CN104878015A - Bacterial endotoxin aptamer and application thereof - Google Patents
Bacterial endotoxin aptamer and application thereof Download PDFInfo
- Publication number
- CN104878015A CN104878015A CN201510128114.9A CN201510128114A CN104878015A CN 104878015 A CN104878015 A CN 104878015A CN 201510128114 A CN201510128114 A CN 201510128114A CN 104878015 A CN104878015 A CN 104878015A
- Authority
- CN
- China
- Prior art keywords
- aptamer
- bacterial endotoxin
- stranded dna
- centrifuge tube
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a bacterial endotoxin aptamer and its application in removing endotoxin. Nucleotide sequence of the aptamer is as shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3. According to the invention, the bacterial endotoxin aptamer binds to magnetic bead and then specifically binds to endotoxin in a sample to be measured. Thus, endotoxin in the sample to be measured is removed. Through polymyxin B, bacterial endotoxin is fixed to agarose gel particles so as to avoid the influence of coupling to a matrix through a covalence reaction on target conformation by a traditional method. By a PMB-Elisa method, detection is simple and has high sensitivity. In addition, the aptamer obtained by screening is nontoxic, has low molecular weight and good permeability and is easy for synthesis and marking. Through a SELEX method, the aptamer obtained by screening only specifically recognizes bacterial endotoxin but has no function of recognizing other polysaccharides.
Description
(1) technical field
The present invention relates to a kind of nucleic acid, particularly the aptamer of bacterial endotoxin and the application in removal bacterial endotoxin thereof.
(2) background technology
1892 ~ 1895 years, Richard Pfeiffer found, in heat-inactivated vibrio cholerae solute, containing a kind of toxic component, laboratory animal can be caused to suffer a shock and death.In order to distinguish mutually with the thermo-labile extracellular toxin secreted by vibrio cholerae, this heat-staple material is called intracellular toxin by him.
Intracellular toxin main component is lipopolysaccharides (LPS), and its chemical structure is mainly divided into two portions: polysaccharide and lipoid A (Lipid A), wherein lipoid A is endotoxic active centre.In the various thermogenic substance known, intracellular toxin is ubiquity is also most important one.The lipopolysaccharides material produced by cell walls cracking when release or death when it is gram negative bacillus growth, denier (nanogram level) intracellular toxin enters human body will cause high heat, diarrhea, vasodilation, uncomfortable from head to foot, even faint or death.Conventional endotoxin removal method has: charcoal absorption, extraction, ultrafiltration, PXB etc.Ordinary method due to specificity strong, or there is toxicity in itself, is unfavorable for intracellular toxin safety, specific removal.Therefore design a kind of high-affinity and highly selective in conjunction with bacterial endotoxin aglucon will induced by endotoxin control and remove significant.
What aptamer to refer to from the single stranded DNA/RNA library of synthetic that screening obtains can high-affinity and the single stranded oligonucleotide that is combined with target molecule with high specificity.Aptamer forms special three-dimensional structure by hydrogen bond, Van der Waals force, hydrophobic interaction equimolecular intermolecular forces, as hair clip, false knot, bulge loop, the G-tetramer etc., thus identifies target material specifically and affects its biological activity.The distinctive biochemical characteristic of aptamer itself makes it have many advantages in biological medicine Application Areas, and as wide in target molecule scope, avidity and high specificity, synthetic modification fast and easy, good biocompatibility, that it consists of nontoxic Nucleotide, vitro stability is good etc.Aptamer can pass through part index concentration evolution technology (Systematic Evolution of Ligands by ExponentialEnrichment, SELEX) screening obtains, its ultimate principle is that artificial chemistry synthesizes an oligonucleotide library in vitro, comprise RNA and ssDNA of RNA, ssDNA or modification, by the interaction of oligonucleotide library and target molecule, in conjunction with the oligonucleotide of the exponential amplification of round pcr and target molecule specific combination, take turns through several or tens ofly take turns screening process, obtaining the aptamer of high-affinity and high specific.
Because conventional endotoxin removal method specificity is not strong, or there is toxicity in itself, be unfavorable for intracellular toxin safety, specific removal, and aptamer is efficient because itself distinctive biochemical characteristic is conducive to intracellular toxin, specific removal.Namely aptamer-magnetic bead is obtained after being combined bringing the aptamer of vitamin H with the magnetic bead with Streptavidin, endotoxic removal in sample should be can be used for the magnetic bead of aptamer, and be put in by magnetic bead on magnetic frame just can by intracellular toxin and solution separating, the endotoxic method of this removal is simple, fast, specificity is good.
