CN104845994B - A kind of expression and its application that activated gene in situ is realized using genome editing technique - Google Patents
A kind of expression and its application that activated gene in situ is realized using genome editing technique Download PDFInfo
- Publication number
- CN104845994B CN104845994B CN201410051873.5A CN201410051873A CN104845994B CN 104845994 B CN104845994 B CN 104845994B CN 201410051873 A CN201410051873 A CN 201410051873A CN 104845994 B CN104845994 B CN 104845994B
- Authority
- CN
- China
- Prior art keywords
- gene
- expression
- situ
- plasmids
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a kind of expression and its applications that activated gene in situ is realized using genome editing technique.The present invention is by homologous recombination technique, after the target gene promoters of receptor, before the gene order of target gene, is inserted into second promoter and riddled basins, and is screened by selection markers and obtain positive findings, so as to fulfill the expression of activated gene in situ.The expression of the present invention can be used for the overexpression of activated gene in situ, so as to the functional study field applied to gene.
Description
Technical field
The present invention relates to gene transcription regulation research fields, and in particular to a kind of to realize original position using genome editing technique
The expression of activated gene and its application.
Background technology
The expression regulation of gene is regulated and controled be subject to many levels, including transcriptional level and post-transcriptional level, for encoding base
Because of regulation and control horizontal after further including translation skill and translating etc..
Different genes is also subject to various forms of regulation and control when expression.Pass through function often in research gene function
Deletion experiments（loss of function）It is tested with gain-of-function（gain of function）Two ways is realized to base
Because of the research of function.Wherein afunction, which tests common mode, RNA perturbation techniques（RNAi Interference, RNAi）
Etc. technologies realize the downward to target gene expression, and gain-of-function tests common mode using expression vector expressing gene
CDNA sequence realizes the overexpression of gene outcome.
Expression vector be it is a kind of can in prokaryotes and eukaryotic cells one kind of external source expressing protein or RNA
Circular double-stranded DNA molecule is widely used in studying the effects of the large biological molecules in cell activities such as albumen, RNA.It presses
The host's difference correlated can be divided into prokaryotic expression carrier and carrier for expression of eukaryon.Common prokaryotic expression carrier have pET series,
PQE systems, pGEX series, pMAL series etc. are a variety of.And carrier for expression of eukaryon then divides Yeast expression according to applicable species difference
Carrier, plant expression vector and eucaryon mammalian vector etc. are a variety of.
In current research, the cDNA sequence of gene is usually cloned into expression vector and is overexpressed by researcher,
Realize that function is overexpressed.Such mode has been used for external source and is overexpressed protein coding gene gene and heterogenous expression microRNA etc..
Although such mode has evolved into ripe, many problems are frequently encountered in actual mechanical process, Ying Ji that such as cannot be anti-endogenous
Because expressing environment, expression product can not achieve normal positioning etc..Particularly there is the non-volume RNA of customs director in recent years（long
NoncodingRNA, lncRNA）Research that people is allowed to be further appreciated that existing for this expression way is insufficient.
Long non-coding RNA（Long noncoding RNAs, lncRNAs）It is that one kind is present in cell, length is more than
The RNA molecule of the protein of 200nt and non-coding protein product or coding without function.Existing research has been sent out
Polytype lncRNAs is showed, and lncRNAs can be a variety of by participating in chromatin remodeling, chromatin higher order structure maintenance etc.
Mode participates in gene expression regulation, while may also participate in formation of subnucleus structure etc. in nucleus.
It is found that when carrying out the overexpression of lncRNAs with traditional expression vector, the RNA of overexpression tends not to realize
Correct Subcellular Localization.When this is likely due to be overexpressed cDNA sequence, the RNA of overexpression is needed not move through similar to endogenous
The RNA processing of gene（RNA processing）Process, such as montage（splicing）；Express simultaneously ripe lncRNA also with outside
The protein of source expression is different, may not have special positioning signal of intracellular different position etc. on molecule.Therefore,
A kind of mode of similar endogenous expression is realized to the overexpression of target gene for studying the function of lncRNA with highly important
Effect.
CCAT1-L is the long non-coding RNA of a high expression in colon cancer.Hybridization in situ experiment the results show CCAT1-
L is distributed in nucleus, in spot distribution（Such as scheme Fig1A）, and be gathered near its transcription site（Such as scheme Fig1B）.Function
It obtains experiment and has a very important role for studying the biological function of CCAT1-L.However, cross table using traditional carrier
Experimental result up to lncRNAs shows that the CCAT1-L being overexpressed using foreign vector is distributed in entire cell, i.e., in cell
It is all distributed in core and cytoplasm（Such as scheme Fig1C）.This illustrates that the CCAT1-L that traditional approach is overexpressed can not simulate endogenous RNA
Positioning scenarios, i.e., can not correctly play the biological function of the RNA.Being overexpressed CCAT1-L using such mode may cause
Obtain incorrect or even wrong experimental result.Therefore, a kind of experimental method that can be overexpressed with the endogenous CCAT1-L of analog cell
Have great importance for studying its function.
The content of the invention
The defects of it is an object of the invention to overcome the prior art, provides a kind of in situ using the realization of genome editing technique
The expression system of activated gene and its application realize activation long non-coding RNA base in situ especially with genome editing technique
The expression of cause and its application.
The present invention discloses a kind of expression of activation long non-coding RNA gene in situ first, is：Pass through homologous recombination
Technology after the target gene promoters of receptor, before the gene order of target gene, is inserted into second promoter and screening mark
Remember gene, and screened by selection markers and obtain positive findings.
It is non-with the activation length in situ can to cultivate the positive cell for the positive cell that the positive findings obtains for screening
The expression of coding RNA gene.
The expression of the activation long non-coding RNA gene in situ, refer to activation long non-coding RNA gene expression with it is interior
The expression and localization of source long non-coding RNA gene is consistent, can further simulate the function of endogenous long non-coding RNA.
The target gene is long non-coding RNA gene to be activated, specifically, such as CCAT1-L.
It further expands, the long non-coding RNA gene or encoding gene, target gene are volume to be activated
Code gene.
Specifically, the expression of the activation long non-coding RNA gene in situ of the present invention comprises the following steps：
1）Build specific recognition target sequence TALEN plasmids；
2）It designs and builds Donor plasmids, include the second of sequential series between the left and right homology arm of the Donor plasmids
Promoter and riddled basins；
3）By step 1）With 2）The TALEN plasmids and Donor plasmids of structure are transferred to recipient cell, by homologous recombination to by
Body cell carries out genome manipulation, cultivates recipient cell and screens acquisition positive findings according to selection markers and verify.
Step 1）In, the targeted target site of the TALEN plasmids is located at the promoter of target gene and its gene originates sequence
Between row.The TALEN plasmids should not destroy the promoter and its gene of acceptor gene group target gene.
Step 2）In, the corresponding homologous recombination target sequence of the Donor plasmids is located at the promoter and its gene of target gene
Between homing sequence.After the Donor plasmids can guarantee homologous recombination, promoter, riddled basins and the target gene of insertion
Frame is correct.
Second promoter may be selected from CMV promoter, EF1alpha promoters etc..The riddled basins can be
Resistant gene and fluorescent protein marker gene.The resistant gene such as puromycin（Puro）Resistant gene or
blasticidin（Blasticidin）Resistant gene etc..The fluorescent protein marker gene such as EGFP, YFP fluorescent protein labeling base
Because etc..
Further, between the left and right homology arm of the Donor plasmids, after riddled basins, also it has been sequentially inserted into
Terminator sequence and inducible promoter.The design can be achieved target gene and be overexpressed with can induce.
Specifically, the terminator sequence can be two kinds of terminator sequences of BGH and SV40.The design can terminate the second startup completely
The transcription of son driving.The inducible promoter can be Ptight promoters.
When being inserted into inducible promoters, the positive cell can be cultivated and induce the table of the long non-coding RNA gene
It reaches.
As the specific embodiment of the invention is enumerated, including sequential series between the left and right homology arm of the Donor plasmids
CMV promoter, puromycin resistant genes and EGFP fluorescent protein marker genes.
It is further preferred that between the puromycin resistant genes and EGFP fluorescent protein marker genes also inserted with
T2A sequences.
Further to realize the derivable overexpression of target gene, between the left and right homology arm, EGFP fluorescent protein labelings
Two kinds of terminator sequences of BGH and SV40 and Ptight promoters have also been sequentially inserted into after gene.
Step 3）In, it is miscellaneous that can qPCR, Northernblot, RNA fluorescent in situ be selected to the verification method of positive findings
Hand over experiment and the double fluorescence in situ hybridization experiments of RNA/DNA.
The expression of activation long non-coding RNA gene in situ of the present invention can also be used as a kind of overexpression length non-
Coding RNA gene is properly positioned situation, to study the experimental method of RNA functions with simulate endogenous RNA.
Expression of the present invention can be used for the overexpression of activation long non-coding RNA gene in situ, so as to be applied to
The functional study field of LncRNA.The overexpression of the long non-coding RNA gene can realize correct Subcellular Localization.
The similary amplifiable overexpression for being applied to activated code gene in situ of expression of the present invention, so as to apply
In the functional study field of encoding gene.
Beneficial effects of the present invention：The present invention realizes the activation in situ of target gene for the first time in the world, includes to be overexpressed
Gene including long non-coding RNA provides new method and thinking with its function is studied.
Description of the drawings
Figure 1A:Wild type rna fluorescence in situ hybridization result
Figure 1B：The double fluorescence in situ hybridization results of wild-type endogenous CCAT1-L RNA/DNA
Fig. 1 C:Traditional plasmid is overexpressed CCAT1-L in situ hybridization results
Fig. 2A:The Donor plasmid construct schematic diagrames that embodiment 1 is built
Fig. 2 B：1 genome editor's PCR verification results of embodiment
Fig. 2 C：Embodiment 1 is overexpressed RNA RT-qPCR verification results.WT represents wild type, and 1-4 represents each saltant type.
Fig. 2 D：Embodiment 1Northernblot checking test results
Fig. 2 E:Embodiment 1RNA fluorescence in situ hybridization is tested（RNA FISH）Verification result
Fig. 2 F:The double fluorescence in situ hybridization experiments of embodiment 1RNA/DNA（RNA/DNA double FISH）Verification result
Fig. 3 A:The Donor plasmid construct schematic diagrames that embodiment 2 is built
Fig. 3 B：2 genome editor's PCR verification results of embodiment
Fig. 3 C：Embodiment 2 is overexpressed RNA RT-qPCR verification results.WT represents wild type, and 1-4 represents each saltant type.
Specific embodiment
The expression of the activation long non-coding RNA gene in situ of the present invention, mainly by homologous recombination technique, in receptor
Target gene promoters after, before the gene order of target gene, be inserted into second promoter and riddled basins, so as to
Realize the overexpression in situ of long non-coding RNA gene.
The present invention specifically by taking long non-coding RNA CCAT1-L as an example, using the expression, realizes CCAT1-L
Overexpression in situ in colon cancer cell.
Specifically, test method comprises the following steps：
1）Build TALEN plasmids.
The targeted target site of the TALEN plasmids is located at the promoter and its base of long non-coding RNA gene to be activated
Because between homing sequence.
Specifically, left and right TALEN plasmids identification sequence be respectively TCATCATTACCAGCTGCCGT and
ACGCTCACGATTCACAGAAA。
2）It designs and builds Donor plasmids, include the second of sequential series between the left and right homology arm of the Donor plasmids
It opens
Mover and riddled basins.
The riddled basins can be resistant gene and fluorescent protein marker gene.The resistant gene is such as
puromycin（Puro）Resistant gene or blasticidin（Blasticidin）Resistant gene etc..The fluorescin mark
Remember gene such as EGFP, YFP fluorescent protein marker gene etc..
Include order as one embodiment of the invention is specifically enumerated, between the left and right homology arm of the Donor plasmids to go here and there
CMV promoter, puromycin resistant genes and the EGFP fluorescent protein marker genes of connection.
It is further preferred that between the puromycin resistant genes and EGFP fluorescent protein marker genes also inserted with
T2A sequences.
Specifically, the sequence of the Donor plasmids such as SEQ ID NO:Shown in 29.
Include order as another specific embodiment of the present invention is enumerated, between the left and right homology arm of the Donor plasmids to go here and there
CMV promoter, puromycin resistant genes and EGFP fluorescent protein marker genes, BGH terminator sequences, the SV40 of connection terminate sequence
Row and Ptight promoters.
More preferably, also inserted with T2A sequences between the puromycin resistant genes and EGFP fluorescent protein marker genes
Row.
Specifically, the sequence of the Donor plasmids such as SEQ ID NO:Shown in 30.
3）By step 1）With 2）The TALEN plasmids and Donor plasmids of structure are transferred to recipient cell, by homologous recombination to by
Body cell carries out genome manipulation, cultivates recipient cell, and screening obtains positive findings and verifies.
Specifically, embodiment employs colon cancer cell as recipient cell.
In the case of inducible promoters are inserted into, it is necessary to induced expression when carrying out being overexpressed verification.Specifically, for
Ptight promoters, using inducible system（Tet-On systems, Tet-Off systems）Expression regulation is carried out to target gene.
Present invention specific implementation employs the transformation that qPCR, Northernblot demonstrate genome, former using RNA fluorescence
Position hybrid experiment and the double fluorescence in situ hybridization experimental verifications of RNA/DNA overexpression in situ.
Positive cell is obtained using the above method, CCAT1-L, the CCAT1-L of the overexpression are overexpressed available in situ
It can be correctly located against on nucleus.So as to be used for the functional study to CCAT1-L.The long non-coding RNA gene
Before the specific embodiment of the invention is further described, it should be appreciated that protection scope of the present invention is not limited to down
State specific specific embodiment；It is also understood that the term used in the embodiment of the present invention is specific specific in order to describe
Embodiment, the protection domain being not intended to be limiting of the invention.
Unless otherwise stated, disclosed in this invention experimental method, detection method, preparation method using this technology lead
Molecular biology, biochemistry, chromatin Structure and the analysis of domain routine, analytical chemistry, cell culture, recombinant DNA technology and
The routine techniques of association area, these technologies existing perfect explanation in the prior art.
The acquisition and identification of embodiment 1CCAT1 overexpressing cells system
1. experiment material
1）Reagent
Primer synthesis wins still biological Co., Ltd from Shanghai；EcoR I and Not I is purchased from NEB companies；PLKO.1L comes from
Addgene websites；TALEN assembling kits are purchased from Shanghai Si Dansai Bioisystech Co., Ltd.
2）Cell line and carrier
Colon cancer cell HCT116 cultures are adding 10% hyclone（Gbico）, 1 ‰ dual anti-DMEM culture mediums
（Gibco）Middle adhere-wall culture.
2. experimental method
The structure of 2.1TALEN plasmids
The structure of TALEN plasmids assembles kit according to TALEN（Purchased from Shanghai Si Dansai Bioisystech Co., Ltd）It says
Bright book carries out, left and right TALEN plasmids identification sequence be respectively TCATCATTACCAGCTGCCGT and
ACGCTCACGATTCACAGAAA.Gained TALEN plasmids carry out sanger sequence verifications.
The structure of 2.2Donor plasmids
It, need to be in 5 ' one promoter of end insertion of target gene to realize the overexpression of target gene（As CMV promoter,
EF1alpha）；Meanwhile resistant gene is inserted into genome（Such as puromycin（Puro）Resistant gene or
blasticidin（Blasticidin）Resistant gene etc.）And fluorescent protein labeling（Such as GFP）It can be provided for subsequent colony screening
Very big help.
Therefore, sequential series CMV promoter and the segment of puromycin resistant genes and GFP are inserted into target gene
Behind promoter, before gene coding region.It, can be in puromycin in order to generate the independent and functional puromycin albumen of tool
T2A sequences are inserted between EGFP, which can be identified and cut by the enzyme in cell upon translation.（Schematic diagram is as schemed
2A）.
PCR expansions are carried out respectively from HCT116 cellular genomes using following primer 1 and primer 2 and primer 3 and primer 4
Increase the left and right homology arm of Donor plasmids, then in pCR II plasmids（Purchased from Invitrogen）It is inserted using Hind III and KpnI
Enter left homology arm, right homology arm is inserted into Xho I and BamH I.Then primer 5 and primer 6 are used from pTALETF_v2 (NI)
（Purchased from Shanghai Si Dansai Bioisystech Co., Ltd）Middle amplification CMV promoter, with primer 7 and primer 8 from pLKO.1-TRC
（Purchased from Addgene）Middle amplification puro genes, T2A-EGFP pieces are expanded with primer 9 and primer 10 from pTALETF_v2 (NI)
Section.Condition used in above-mentioned amplification is routine.After obtained segment is carried out overlapping KpnI and BamH I is used to be inserted into
Into the pCR II plasmids with left and right homology arm, that is, obtain needed for Donor plasmids.The sequence such as SEQ of gained Donor plasmids
ID NO:Shown in 29.
Table 1PCR primers
It is as follows using PCR system that the various segments such as homology arm are expanded in experiment：
LongAmp(NEB)1μl；5×buffer4μl；Forward Primer1μl；Reverse Primer1μl；
Template10ng；RNase-free water are mended to 20 μ l
PCR programs are as follows：95 DEG C, 2min；95 DEG C, 15sec, 55 DEG C, 30s, 72 DEG C, 1min, 30 Xun Huans；72 DEG C, 3min.
Overlapping is as follows using PCR system in experiment：
LongAmp(NEB)1μl；5×buffer4μl；11 μ l of segment；21 μ l of segment；RNase-free water are mended to 20
μl。
PCR programs are as follows：95 DEG C, 2min；95 DEG C, 15sec, 55 DEG C, 30s, 72 DEG C, 2min, 10 Xun Huans；Stopped reaction,
Then add in thereto after corresponding primer and carry out the PCR of 20 Xun Huans again.
The CMV segments that wherein primer 5 and primer 6 obtain（Segment A）With the puromycin obtained with primer 7 and primer 8
（Segment B）It carries out adding in primer 5 and primer 8 during overlapping, can obtain the fusion segment of CMV and puromycin（Segment
C）.Segment C with primer 9 and primer 10 with expanding T2A-EGFP segments（Segment D）It carries out using primer when overlapping
5 and primer 10.
2.3 carry out genome manipulation using TALEN plasmids and Donor plasmids
By the correct left and right TALEN plasmids of obtained sequence and Donor plasmids according to 1:1:4 ratio is mixed into 100ul
Consideration convey reagent (Lonza）In, 2,000,000 HCT116 cells are resuspended with the consideration convey reagent of mixed plasmid, use consideration convey instrument (Lonza）
X-005 programs carry out consideration convey.Transfection adds in 1ug/ml puro antibiotic and carries out colony screening afterwards for 24 hours.During colony screening, often
It replaces containing Antibiotic medium once within 3-4 days, until most cells is carry out monoclonal after GFP positive cells in culture dish
It selects.
Trypsin digestion cell counts and cell is resuspended according to 1/100ul culture mediums concentration, will be thin per hole according to 100ul
Born of the same parents' suspension is added separately in the different holes of 96 orifice plates, and normal culture 1-2 weeks disappears after cell Proliferation is single visible clone
Change and amplifying cells are into 6cm culture dishes
The verification of 2.4 genome editors
Utilize genome extraction agent box（Purchased from Tiangeng biochemical technology Co., Ltd）Extract monoclonal cell genome.
Using 100ng genomes as template, wild type gene segment is expanded with primer 11 and primer 12 respectively, with 13 He of primer
Primer 14 expands mutated genes segment.
Because primer 11 and primer 12 in the both sides of TALEN recognition sites, can be amplified without the wild of insertion respectively
Type genomic fragment, and primer 13 is in genome and primer 14 is on Donor plasmids, only Donor plasmid integrations arrive
After the identification of TALEN and cleavage site, primer 13 and primer 14 can just amplify product, i.e. mutated genes segment.When one
Product can only be amplified in cell with primer 11 and primer 12 and represents that the cell without being inserted into Donor plasmids, can only use primer 13
Product, which is amplified, with primer 14 represents the fully integrated Donor plasmids of two allele of the cell.When using two kinds of primers
Product can be amplified to represent only to incorporate Donor plasmids there are one allele in the cell.It is overexpressed to realize
LncRNA, only needs single allele to integrate Donor plasmids, that is, the positive of product can be amplified by obtaining two kinds of primers
Cell.
Positive findings is as shown in Figure 2 B.Wherein, WT swimming lanes correspond to wild type, No. 1 saltant type corresponding with No. 2 swimming lanes.
2 genome editor of table identifies primer
2.5 are overexpressed the verification of RNA
2.5.1qPCR verification
RNA is extracted
After the HCT116 cells of 3.5cm culture dish adherent growths are washed twice with PBS, 1mLTRIzol reagents are added in, repeatedly
Piping and druming is until cell all cracks.0.2mL chloroforms are added in afterwards, and RNA is in upper strata aqueous phase after centrifugation, and is transferred into
It in the 1.5mLEP pipes of RNase-free, is centrifuged after adding in isometric isopropanol mixing, RNA will form flaky precipitate in tube bottom.
After the rinsing twice of 75% ethyl alcohol, room temperature is dried, and adds in suitable RNase-free water dissolutions.
RT-qPCR is verified
For the total RNA extracted, first with DNase I after 37 DEG C handle 30min, inverted and tried using Takara
Agent box is reversed to cDNA.System is as follows：
RNA1μg；5×buffer4μl；Oligo dT1μl；Random primer1μl；Enzyme1μl；RNase-free
Water is mended to 20 μ l.37 DEG C, 15min；85 DEG C, 5sec.
0.5 μ l is taken to use following primer as the template per hole（Table 3）Carry out RT-qPCR detections.It is interior using β-actin
Ginseng, standard deviation is from the result of three repetition experiments.
Table 3PCR primers
In obtained positive colony, for wild type HCT116, CCAT1-L has 20-40 times and is overexpressed effect,
Experimental result is as shown in Figure 2 C.
2.5.3Northernblot verification
2.5.3.1 prepared by probe
Using HCT116cDNA as template, the probe sequence of CCAT1-L is expanded using sequence 19 shown in table 4 and primer 20；With
PEGFP-C1 plasmids（Clontech）For template, sequence 21 shown in table 4 and the probe sequence of the amplification of primer 22 GFP are used.It utilizes
TA- Cloning Kits（Invitrogen）By obtained segment, forward direction is inserted among pCR-II plasmids respectively, obtains pCR-II-
CCAT1-L plasmids and pCR-II-GFP plasmids, respectively as the template for preparing CCAT1 and GFP probes.
4 amplification probe region primer of table
Then, carried out external from amplification probe template on the pCR-II carriers containing probe sequence obtained with M13 primers
Transcription experiment, obtains digoxin respectively（Dig）The AS of the identification of mark transcript identical with genetic transcription direction（antisense）
The S of rna probe and identification transcript opposite with genetic transcription（sense）Rna probe, transcription system are as follows：
Template1μg；10×Transcription Buffer2μl；0.1MDTT2μl；10×DigRNA
labeling mix2μl；RiboGuard0.5μl；Enzyme2μl；RNase-free water are mended to 20 μ l；37 DEG C of water-baths 3
Hour, 4M LiCl recycling, after packing, -80 DEG C freeze.
2.4.3.2Northernblot verification
The Agarose glue that concentration is 1.5% is prepared, 10 μ g are from HCT116 and TALEN positive cell clones
TotalRNA detects for Northernblot.After 2 hours of 120V electrophoresis, Bio-Rad membrane-transferring devices, 20V constant pressures electricity are used
Night is turned over, RNA is transferred on nylon membrane, then, 1800J UV crosslinking after 2 hours of 68 DEG C of prehybridizations, is separately added into
CCAT1 and GFP probe hybridized overnights.After hybridization, washed twice respectively in room temperature using 2 × SSC+0.1%SDS conditions, often
Secondary 5min washes twice in 68 DEG C of use 0.2 × SSC+0.1%SDS conditions, after each 30min, uses blockingbuffer
（Block buffer）Room temperature closes 30min, adds in Anti-Digoxigenin, FabFragment incubation at room temperature 30min, then
Use washingbuffer（Lavation buffer solution）It washes twice, each 15min.After being finally incubated 5min with substrate CDP-STAR, show
Shadow.As a result as shown in Figure 2 D, in the positive colony of acquisition, it can detect the GFP-CCAT1-L's of external source using GFP probes
Fusion transcript（Fig. 2 D are left）, the fusion of the GFP-CCAT1-L in addition to endogenous CCAT1-L is can detect using CCAT1-L probes
Transcript（Fig. 2 D are right）, and molecular weight is far longer than endogenous CCAT1-L.Illustrate using the system be successfully realized overexpression length it is non-
Coding RNA CCAT1-L.
2.5.4RNA fluorescence in situ hybridization is tested（RNA FISH）Verification
1）Plantation is overexpressed the HCT116 cells of CCAT1-L RNA on glass slide, 24 it is small when after with 1x PBS rinse 2-3
It is secondary, 15 minutes then are fixed with fixer (3.6%PFA+10% acetic acid (in1x PBS)), 1x PBS are rinsed 3 times, each 5min；
Again with 0.5%TritonX-100+2mM VRC processing, put 5 minutes on ice, 1x PBS are washed 3 times, each 5min；Add 75% ethyl alcohol, 4
DEG C overnight；
2）Probe hybridization adds CCAT1-L probes and GFP probes to hybridize to 10ul in buffer respectively, and 100 DEG C are denatured 10 points
Zhong Houfang is more than 2 minutes on ice；50%formamide+2XSSC room temperatures processing cell is used after removing 75% ethyl alcohol 10 minutes；Add spy
Pin is on cell, 50 DEG C of hybridized overnights；
3）Antibody incubation is rinsed twice with 0.1X SSC+0.1%SDS+50%formamide, and 50 DEG C are protected from light processing 20 minutes；
2XSSC+50%formamide is washed twice, and room temperature is protected from light processing 20 minutes；Add in sheep anti-Dig antibody, 100ul/
Well is incubated at room temperature 1h；2XSSC+8%formamide is rinsed 3 times, adds in donkey anti-sheep secondary antibodies, room temperature, which is protected from light, incubates
Educate 1h；It is rinsed 2 times, every time 10 minutes with 2XSSC+8%formamide room temperatures（It is protected from light）；DAPI is dyed 1 minute；2XSSC+8%
Formamide room temperatures rinse 3 times, every time 10 minutes（It is protected from light）；Mounting, fluorescence microscope is taken pictures or 4 degree of preservations.
Experimental result as shown in Figure 2 E, uses CCAT1-L probes（On）With GFP probes（Under）RNA in situ hybridizations are done respectively
It can detect that the CCAT1-L-GFP fusion transcripts of overexpression are located in nucleus during experiment, in spot distribution, be similar to
The positioning of endogenous CCAT1-L（Such as Figure 1A）.
2.5.5RNA/DNA double fluorescence in situ hybridization experiments（RNA/DNA double FISH）Verification
RNA fluorescence in situ hybridization step under fluorescence microscope as before, take pictures.
Sample after RNA fluorescence in situ hybridization is taken pictures is removed, and is first rinsed with 2X SSC+0.1%NP40+50%formamide
Then (42 DEG C) twice are handled 60 minutes with the 2X SSC+50%formamide37 DEG C containing RNase A.Treated sample
2XSSC+70%formamide80 DEG C is denatured 5 minutes, is handled with the 75% of precooling, 95%, 100% ethyl alcohol and added in after five minutes respectively
The DNA probe of CCAT1-L genes corresponding region（Empire Genomics）.37 DEG C of probes are incubated overnight.
It is rinsed 2 times, every time 10 minutes with 2XSSC+50%formamide37 DEG C（It is protected from light）；1XSSC room temperatures rinsing 1 time, five
Minute；4XSSC room temperatures rinse 1 time, five minutes；DAPI is dyed 1 minute；4XSSC room temperatures rinse 2 times, every time five minutes；Mounting,
Fluorescence microscope is taken pictures or 4 degree of preservations.
As shown in Figure 2 F, RNA in situ hybridizations the results show is overexpressed the fusion of the CCAT1-L-GFP generated to experimental result
RNA is dotted in one in cell in nucleus（Fig. 2 F are left）, DNA hybridization in situ experiment display CCAT1-L genes are in cell
In there are two allele（In Fig. 2 F）, the CCAT1-L-GFP of fusion and one of CCAT1-L genes common location, i.e., table
CCAT1-L-GFP up to generation is positioned at as endogenous CCAT1-L near its transcription site（Such as Figure 1B）.
Embodiment 2 can induce the acquisition and identification of CCAT1-L overexpressing cells system
1. experiment material
1）Reagent
With embodiment 1.
2）Cell line and carrier
With embodiment 1.
2. experimental method
The structure of 2.1TALEN plasmids
CCAT1-L, which can induce, uses TALEN plasmids used in embodiment 1 in being tested of overexpressing cell system.
The structure of 2.2Donor plasmids
It, need to be in 5 ' one inducible promoter of end insertion of target gene to realize the inducible overexpression of target gene（Such as
Ptight promoters）, and utilize the system of can induce（Tet-On systems, Tet-Off systems）Target gene is regulated and controled.
Therefore, after sequential series CMV promoter and the segment of puromycin resistant genes and GFP simultaneously be inserted into BGH and
Two kinds of terminator sequences of SV40, to terminate the transcription of CMV promoter driving completely.Then Ptight is inserted into after terminator sequence to start
Son（Schematic diagram such as Fig. 3 A）.
To obtain the sequence containing BGH and SV40, using primer 31 and primer 32 from pcDNA3.0 (Invitrogen)
BGH sequences are expanded, SV40 sequences, the BGH that will be obtained are expanded from pEGFP-C1 (Clontech) using primer 33 and primer 34
It is carried out with SV40 sequences after overlapping PCR using being connected into pCR-II after EcoR I and BamH I double digestions
（Invitrogen）In plasmid, pCR-II-BGH-SV40 plasmids are obtained.Using EcoR I and BamH I restriction endonucleases from pCR-II-
BGH-SV40 plasmids, in cut the fusion segment of BGH and SV40, segment is inserted into the example 1 of EcoR I and BamH I digestions
Donor plasmids in, obtain containing there are two terminator sequence Donor plasmids（Donor2）.
Right homology arm is expanded from HCT116 cellular genomes using primer 23 and primer 24, segment is in BamH I and XhoI
It is inserted into the Donor2 plasmids that original right homology arm is removed after BamH I and XhoI double digestions, is realized in Donor2 after double digestion
Not I and EcoR V restriction enzyme sites are introduced in plasmid.The carrier obtained using BamH I and Not I digestions, insertion Bgl II and
Ptight promoters after Not I digestions are to obtain purpose Donor plasmids 3.Obtain the sequence such as SEQ IDNO of Donor plasmids:
Shown in 30.
Table 5PCR primers
2.3 carry out genome manipulation and the verification of genome editor using TALEN plasmids and Donor plasmids
Using same method in embodiment 1 work to the genome manipulation of HCT116 cells, obtain monoclonal, and
The verification of genome editor is carried out using same primer.
Insert type genomic fragment is expanded using primer 25 and primer 26, primer 27 and primer 28 expand endogenous gene pack
Section.Verification result as shown in Figure 3B because primer 27 and primer 28 can amplify respectively in the both sides of TALEN recognition sites
Wild-type genomic segment without insertion, and primer 25 is in genome and primer 26 is on Donor plasmids, only Donor
For plasmid integration to after the identification of TALEN and cleavage site, primer 25 and primer 26 can just amplify product and mutated genes piece
Section.Represent that the cell, can only without being inserted into Donor plasmids when product can only be amplified in a cell with primer 27 and primer 28
Product, which is amplified, with primer 25 and primer 26 represents the fully integrated Donor plasmids of two allele of the cell.When using
Two kinds of primers can amplify product and represent only to incorporate Donor plasmids there are one allele in the cell.To realize
LncRNA is expressed, only single allele is needed to integrate Donor plasmids, i.e., two kinds of primers of acquisition experiment, which can expand, produces
The cell of object.
6 genome editor of table identifies primer
2.5 can induce the verification for being overexpressed RNA
To realize the inducible expression of CCAT1-L, it is necessary to be transferred to the matter of coding rtTA albumen in the positive colony of acquisition
Grain.RtTA code areas are expanded from pLVX-Tight-Puro (Clontech) using primer 35 and primer 36 to obtain the plasmid
And obtain pcDNA3-rtTA using being inserted into after Bgl II and EcoR I digestions in the pcDNA3 plasmids after Bgl II and EcoR I
Plasmid.
PcDNA3-rtTA plasmids are transfected into the positive colony of acquisition and add in 1 μ g/ml's of final concentration simultaneously
Doxycycline (fortimicin) handles cell, and processing cell collects cell total rna afterwards for 24 hours（Such as example 1）.Using in example 1
Identical mode carries out RT experiments, then carries out RT-qPCR verifications using primer identical in example 1.
As a result as shown in Figure 3 C, the expression quantity of CCAT1-L is very low in the positive colony without induction（Labeled as 1,2,
3,4）, after fortimicin inducible gene expression is used, the expression quantity of CCAT1-L significantly increases（I.e. corresponding 1+Dox, 2+
Dox,3+Dox,4+Dox）.The inducible CCAT1 for being successfully realized CCAT1-L is overexpressed.
Table 7rtTA builds primer
Claims (8)
1. a kind of expression of activation long non-coding RNA gene C CAT1-L in situ, is：By homologous recombination technique, in receptor
Target gene promoters after, before the gene order of target gene, be inserted into second promoter and riddled basins, and lead to
Cross screening label screening obtain positive findings, the target gene be CCAT1-L, second promoter be selected from CMV promoter or
EF1alpha promoters.
2. the expression of activation long non-coding RNA gene C CAT1-L in situ as described in claim 1, which is characterized in that including
The following steps：
1) specific recognition target sequence TALEN plasmids are built；
2) design and build Donor plasmids, second that sequential series are included between the left and right homology arm of the Donor plasmids starts
Son and riddled basins；
3) by step 1) and 2), the TALEN plasmids and Donor plasmids of structure are transferred to recipient cell, by homologous recombination to recipient cell
Born of the same parents carry out genome manipulation, cultivate recipient cell and screen acquisition positive findings according to selection markers and verify.
3. the expression of activation long non-coding RNA gene C CAT1-L in situ as claimed in claim 2, which is characterized in that step
1) in, the targeted target site of the TALEN plasmids is located between promoter and its gene start sequence of target gene；Step 2)
In, the corresponding homologous recombination target sequence of the Donor plasmids is located between promoter and its gene start sequence of target gene.
4. the expression of activation long non-coding RNA gene C CAT1-L in situ as claimed in claim 2, which is characterized in that described
Riddled basins are resistant gene and fluorescent protein marker gene.
5. the expression of activation long non-coding RNA gene C CAT1-L in situ as claimed in claim 2, which is characterized in that described
Between the left and right homology arm of Donor plasmids, after riddled basins, terminator sequence and derivable startup have also been sequentially inserted into
Son.
6. the expression of activation long non-coding RNA gene C CAT1-L in situ as claimed in claim 2, which is characterized in that described
Include CMV promoter, puromycin resistant genes and the EGFP fluorescence of sequential series between the left and right homology arm of Donor plasmids
Protein marker gene；Between the left and right homology arm, BGH has selectively been sequentially inserted into after EGFP fluorescent protein marker genes
With two kinds of terminator sequences of SV40 and Ptight promoters.
7. the expression of activation long non-coding RNA gene C CAT1-L in situ as claimed in claim 6, which is characterized in that described
Inserted with T2A sequences between puromycin resistant genes and EGFP fluorescent protein marker genes.
8. the purposes of the expression as described in any claim in claim 1-7, to be used for activation long non-coding in situ
The overexpression of rna gene CCAT1-L, so as to the functional study field applied to LncRNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410051873.5A CN104845994B (en) | 2014-02-14 | 2014-02-14 | A kind of expression and its application that activated gene in situ is realized using genome editing technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410051873.5A CN104845994B (en) | 2014-02-14 | 2014-02-14 | A kind of expression and its application that activated gene in situ is realized using genome editing technique |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104845994A CN104845994A (en) | 2015-08-19 |
| CN104845994B true CN104845994B (en) | 2018-06-01 |
Family
ID=53845982
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410051873.5A Active CN104845994B (en) | 2014-02-14 | 2014-02-14 | A kind of expression and its application that activated gene in situ is realized using genome editing technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104845994B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567734A (en) * | 2016-01-18 | 2016-05-11 | 丹弥优生物技术（湖北）有限公司 | Method for precisely editing genome DNA sequence |
-
2014
- 2014-02-14 CN CN201410051873.5A patent/CN104845994B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Human colorectal cancer-specific CCAT1-L lncRNA regulates long-range chromatin interactions at the MYC locus;Jian-Feng Xiang等;《Cell Research》;20140325;第24卷;513-531页 * |
| Long noncoding RNAs: from identification to functions and mechanisms;Oskar Marín-Béjar等;《Advances in Genomics and Genetics》;20150702;257-274页 * |
| 探索长非编码RNA在哺乳动物细胞中的功能秘密;向剑锋 等;《中国细胞生物学学报》;20130228;第35卷(第2期);262-272页 * |
| 通过启动子同源重组研究人凝血因子的组成型表达;杨晓青 等;《中国科学(C辑)》;20001031;第30卷(第5期);535-540页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104845994A (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bardou et al. | Long noncoding RNA modulates alternative splicing regulators in Arabidopsis | |
| Lee et al. | Advances in CLIP technologies for studies of protein-RNA interactions | |
| EP3344766B1 (en) | Systems and methods for selection of grna targeting strands for cas9 localization | |
| Ishizu et al. | Somatic primary piRNA biogenesis driven by cis-acting RNA elements and trans-acting Yb | |
| Jacobsen et al. | Transcriptional effects of transfection: the potential for misinterpretation of gene expression data generated from transiently transfected cells | |
| US20180171314A1 (en) | Thermostable cas9 nucleases | |
| CN108018301B (en) | Method for determining core promoter of miR-27a gene and binding site of transcription factor Myod thereof | |
| CN108285494B (en) | Fusion protein, kit and CHIP-seq detection method | |
| CN109402179B (en) | Method for rapidly identifying proliferation phenotype after knockout of esophageal cancer functional gene in cell line | |
| Inatomi et al. | TFB2M and POLRMT are essential for mammalian mitochondrial DNA replication | |
| Ren et al. | Characterization and perturbation of CTCF-mediated chromatin interactions for enhancing myogenic transdifferentiation | |
| Wu et al. | Massively parallel characterization of CRISPR activator efficacy in human induced pluripotent stem cells and neurons | |
| WO2019027414A1 (en) | High performance multi-input microrna sensors and uses thereof | |
| CN104845994B (en) | A kind of expression and its application that activated gene in situ is realized using genome editing technique | |
| Fitzsimmons et al. | Rewiring of RNA methylation by the oncometabolite fumarate in renal cell carcinoma | |
| JP6960409B2 (en) | promoter | |
| Lo et al. | Halo‐seq: An RNA Proximity Labeling Method for the Isolation and Analysis of Subcellular RNA Populations | |
| Picchi-Constante et al. | Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi | |
| Robledo et al. | Identification of small RNA–protein partners in plant symbiotic bacteria | |
| CN107881200A (en) | A kind of rapid screening method applied to model animal zebra fish transgenosis | |
| CN112877332A (en) | Method for detecting activity of chicken RIPK2 promoter by using dual-luciferase reporter gene | |
| Suda et al. | Molecular cytogenetic characterization of telomere‐specific repetitive DNA sequences in Rana rugosa | |
| US6558906B2 (en) | Methods of screening potential translational regulatory elements of messenger RNA | |
| Guarnaccia et al. | Gene-specific quantification of nascent transcription following targeted degradation of endogenous proteins in cultured cells | |
| CN106868006B (en) | E2F1 protein bindable DNA fragment and application thereof in E2F1 activity detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200421 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai, Xuhui District Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |