA are very remarkable in the SS1+AS1, the SS2+AS2 and the SS3+AS 3.

Example 5: serum enzymolysis verification of SS1+AS1

1) Taking a 0.2ml PCR tube, respectively adding 400ng of SS1+AS1 and 0.5ul of fetal bovine serum, supplementing 5ul with DEPC water, and respectively standing at 37 ℃ for N hours, wherein N=72 hours, 48 hours, 24 hours, 6 hours, 4 hours, 2 hours and 0 hour;

2) The procedure for the non-chemically modified ss+as is AS above;

3) Running electrophoresis: adding at least 1ul of 6-loading buffer into the PCR small tube, uniformly mixing, loading sample, 140V and 15min;

4) Photographing;

5) Experimental results

AS shown in fig. 6, when the chemically modified ss1+as1 was in serum for 72 hours, the chemically modified ss1+as1 was still partially undegraded, and showed good enzymatic hydrolysis resistance. Ss+as was fully explained at 24h, with rapid degradation of the ss+as 0h lane during running.

In conclusion, the expression of 2019-nCOV-ommicro-BA.1/BA.2NSp13 genes is inhibited by the SS+AS, the SS1+AS1, the SS2+AS2 and the SS3+AS 3; after the sequence is chemically modified, the anti-enzymolysis capability in serum is obviously improved, and almost no cytotoxicity exists. The three sequences can be used for in vivo and in vitro experiments. The sequence of the invention can be used as an effective target point for developing anti-novel coronavirus medicaments, and provides an effective technical means for resisting 2019-nCOV-ommicro-BA.1/BA.2 viruses.

The above-described embodiments are merely preferred embodiments for fully explaining the present invention, and the scope of the present invention is not limited thereto. Equivalent substitutions and modifications will occur to those skilled in the art based on the present invention, and are intended to be within the scope of the present invention. The protection scope of the invention is subject to the claims.

Claims

1. An siRNA for inhibiting the omucon Nsp13 gene, wherein the sense strand of the siRNA has a sequence of 5'-CCACCACUUAACCGAAAUUAUGU-3' and the antisense strand has a sequence of 5'-AUAAUUUCGGUUAAGUGGUGGUC-3'.

2. The siRNA that inhibits the omucon Nsp13 gene of claim 1, further comprising chemically modifying the sense strand and/or the antisense strand.

3. The siRNA that inhibits the omucon Nsp13 gene of claim 2, wherein the chemical modification comprises one or more of a thio modification, methoxy modification, fluoro modification.

4. The siRNA that inhibits the omnirange Nsp13 gene according to claim 2, wherein the chemical modification is the substitution of the hydroxyl group of ribose C-2' in bases 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 from the 5' end of the sense strand of the siRNA with a fluorine atom, and the methylation of the hydroxyl group of ribose C-2' in bases 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 into methoxypentanose; and methylation of ribose C-2 'hydroxyl groups in 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21 bases from the 5' end of the antisense strand of the siRNA into methoxy pentose.

5. The siRNA that inhibits the omucon Nsp13 gene according to claim 2 wherein the chemical modification is a thio modification of the sense strand of the siRNA from the 5' end to the phosphate at positions 2, 3, 4, 5, 6, 7, 17, 18, 19, 20, 21, the antisense strand not being chemically modified.

6. The siRNA that inhibits the omucon Nsp13 gene of claim 2, wherein the chemical modification is methylation of the hydroxy group of ribose C-2 'in bases 1, 2, 4, 5, 7, 8, 9, 12, 13, 18, 19, 21, 23 of the sense strand of the siRNA from the 5' end to methoxy pentose; the antisense strand of siRNA is methylated into methoxy pentose from the hydroxyl of ribose C-2 'in the 2 nd and 22 nd bases from the 5' end.

7. Use of an siRNA that inhibits the omucotton Nsp13 gene according to any one of claims 1 to 6 for the preparation of a nucleic acid medicament for the treatment of novel coronavirus infections.

8. The use of claim 7, wherein the siRNA is formulated into a medicament by encapsulation with a delivery vehicle.

9. The use according to claim 7, wherein the medicament is administered by nebulization or intravenous injection.