(3) summary of the invention
The object of the invention is to provide a kind of aptamer with the bacterial endotoxin of high specific and high-affinity, and this aptamer is removing the application in bacterial endotoxin, namely aptamer-magnetic bead is obtained after being combined with the magnetic bead with Streptavidin by aptamer, endotoxic removal in sample should be can be used for the magnetic bead of aptamer, and be put in by magnetic bead on magnetic frame just can by intracellular toxin and solution separating, the endotoxic method of this removal is simple, fast, specificity is good.
The technical solution used in the present invention is:
The invention provides a kind of bacterial endotoxin aptamer, the nucleotides sequence of described aptamer is classified as shown in SEQ ID NO.1 (being designated as EAQ1), SEQ ID NO.2 (being designated as EAQ2) or SEQ ID NO.3 (being designated as EAQ3), shown in preferred SEQ ID NO.3.
SEQ ID NO.1：
ATGAGAGCGTCGGTGTGGTACCACGCGCGGACAACAAGACAGCGTGCCTGCAGTGTGTAGGAGGGTGCGGAAGTA；
SEQ ID NO.2：
ATGAGAGCGTCGGTGTGGTATCGCCGCGCTCGCCGATCGTTCCTCCCCCCCCGTGTGTAGGAGGGTGCGGAAGTA；
SEQ ID NO.3：
ATGAGAGCGTCGGTGTGGTAGCCATGCGCCGACCCAGGTCTAAGAGCCTCGGCCGTGTAGGAGGGTGCGGAAGTA。
The preparation method of bacterial endotoxin aptamer of the present invention comprises the following steps:
(1) (usual storage capacity is 10 to synthesize the stochastic sequence that two ends are fixed sequence program, centre is 35 bases
10more than bar) single stranded DNA random oligonucleotide storehouse, the single stranded DNA random oligonucleotide storehouse of synthesis is dissolved in binding buffer liquid 1 and forms 0.05 ~ 0.15 μM of nucleic acid solution, by nucleic acid solution at 90 DEG C of heating 5min, 15min is placed on ice, then room temperature places 5min, obtains pretreated single stranded DNA random oligonucleotide storehouse; Described binding buffer liquid 1 consists of 20mmol/LHePes, 5mmol/L KCl, 120mmol/L NaCl, lmmol/L MgCl
2, l mmol/L CaCl
2, pH7.3;
The sequence in described single stranded DNA random oligonucleotide storehouse is:
5'-ATGAGAGCGTCGGTGTGGTA-35nt-TGTAGGAGGGTGCGGAAGTA-3', nt represent the stochastic sequence of 35 bases; Described elution buffer consists of 20mMTris-HCL, 4M guanidinium isothiocyanate, 1mM DTT, pH8.3;
(2) with the agarose gel particle of bonding PXB for matrix, add intracellular toxin and hatch latter (37 DEG C, 130r/min, vibration 1h), add pretreated single stranded DNA random oligonucleotide storehouse again and hatch (37 DEG C, 130r/min, vibration 1h), removing supernatant liquor (namely removing the single stranded DNA be not combined with intracellular toxin), the single stranded DNA be combined with intracellular toxin is then stayed on sepharose, by the elution buffer wash-out of the single stranded DNA on sepharose, collect effluent liquid, obtain and the nucleotide sequence of bacterial endotoxin specific binding (single stranded DNA), described elution buffer consists of 20mM Tris-HCL, 4M guanidinium isothiocyanate, 1mM DTT, pH8.3,
(3) nucleotide sequence of step (2) gained and bacterial endotoxin specific combination is carried out non-symmetric PCR amplification reaction under the effect of primer 1 and primer 2, again non-symmetric PCR amplification product is carried out asymmetric PCR reaction under the effect of primer 2 and primer 3, the single stranded DNA obtained is through cutting glue, purifying, obtain the single-stranded DNA banks of taking turns screening for this, form time one-level nucleic acid library;
Primer 1:5'-ATGAGAGCGTCGGTGTGGTA-3';
Primer 2: 5'-TACTTCCGCACCCTCCTACA-3';
Primer 3:5'-biotin-ATGAGAGCGTCGGTGTGGTA-3';
(4) by the single-stranded DNA banks of step (3) gained, carry out next round screening by step (2) and step (3), after 10 ~ 20 take turns screening, obtain object oligonucleotide sequence, be bacterial endotoxin aptamer; Described object oligonucleotide sequence is proceeded to escherichia coli cloning by PMD-18T carrier, and check order described object oligonucleotide sequence;
(5) check order in synthetic step (3) single stranded DNA obtained, and identify its avidity be combined with target protein and specificity by PMB-Elisa method, screen the sequence good to bacterial endotoxin specificity, avidity is high, screening bacterial endotoxin aptamer.
The present invention also provides a kind of described bacterial endotoxin aptamer removing the application in intracellular toxin, described application is combined with magnetic bead by bacterial endotoxin aptamer, and then with the intracellular toxin specific binding in sample to be tested, thus the intracellular toxin in removal sample to be tested, be specially: bacterial endotoxin aptamer and the magnetic bead of band Streptavidin are left standstill 25 ~ 70min in 20 ~ 40 DEG C in damping fluid, obtain aptamer-magnetic bead, again this aptamer-magnetic bead and testing sample are hatched 25 ~ 35min in 20 ~ 40 DEG C in damping fluid, get supernatant liquor, obtain and remove endotoxic sample.
More specifically, bacterial endotoxin aptamer of the present invention is removing being applied as in intracellular toxin: added by Streptavidin MagneSphere in centrifuge tube, centrifuge tube is placed on 1 ~ 2min on magnet, sucks supernatant; Take off centrifuge tube binding buffer liquid 2 to wash; Add in centrifuge tube by the mixed solution of bacterial endotoxin aptamer and binding buffer liquid 2, room temperature leaves standstill 30min; Centrifuge tube is put in 1 ~ 2min on magnet, sucks supernatant, wash with binding buffer liquid 1; In centrifuge tube, add binding buffer liquid 1 solution of sample to be tested, hatch 30min for 37 DEG C; Centrifuge tube is put in 1 ~ 2min on magnet, draws supernatant, can obtain removing endotoxic sample solution; Described binding buffer liquid 2 is 10mM, pH 7.5Tris-HCl containing 1mMEDTA+2M NaCl, and binding buffer liquid 1 is for containing 5mmol/LKCl+120mmol/L NaCl+lmmol/L MgCl
2+ l mmol/L CaCl
2pH7.3,20mmol/LHePes.
The present invention screens the aptamer of acquisition for endotoxic removal, comprise the following steps: the primer (i.e. primer 3) of aptamer band vitamin H is carried out asymmetric PCR, obtain the aptamer being with vitamin H, to the aptamer of vitamin H be with and be with the magnetic bead of Streptavidin in damping fluid in 20 ~ 40 DEG C of stationary incubation 25 ~ 70min, obtain aptamer-magnetic bead, this aptamer-magnetic bead is hatched 25 ~ 35min in 20 ~ 40 DEG C with containing endotoxic sample in damping fluid, get supernatant liquor, endotoxin content is detected by tachypleus amebocyte lysate, the intracellular toxin amount of aptamer absorption can be obtained.Changing the concentration of adsorption time and bacterial endotoxin, measuring Static Adsorption curve and adsorption isothermal curve respectively, for verifying the feasibility of this minimizing technology.According to feasibility result, endotoxic for this removal method is used for the intracellular toxin removed in actual sample.
Magnetic bead model in the application of bacterial endotoxin aptamer of the present invention is DynabeadsM-280Streptavidin, be purchased from Invitrogen company, Dynabeads M-280Streptavidin is that Invitrogen Corp. produces, and diameter is the covalently bound magnetic bead having Streptavidin of 2.8 μm.
Because described aptamer has the living features in conjunction with bacterial endotoxin, therefore described bacterial endotoxin aptamer can be used as and removes the aglucon of bacterial endotoxin, preferred nucleic acid is fit EAQ3.
The invention has the advantages that: first, by PXB, bacterial endotoxin is fixed on agarose gel particle, avoids in traditional method and be coupled to the impact on target conformation in matrix by covalent reaction.Secondly, PMB-Elisa method makes detection easy and highly sensitive.And the own nontoxicity of aptamer that screening obtains, molecular weight is little, good penetrability, is easy to synthesis and mark.By the aptamer specific recognition bacterial endotoxin that the screening of SELEX method obtains, not there is recognition function to other polysaccharide.Above-mentioned advantage makes described aptamer become in conjunction with bacterial endotoxin specific ligand, bacterial endotoxin in alternative removal sample.
(4) accompanying drawing explanation
Fig. 1 is the experiment flow figure of this experiment.
Fig. 2 is that aptamer EAQ3 adsorbs dynamic curve.
Fig. 3 is aptamer EAQ3 adsorption isothermal line.
(5) embodiment
Below in conjunction with specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in this:
The aptamer of embodiment 1 in-vitro screening and bacterial endotoxin specific combination
The aptamer of in-vitro screening and bacterial endotoxin specific combination carries out according to the following steps:
1, external synthesizing single-stranded DNA random oligonucleotide storehouse, the two ends in single stranded DNA random oligonucleotide storehouse are fixed sequence program, centre is the stochastic sequence of 35 bases, is 5'-ATGAGAGCGTCGGTGTGGTA-35nt-TGTAGGAGGGTGCGGAAGTA-3', and storage capacity is 10
10more than bar, this trust Shanghai, library Sheng Gong biotechnology limited-liability company synthesizes.The single stranded DNA nucleic acid storehouse of synthesis is dissolved in binding buffer liquid 1 (20mmol/L HePes, 5mmol/L KCl, 120mmol/L NaCl, lmmol/L MgCl
2, l mmol/L CaCl
2, pH7.3), obtain 0.1 μM of nucleic acid solution, solution is heat-treated: 90 DEG C of heating 5min, place 15min on ice, then room temperature places 5min, obtains pretreated single stranded DNA nucleic acid storehouse.
2, intracellular toxin and PXB-agarose gel particle is carried out hatching that (incubation conditions is: 37 DEG C, 130r/min vibrates 1h), by pretreated single stranded DNA nucleic acid storehouse with combine endotoxic PXB-agarose gel particle and carry out hatching that (incubation conditions is: 37 DEG C, 130r/min vibrates 1h), after removing supernatant liquor, with elution buffer, (elution buffer consists of 20mMTris-HCL, 4M isothiocyanic acid flesh, 1mM DTT, pH8.3) wash the single stranded DNA of lower combination.
3, under the effect of primer 1 and primer 2, carry out non-symmetric PCR amplification by after the single stranded DNA purifying under wash-out, PCR response procedures is: 94 DEG C of denaturation 3min, 94 DEG C of 30s; 60 DEG C of 30s; 72 DEG C of 30s, 24 circulations of increasing, last 72 DEG C extend 10min.
Wherein, primer 1:5'-ATGAGAGCGTCGGTGTGGTA-3'; Primer 2: 5'-TACTTCCGCACCCTCCTACA-3'.
Asymmetric PCR prepares single stranded oligonucleotide storehouse, and with step 3 amplified production for template, under the effect of primer 2 and primer 3, carry out asymmetric PCR reaction, wherein the concentration ratio of primer 2 and primer 3 is 1:100, and other condition is the same with PCR condition in step 3.By the single stranded DNA electrophoresis obtained, cut glue after with oligonucleotide Purification Kit namely obtain for next round screening single-stranded DNA banks.
Primer 2: 5'-TACTTCCGCACCCTCCTACA-3';
Primer 3:5'-biotin-ATGAGAGCGTCGGTGTGGTA-3';
4, often wheel gradually reduces the amount of single-stranded DNA banks afterwards, carry out 15 altogether and take turns screening, wherein sieve every three-wheel is once counter, namely do not add bacterial endotoxin, carry out single stranded DNA nucleic acid storehouse and PXB-agarose gel particle hatching that (incubation conditions is: 37 DEG C, 130r/min, vibration 1h), other step is constant, to remove the single stranded DNA be combined with PXB-agarose gel particle, improves screening efficiency.
The single stranded DNA cloning and sequencing screened is taken turns by the 15th.Obtain 26 biotin labeled sequences after order-checking, wherein have 3 sequences to repeat, respectively called after:
EAQ1：
5'-ATGAGAGCGTCGGTGTGGTACCACGCGCGGACAACAAGACAGCGTGCCTGCAGTGTGTAGGAGGGTGCGGAAGTA-3'
EAQ2：
5'-ATGAGAGCGTCGGTGTGGTATCGCCGCGCTCGCCGATCGTTCCTCCCCCCCCGTGTGTAGGAGGGTGCGGAAGTA-3'
EAQ3：
5'-ATGAGAGCGTCGGTGTGGTAGCCATGCGCCGACCCAGGTCTAAGAGCCTCGGCCGTGTAGGAGGGTGCGGAAGTA-3'
Wherein repetition rate is respectively 15.4%, and 11.5%, 7.7%.These 3 sequences are used for the mensuration of specificity and affinity.
Embodiment 2 measures the affinity of gained single stranded DNA and bacterial endotoxin with PMB-Elisa method
Screen with embodiment 1 the biotin labeled EAQ1 sequence, EAQ2 sequence and the EAQ3 sequence that obtain to test.
In 96 orifice plates, add PXB (PMB) the 100 μ L being diluted to 10 μ g/mL with coating buffer (0.05M carbonate buffer solution, pH9.6), 4 DEG C are spent the night; Remove coating buffer and wash plate 3 times, each 5min; Add confining liquid (1%BSA) 37 DEG C of closed 1h; Add the bacterial endotoxin of 100 μ L, 10 μ g/mL after washing, hatch 1h for 37 DEG C; Add with binding buffer liquid 1 (20mmol/LHePes, 5mmol/L KCl, 120mmol/L NaCl, lmmol/L MgCl
2, l mmol/L CaCl
2, pH7.3) and be diluted to the single stranded DNA (i.e. EAQ1 sequence, EAQ2 sequence and EAQ3 sequence) of 0.1 μM, hatch 1h for 37 DEG C; Pat dry liquid in hole, add 200 μ L dcq buffer liquid (20mmol/LHePes, 5mmol/L KCl, 120mmol/L NaCl, lmmol/L MgCl
2, l mmol/L CaCl
2, 0.05% polysorbas20, pH 7.3) rinse 3 times, wash 5min at every turn; Add Streptavidin (1:5000) the 100 μ L of horseradish peroxidase-labeled, hatch 1h for 37 DEG C, rinse 3 times with dcq buffer liquid; Develop the color with Elisa TMB colouring reagents box; Microplate reader measures 450nm place light absorption value, and wherein EAQ1 is 0.319, EAQ3 be 0.367, EAQ3 is 0.695.OD value is higher, illustrates that the single stranded DNA amount be combined with intracellular toxin is higher, and result shows that these three sequence pair intracellular toxins have affinity, wherein best with the affinity of EAQ3 induced by endotoxin, illustrates that EAQ3 can be used as the aglucon of endotoxin removal.
Embodiment 3 measures the specificity of gained single stranded DNA and bacterial endotoxin with PMB-Elisa method.
Utilize embodiment 2 method, replacing bacterial endotoxin to carry out avidity mensuration with bovine serum albumin and ovalbumin, can determine whether aptamer has specificity to bacterial endotoxin by contrasting OD value with bacterial endotoxin.
Result shows: 3 aptamers all can not be combined with BSA, OVA, and 3 aptamers screened have specificity affinity interaction to bacterial endotoxin.
The mensuration of embodiment 4 aptamer EAQ3 and Endotoxin adsorption kinetic curve
Curve of adsorption kinetics is the time dependent curve of research loading capacity, and concrete measuring method is as follows: by intracellular toxin binding buffer liquid 1 (20mmol/L HePes, 5mmol/L KCl, 120mmol/LNaCl, lmmol/L MgCl
2, l mmol/L CaCl
2, pH7.3) and be made into the endotoxin solution of 0.5EU/mL, take out in Streptavidin MagneSphere (model DynabeadsM-280Streptavidin is purchased from Invitrogen Corp.) 50 μ L to 1.5mL centrifuge tube; Centrifuge tube is placed on 1 ~ 2min on magnet, magnetic bead all accumulates in the centrifuge tube inwall near magnetic field under the action of a magnetic field, and liquid in pipe becomes clarification; Centrifuge tube is placed on magnet motionless, with pipettor by clear liquid removing in centrifuge tube; Take off centrifuge tube binding buffer liquid 2 (10mM Tris-HCl pH 7.5,1mM EDTA, 2M NaCl) and wash 3 times; Joined by EAQ3 in binding buffer liquid 2, mix with magnetic bead, room temperature leaves standstill 30min; Centrifuge tube is put in 1 ~ 2min on magnet, sucks supernatant, wash 3 times with binding buffer liquid 2; Add the endotoxin solution being diluted to 0.5EU/mL with binding buffer liquid 1, hatch, respectively at 10min, 20min for 37 DEG C, 30min, 40min, 50min Aspirate supernatant 20 μ L, measures endotoxic content in supernatant liquor by tachypleus amebocyte lysate, according to the adsorptive capacity of its different time of change calculations of endotoxin content, with loading capacity, adsorption time is mapped, can obtain adsorbing dynamic curve, shown in Fig. 2.Result shows that the loading capacity of aptamer EAQ3 induced by endotoxin just reaches maximum value in 10min, loading capacity is approximately 1199EU/g, the removal efficiency of induced by endotoxin can reach more than 98.3%, illustrates that the rate of adsorption of aptamer EAQ3 induced by endotoxin is fast, excellent adsorption.
Embodiment 5 aptamer EAQ3 and the isothermal mensuration of Endotoxin adsorption
By intracellular toxin binding buffer liquid 1 (20mmol/L HePes, 5mmol/L KCl, 120mmol/LNaCl, lmmol/L MgCl
2, l mmol/L CaCl
2, pH7.3) and be made into the solution of different concns, be respectively 0.05EU/mL, 0.1EU/mL, 0.2EU/mL, 0.4EU/mL, 0.8EU/mL, 1.6EU/mL, take out in Streptavidin MagneSphere 50 μ L to 1.5mL centrifuge tube; Centrifuge tube is placed on 1 ~ 2min on magnet, magnetic bead all accumulates in the centrifuge tube inwall near magnetic field under the action of a magnetic field, and liquid in pipe becomes clarification; Centrifuge tube is placed on magnet motionless, with pipettor by clear liquid removing in centrifuge tube; Take off centrifuge tube binding buffer liquid 2 (10mM Tris-HCl pH 7.5,1mMEDTA 2M NaCl) and wash 3 times; Joined by EAQ3 in binding buffer liquid 2, mix with magnetic bead, room temperature leaves standstill 30min; Centrifuge tube is put in 1 ~ 2min on magnet, sucks supernatant, wash 3 times with binding buffer liquid 1; Add the endotoxin solution being diluted to different concns with binding buffer liquid 1, measure loading capacity during adsorption equilibrium respectively.Calculation formula:
c in formula
0endotoxic content (EU/L) in the solution of absorption front and back is respectively with Ce; V is liquor capacity (mL), W is aptamer EAQ3 quality (g).To loading capacity Qe mapping, adsorption isothermal line is obtained, shown in Fig. 3 to adsorb endotoxic content Ce in rear solution.Result shows, along with the raising of endotoxin concns, the loading capacity of aptamer EAQ3 to bacterial endotoxin also raises, and when bacterial endotoxin concentration reaches 0.4EU/mL value, it is 2500EU/g that the loading capacity of aptamer EAQ3 to bacterial endotoxin reaches this value of stationary value.
Embodiment 6 aptamer removes the bacterial endotoxin in sample solution
Take out in Streptavidin MagneSphere 50 μ L to 1.5mL centrifuge tube; Centrifuge tube is placed on 1 ~ 2min on magnet, magnetic bead all accumulates in the centrifuge tube inwall near magnetic field under the action of a magnetic field, and liquid in pipe becomes clarification; Centrifuge tube is placed on magnet motionless, with pipettor by clear liquid removing in centrifuge tube; Take off centrifuge tube binding buffer liquid 2 (10mM Tris-HCl pH 7.5,1mM EDTA 2MNaCl) and wash 3 times; Joined by EAQ3 in binding buffer liquid 2, mix with magnetic bead, room temperature leaves standstill 30min; Centrifuge tube is put in 1 ~ 2min on magnet, sucks supernatant, with binding buffer liquid 1 (20mmol/L HePes, 5mmol/L KCl, 120mmol/L NaCl, lmmol/L MgCl
2, lmmol/L CaCl
2, pH7.3) and wash 3 times; Add the sample solution (intracellular toxin final concentration is 0.5EU/mL) diluted with binding buffer liquid 1, hatch 30min for 37 DEG C; Centrifuge tube is put in 1 ~ 2min on magnet, draw supernatant and can obtain removing endotoxic sample solution, removal efficiency can reach 98.3%.
The invention is not restricted to these disclosed embodiments, the scope that the present invention will cover described in patent book, and the various modification of right changes with equivalence.
Claims (8)
1. a bacterial endotoxin aptamer, is characterized in that the nucleotides sequence of described aptamer is classified as shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3.
2. bacterial endotoxin aptamer as claimed in claim 1, is characterized in that the nucleotides sequence of described aptamer is classified as shown in SEQ ID NO.3.
3. the preparation method of bacterial endotoxin aptamer described in a claim 1, it is characterized in that described method is: the single stranded DNA random oligonucleotide storehouse that (1) synthesis two ends are fixed sequence program, centre is the stochastic sequence of 35 bases, the single stranded DNA random oligonucleotide storehouse of synthesis is dissolved in binding buffer liquid 1 and forms 0.05 ~ 0.15 μM of nucleic acid solution, by nucleic acid solution at 90 DEG C of heating 5min, 15min is placed on ice, then room temperature places 5min, obtains pretreated single stranded DNA random oligonucleotide storehouse; Described binding buffer liquid 1 consists of 20mmol/L HePes, 5mmol/L KCl, 120mmol/L NaCl, lmmol/L MgCl
2, l mmol/L CaCl
2, pH7.3;
The sequence in described single stranded DNA random oligonucleotide storehouse is:
5'-ATGAGAGCGTCGGTGTGGTA-35nt-TGTAGGAGGGTGCGGAAGTA-3', nt represent the stochastic sequence of 35 bases;
(2) with the agarose gel particle of bonding PXB for matrix, add after intracellular toxin hatches, then add pretreated DNA random oligonucleotide storehouse and hatch, removing supernatant liquor, with elution buffer washing, collect effluent liquid, obtain the single stranded DNA with bacterial endotoxin specific combination; Described elution buffer consists of 20mM Tris-HCL, 4M guanidinium isothiocyanate, 1mM DTT, pH8.3;
(3) single stranded DNA of step (2) gained and bacterial endotoxin specific combination is carried out non-symmetric PCR amplification reaction under the effect of primer 1 and primer 2, again non-symmetric PCR amplification product is carried out asymmetric PCR reaction under the effect of primer 2 and primer 3, the single stranded DNA obtained is through cutting glue, purifying, obtain the single-stranded DNA banks of taking turns screening for this, form time one-level nucleic acid library;
Primer 1:5'-ATGAGAGCGTCGGTGTGGTA-3';
Primer 2: 5'-TACTTCCGCACCCTCCTACA-3';
Primer 3:5'-biotin-ATGAGAGCGTCGGTGTGGTA-3';
(4) by the single-stranded DNA banks of step (3) gained, carry out next round screening by step (2) and step (3), after 10 ~ 20 take turns screening, obtain object oligonucleotide sequence, be bacterial endotoxin aptamer.
4. bacterial endotoxin aptamer described in a claim 1 is removing the application in intracellular toxin.
5. apply as claimed in claim 4, it is characterized in that described application is combined with magnetic bead by bacterial endotoxin aptamer, and then with the intracellular toxin specific binding in sample to be tested, thus remove the intracellular toxin in sample to be tested.
6. apply as claimed in claim 5, it is characterized in that described being applied as: bacterial endotoxin aptamer and the magnetic bead of band Streptavidin are hatched 25 ~ 70min in 20 ~ 40 DEG C in damping fluid, obtain aptamer-magnetic bead, again this aptamer-magnetic bead and testing sample are hatched 25 ~ 35min in 20 ~ 40 DEG C in damping fluid, get supernatant liquor, obtain and remove endotoxic sample.
7. apply as claimed in claim 6, it is characterized in that described being applied as: Streptavidin MagneSphere is added in centrifuge tube, centrifuge tube is placed on 1 ~ 2min on magnet, sucks supernatant; Take off centrifuge tube binding buffer liquid 2 to wash; Add in centrifuge tube by the mixed solution of bacterial endotoxin aptamer and binding buffer liquid 2, room temperature leaves standstill 30min; Centrifuge tube is put in 1 ~ 2min on magnet, sucks supernatant, wash with binding buffer liquid 1; In centrifuge tube, add binding buffer liquid 1 solution of sample to be tested, hatch 30min for 37 DEG C; Centrifuge tube is put in 1 ~ 2min on magnet, draws supernatant, can obtain removing endotoxic sample solution; Described binding buffer liquid 2 is 10mM, pH7.5Tris-HCl containing 1mM EDTA+2M NaCl, and binding buffer liquid 1 is for containing 5mmol/L KCl+120mmol/L NaCl+lmmol/LMgCl
2+ l mmol/L CaCl
2pH7.3,20mmol/L HePes.
8. the application as described in one of claim 4-7, is characterized in that Streptavidin MagneSphere is Dynabeads M-280 Streptavidin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510128114.9A CN104878015B (en) | 2015-03-23 | 2015-03-23 | A kind of bacterial endotoxin aptamer and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510128114.9A CN104878015B (en) | 2015-03-23 | 2015-03-23 | A kind of bacterial endotoxin aptamer and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104878015A true CN104878015A (en) | 2015-09-02 |
| CN104878015B CN104878015B (en) | 2018-02-13 |
Family
ID=53945691
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510128114.9A Active CN104878015B (en) | 2015-03-23 | 2015-03-23 | A kind of bacterial endotoxin aptamer and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104878015B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108982623A (en) * | 2018-05-23 | 2018-12-11 | 浙江工业大学 | A kind of aptamer biosensor and its preparation and application |
| CN108982605A (en) * | 2018-08-10 | 2018-12-11 | 山东大学 | A kind of endotoxin aptamer sensor and its endotoxic method of detection based on copper-rich ionic material label |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445798A (en) * | 2008-12-05 | 2009-06-03 | 中国人民解放军第三军医大学 | Small molecule DNA adaptorprotein for restraining activity of endotoxin and preparation method thereof |
-
2015
- 2015-03-23 CN CN201510128114.9A patent/CN104878015B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445798A (en) * | 2008-12-05 | 2009-06-03 | 中国人民解放军第三军医大学 | Small molecule DNA adaptorprotein for restraining activity of endotoxin and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| 左明艳: "基于SELEX技术筛选前白蛋白的_省略_适配体传感器检测细菌内毒素的应用", 《中国优秀硕士学位论文全文数据库 信息科技辑》 * |
| 杨清武等: "SELEX 筛选LPS 寡核苷酸适配子方法的建立", 《重庆医学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108982623A (en) * | 2018-05-23 | 2018-12-11 | 浙江工业大学 | A kind of aptamer biosensor and its preparation and application |
| CN108982605A (en) * | 2018-08-10 | 2018-12-11 | 山东大学 | A kind of endotoxin aptamer sensor and its endotoxic method of detection based on copper-rich ionic material label |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104878015B (en) | 2018-02-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2617226T3 (en) | Multiplexed trials based on aptamers | |
| CN113061610B (en) | Aptamer binding to novel coronavirus (SARS-CoV-2) spinous process protein S1 subunit and use thereof | |
| AU2011350672B2 (en) | Method for immobilising nucleic ligands | |
| KR101460450B1 (en) | DNA aptamer specifically binding to cadmium and uses thereof | |
| Tombelli et al. | Aptamers biosensors for pharmaceutical compounds | |
| CN106399317B (en) | Method for screening and characterizing single-stranded DNA aptamer of phthalate plasticizer | |
| CN107164383B (en) | Creatine kinase isoenzyme nucleic acid aptamer and application thereof | |
| US20170233723A1 (en) | Method For Affinity Purification | |
| KR101263450B1 (en) | DNA aptamer binding to kanamycin with specificity | |
| CN104480114B (en) | The method of high performance liquid chromatography screening aptamer and aptamer and application | |
| CN104878015A (en) | Bacterial endotoxin aptamer and application thereof | |
| JP6384929B2 (en) | Target analysis tool and target analysis method | |
| CN102732523A (en) | Aptamer for identifying zeatin through specifity, and screening method and application of aptamer | |
| JP5835778B2 (en) | PSA-binding aptamer and PSA detection kit | |
| US8283457B2 (en) | Nucleic acid molecule capable of binding to rabbit-derived IgG antibody | |
| KR102196281B1 (en) | DNA aptamer binding to edifenphos with specificity and Uses thereof | |
| KR100930974B1 (en) | DNA aptamer binding to Retinol Binding Protein 4 with specificity and production method thereof | |
| CN105483133A (en) | Staphylococcus aureus toxic shock syndrome toxin-1(TSST-1) aptamer T-7 and preparation method and application thereof | |
| CN108486119B (en) | Aptamer RhB-F02 specifically bound with rhodamine B and application thereof | |
| KR101801227B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to Follistatin and Uses Thereof | |
| KR102067476B1 (en) | DNA aptamer binding to tebuconazole, Inabenfide and Iprobenfos with specificity and Uses thereof | |
| WO2014166558A1 (en) | Dna aptamers to diagnose mycobacterium tuberculosis bacteria and treat tuberculosis disease, specific for m. tuberculosis bacteria | |
| CN102618546B (en) | Aptamers capable of identifying compound containing p-nitrobenzene sulfonamide and applications of aptamers | |
| Lin et al. | Zeolitic Imidazolate Framework-8 Grown on Nanoporous SiO2 with Aptamer Functionalization for Selective Isolation of Thrombin | |
| KR101990103B1 (en) | DNA aptamer binding to progesterone with specificity and Uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |