CN104830854B - For detecting the primer probe sequence of beet Pseudoperonospora cubensis and detection kit - Google Patents
For detecting the primer probe sequence of beet Pseudoperonospora cubensis and detection kit Download PDFInfo
- Publication number
- CN104830854B CN104830854B CN201510246484.2A CN201510246484A CN104830854B CN 104830854 B CN104830854 B CN 104830854B CN 201510246484 A CN201510246484 A CN 201510246484A CN 104830854 B CN104830854 B CN 104830854B
- Authority
- CN
- China
- Prior art keywords
- beet
- sequence
- pseudoperonospora cubensis
- probe
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses for detecting the primer probe sequence of beet Pseudoperonospora cubensis and detection kit.The present invention provides for detect or assist detection beet Pseudoperonospora cubensis kit, including the primer pair being made of the DNA molecular shown in sequence 2 in the DNA molecular shown in sequence in sequence table 1 and sequence table.The experiment proves that, the present invention is according to the difference of beet Pseudoperonospora cubensis and its allied species 28S rDNA sequences design special primer and TaqMan MGB probes, fluorescent quantitative PCR technique is detected applied to beet Pseudoperonospora cubensis, to obtain a kind of sensitive, accurate, easy and quick detection method, there is directive significance to cargoes imported and exported and examination and test of products quarantine, disease control prediction.
Description
Technical field
The present invention relates to biotechnologies, more particularly, to detect primer probe sequence and the inspection of beet Pseudoperonospora cubensis
Test agent box.
Background technology
Beet Pseudoperonospora cubensis (Peronospora farinosa (Fr.) Fr.f.sp.betae Byford) is that China is important
Plant quarantine venereal disease opportunistic pathogen, to beet production very harmful, cause of disease Pseudomonas Mastigomycotina, Peronosporales, Peronospora, powder
Downy mildew.Main to infect the tender organ of beet overground part children, mostly harmful lobus cardiacus, it is yellow after light green color to brown that infected leaves, which is just,
Irregular shape scab.In humid conditions, mould layer of the scab back side with gray purple, the bacterium stretched out from stomata for pathogen
Silk, sporangiophore and sporangiospore.The disease is in Israel, the former Soviet Union, Kenya, Morocco, Canada, the U.S., Argentina, Australia
The countries such as big Leah, New Zealand are distributed.Beet Pseudoperonospora cubensis in 1997 is included in China's quarantine harmful organisms catalogue, according to state
Interior scholar investigates report, which is southwestern three province's foliage heets and Yili of Xinjiang sugar beet, last century 90
Age Xinjiang sugar beet downy mildew causes scholar's extensive concern, and to its pathogen morpha feature, endanger shape, morbidity regularty of epidemic
And quarantine control measure is studied and has been reported.
Sugar beet is the important sugar crop for being only second to sugarcane, and the beet sugar producing region of China's maximum is in Xinjiang, annual output sugar
500000 tons or so.Sugarbeet in Xinjiang seed breeding base was reduced in recent years, and beet downy mildew sporadicly occurs with amblent air temperature small area, but I
Every year from a large amount of beet seeds of the states such as the U.S., Germany, France, Holland import, the quarantine harmful organisms that may be carried are serious for state
The production safety of China's beet industry is threatened, how efficiently quick detection becomes the technology that prevention beet downy mildew is passed to, spreads
It is crucial.Quantitative fluorescent PCR is widely used in the numerous areas such as plant pathogenic fungi, bacterium, viral diagnosis, TaqMan-MGB probes
Since 3 ' ends have MGB molecules, probe Tm values (average 15nt can improve 18 DEG C) are improved, probe length can shorten 13~
15nt or so solves the problems, such as the design of single base differential probe.Beet Pseudoperonospora cubensis can not be cultivated, and detection method is mainly
PCR method, and there is the shortcomings of specificity is not strong in traditional PCR method, it is difficult to meet actually detected needs.
Invention content
It is an object of the present invention to provide for detect or assist detection beet Pseudoperonospora cubensis kit.
Kit provided by the invention, including as 2 institute of sequence in the DNA molecular shown in sequence in sequence table 1 and sequence table
The primer pair of DNA molecular composition shown.
Mentioned reagent box further includes probe, and the nucleotides sequence of the probe is classified as sequence 3 in sequence table.
In mentioned reagent box, 5 ' end mark fluorophors of the probe, and 3 ' end mark quenching groups.
In mentioned reagent box, in the DNA molecular, the sequence table in the sequence table shown in sequence 1 shown in sequence 2
The molar ratio of DNA molecular and the probe is 2-6:2-6:1, DNA molecular, the sequence in the sequence table shown in sequence 1
The molar ratio of DNA molecular and the probe in table shown in sequence 2 is specially 4:4:1.
It is a further object to provide for detect or assist detection beet Pseudoperonospora cubensis PCR reagent.
PCR reagent provided by the invention, including above-mentioned primer pair and the probe；Each primer is described in the primer pair
Final concentration of 0.2-0.6 μm of ol/L in PCR reagent, final concentration of 0.05-0.3 μ of the probe in the PCR reagent
mol/L；
Final concentration of each primer in the PCR reagent is specially 0.4 μm of ol/L in the primer pair, and the probe is in institute
It is specially 0.1 μm of ol/L to state the final concentration in PCR reagent.
The application of above-mentioned kit or above-mentioned PCR reagent in detecting or assisting detection beet Pseudoperonospora cubensis is also this
Invent the range of protection；
Or above-mentioned kit or above-mentioned PCR reagent are in detection or auxiliary detection beet Pseudoperonospora cubensis product is prepared
Using being also the scope of protection of the invention.
Above-mentioned kit or above-mentioned PCR reagent are detecting or are assisting whether detection sample to be tested infects beet downy mildew
Application in bacterium is also the scope of protection of the invention；
Above-mentioned kit or above-mentioned PCR reagent are preparing detection or are assisting whether detection sample to be tested infects beet frost
Application in mildew bacterium product is also the scope of protection of the invention.
Third purpose of the present invention is to provide a kind of detection or whether auxiliary detection sample to be tested infects beet Pseudoperonospora cubensis
Method.
Method provided by the invention, includes the following steps：With the primer pair in above-mentioned kit and the probe
Fluorescent quantitative PCR is carried out to sample to be tested, detects amplified production；
If amplified production has fluorescence signal and Ct values are less than or equal to 35 and more than 0, sample to be tested infection or candidate infection
Beet Pseudoperonospora cubensis；If amplified production unstressed configuration signal has fluorescence signal and Ct values to be more than 35, sample to be tested be uninfected by or
Candidate is uninfected by beet Pseudoperonospora cubensis.
In the above method, the template of the fluorescent quantitative PCR is the DNA of sample to be tested.
The experiment proves that the present invention devises spy according to the conserved sequence of beet Pseudoperonospora cubensis 28S rDNA sequences
Different in nature detection primer and TaqMan-MGB probes detect fluorescent quantitative PCR technique applied to beet Pseudoperonospora cubensis, phase of the present invention
For prior art high specificity, high sensitivity.Therefore, the present invention obtains a kind of sensitive, accurate, easy and quick detection side
Method has directive significance to inlet and outlet complementary goods and examination and test of products quarantine, disease control prediction.
Description of the drawings
Fig. 1 is beet Pseudoperonospora cubensis and the quantitative fluorescent PCR specific detection of correlation kind of bacterial strain DNA.
Fig. 2 is the detection sensitivity of quantitative fluorescent PCR.
Specific embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
The experimental method of specific experiment condition is not specified in the following example, usually according to conventional laboratory conditions or according to system
Make the experiment condition proposed by manufacturer.
Embodiment 1 designs for detecting the primed probe group of beet Pseudoperonospora cubensis
The 28S rDNA sequences for selecting beet Pseudoperonospora cubensis are target gene, the primed probe of design detection beet Pseudoperonospora cubensis
Group, particular sequence are as follows：
Sense primer PF-F：TCTTGGTGGACTAGTCGTCG (sequence 1)
Downstream primer PF-R：GAACGGCAACAAGTTAGAGTCTAC (sequence 2)
Probe PF-T：FAM-CACACGGTACACACGGAGA-MGB (sequence 3)
Wherein, FAM is fluorophor, and MGB is quenching group.
Embodiment 2, the application for detecting the primed probe group of beet Pseudoperonospora cubensis
First, it is verified for detecting the primed probe group-specific of beet Pseudoperonospora cubensis
(1) extraction of DNA
Germ infected plant or pure bacterial strain in table 1 are stored in Yi Li Entry-Exit Inspection and Quarantine Bureau.Sample number into spectrum is in table 1
1st, 4,7,8,9,10, No. 11 germs for being unable to pure culture clean infected leaves tissue with sterile deionized water, by germ spore and
Mycelia is washed down, then by centrifugal enrichment pathogen, rear with reference to kit operation, (plant genome DNA extracts kit, article No. are
DP305-02, Tiangeng bio tech ltd).Sample number into spectrum can carry out the bacterial strain of pure culture through 5 for 2,3,5,6 in table 1
Pure culture in~7 days, it is rear with reference to kit operation (plant genome DNA extraction examination with liquid nitrogen grinding after the freeze-drying of picking mycelia
Agent box, article No. DP305-02, Tiangeng bio tech ltd).Healthy beet leaf and beet seed sample directly use liquid
It is rear to operate (plant genome DNA extracts kit, article No. DP305-02, Tiangeng biotechnology with reference to kit after nitrogen grinding
Co., Ltd).
1 pathogen of table and its host
(2) quantitative fluorescent PCR
The DNA obtained respectively using above-mentioned (1) as template, with sense primer PF-F, downstream primer PF-R and probe PF-T into
Row quantitative fluorescent PCR.
11 kinds of bacterial strains and beet healthy plant (negative control) DNA profiling are placed in different PCR reaction tubes, remaining reagent draws
Object is consistent, and 12 pipes are configured altogether.
The system of above-mentioned fluorescent quantitative PCR is as shown in table 2.
The system of 2 fluorescent quantitative PCR of table
2 × FastFire qPCR PreMix (Probe) include Taq archaeal dna polymerases, dNTPs, MgCl2, reaction buffering
Liquid purchases TIANGEN Biotech (Beijing) Co., Ltd., article No. FP208.
Above-mentioned quantitative fluorescent PCR reaction condition is：95℃ 1min；95 DEG C of 5s, 60 DEG C of 10s, 72 DEG C of 15s, 40 are followed
Ring collects FAM fluorescence signals after 72 DEG C of stages of each cycle.
(3) result judges
The fluorescent PCR amplified signal obtained with 480 instruments of Roche detection above-mentioned (2), according to the cycle threshold under FAM channels
Value (Ct values) is judged that, if amplified production has fluorescence signal and Ct values are less than or equal to 35 and more than 0, sample to be tested is beet
Pseudoperonospora cubensis or infection beet Pseudoperonospora cubensis；If amplified production unstressed configuration signal has fluorescence model and Ct values to be more than 35, treat
Test sample sheet is uninfected by beet Pseudoperonospora cubensis for beet Pseudoperonospora cubensis or candidate.
The results are shown in Figure 1, and 1：Beet Pseudoperonospora cubensis；2-12：Black leg of beet bacterium；Sugar beet leaf spot bacteria；Beet white powder
Germ；Beet Phoma sp pine root fungus；Beet alternaria；Sunflower Downy Mildew；Radish Pseudoperonospora cubensis；Capsicum Pseudoperonospora cubensis；
Plasmopara viticola；Phytophthora sojae kaufmann＆gerdemann；Negative control；The PCR amplification of above-mentioned 1-11 germs sample and negative control, in addition to
No. 1 sample has fluorescence signal, and Ct values are 16.3, remaining sample and the equal unstressed configuration signal of negative control show the detection method
Primer and probe specificity is good.
2nd, it is verified for detecting the primed probe group sensitivity of beet Pseudoperonospora cubensis
The beet Pseudoperonospora cubensis DNA concentration of extraction is measured with nucleic acid concentration analyzer ND-1000, is demarcated to 10.0ng/ μ L,
It is again 1.0 × 10 by 10 times of gradient dilutions6fg/μL、1.0×105fg/μL、1.0×104fg/μL、1.0×103fg/μL、1.0
×102Fg/ μ L, each gradient are repeated 3 times, and 1.0 μ L DNA is taken to do template respectively and carry out fluorescence quantitative PCR detection, and do feminine gender
Control.
Respectively using DNA after above-mentioned dilution as template, carried out with sense primer PF-F, sense primer PF-R and probe PF-T
Quantitative fluorescent PCR, reaction system and reaction condition are shown in above-mentioned one.
The results are shown in Figure 2,1-3：DNA concentration 1.0 × 106fg/μL；4-6：1.0×105fg/μL；7-9：1.0×
104fg/μL；10-12：1.0×103fg/μL；13-15：1.0×102fg/μL；16-18：Negative control；It can be seen that this hair
Bright primer and probe have higher sensitivity, and high sensitivity reaches 100fg pathogens DNA.
3rd, for detecting primed probe group practical application of the beet seed with beet Pseudoperonospora cubensis
9 parts of beet seed DNA of 3 parts of beet seeds and import to field acquisition, carry out fluorescence quantitative PCR detection, see
Table 3.Fluorescence quantitative PCR detection result is shown：There is fluorescence signal in sample 12-8 and 13-6, and Ct values are respectively 21.5 and 24.6,
Testing result is the positive, and other samples and negative control do not have fluorescence signal, and testing result is feminine gender.Fluorescence quantitative PCR detection
As a result it is consistent with field actual monitoring result.
Monitor on field method bibliography《Beet downy mildew》(sternly into 1999, plant quarantine).
Beet Pseudoperonospora cubensis detects in 3 beet seed sample of table
Note："-" is feminine gender；"+" is the positive
Claims (11)
1. for detecting or assisting the kit of detection beet Pseudoperonospora cubensis, including as the DNA molecular shown in sequence in sequence table 1
With the primer pair of the DNA molecular composition shown in sequence in sequence table 2, probe is further included, the nucleotides sequence of the probe is classified as sequence
Sequence 3 in list.
2. kit according to claim 1, it is characterised in that：5 ' end mark fluorophors of the probe, and 3 '
End mark quenching group.
3. kit according to claim 1 or 2, it is characterised in that：DNA molecular in the sequence table shown in sequence 1,
The molar ratio of DNA molecular and the probe in the sequence table shown in sequence 2 is 2-6: 2-6:1.
4. kit according to claim 1 or 2, it is characterised in that：DNA molecular in the sequence table shown in sequence 1,
The molar ratio of DNA molecular and the probe in the sequence table shown in sequence 2 is 4:4:1.
5. for detecting or assisting the PCR reagent of detection beet Pseudoperonospora cubensis, described in any one of claim 1-4
Primer pair and the probe；Final concentration of 0.2-0.6 μm ol/L of each primer in the PCR reagent, institute in the primer pair
State final concentration of 0.05-0.3 μm ol/L of the probe in the PCR reagent.
6. PCR reagent according to claim 5, it is characterised in that：Each primer is in the PCR reagent in the primer pair
Final concentration of 0.4 μm of ol/L, final concentration of 0.1 μm ol/L of the probe in the PCR reagent.
7. any kit or PCR reagent described in claim 5 or 6 are detecting or are assisting inspection in claim 1-4
Survey the application in beet Pseudoperonospora cubensis.
8. any kit or PCR reagent described in claim 5 or 6 are preparing detection or auxiliary in claim 1-4
Help the application in detection beet Pseudoperonospora cubensis product.
9. any kit or PCR reagent described in claim 5 or 6 are detecting or are assisting inspection in claim 1-4
Whether survey sample to be tested infects the application in beet Pseudoperonospora cubensis；
Or any kit or PCR reagent described in claim 5 or 6 are preparing detection or auxiliary in claim 1-4
Help whether detection sample to be tested infects the application in beet Pseudoperonospora cubensis product.
10. a kind of method for detecting or assisting detection sample to be tested whether to infect beet Pseudoperonospora cubensis, includes the following steps：With power
Profit requires the primer pair in 1-4 in any kit and the probe to carry out quantitative fluorescent PCR to sample to be tested
Amplification detects amplified production；
If amplified production has fluorescence signal and Ct values are less than or equal to 35 and more than 0, sample to be tested infection or candidate infection beet
Pseudoperonospora cubensis；If amplified production unstressed configuration signal has fluorescence model and Ct values to be more than 35, sample to be tested is uninfected by or candidate
It is uninfected by beet Pseudoperonospora cubensis.
11. according to the method described in claim 10, it is characterized in that：The template of the fluorescent quantitative PCR is treats test sample
This DNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510246484.2A CN104830854B (en) | 2015-05-13 | 2015-05-13 | For detecting the primer probe sequence of beet Pseudoperonospora cubensis and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510246484.2A CN104830854B (en) | 2015-05-13 | 2015-05-13 | For detecting the primer probe sequence of beet Pseudoperonospora cubensis and detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104830854A CN104830854A (en) | 2015-08-12 |
| CN104830854B true CN104830854B (en) | 2018-06-19 |
Family
ID=53809054
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510246484.2A Expired - Fee Related CN104830854B (en) | 2015-05-13 | 2015-05-13 | For detecting the primer probe sequence of beet Pseudoperonospora cubensis and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104830854B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243166A (en) * | 2013-05-15 | 2013-08-14 | 中国农业科学院植物保护研究所 | Rapid molecular detection method and application for plasmopara viticola |
-
2015
- 2015-05-13 CN CN201510246484.2A patent/CN104830854B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103243166A (en) * | 2013-05-15 | 2013-08-14 | 中国农业科学院植物保护研究所 | Rapid molecular detection method and application for plasmopara viticola |
Non-Patent Citations (4)
| Title |
|---|
| Detection and Quantification of Peronospora tabacina Using a Real-Time Polymerase Chain Reaction Assay;Monica Blanco-Meneses and Jean Beagle Ristaino;《Plant Disease》;20110630;第95卷(第6期);673-682 * |
| Multiplex real-time PCR assays for detection of four seedborne spinach pathogens;C. Feng et al.;《Journal of Applied Microbiology》;20140613;第117卷(第2期);472-484 * |
| 利用28SrDNA D1/D2区和ITS rDNA序列鉴定甜瓜白粉病病原菌;刘建利;《植物保护学报》;20110228;第38卷(第1期);47-51 * |
| 大豆霜霉病菌rDNAITS区的分子探针的设计与应用;刘艳 等;《华北农学报》;20121231;第27卷(第2期);230-233 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104830854A (en) | 2015-08-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103498000B (en) | Primer group, kit and method for detecting rice quarantine pathogenic bacteria by multiplex PCR (polymerase chain reaction) method | |
| CN102154485B (en) | Single tube nested PCR (polymerase chain reaction) detection method for wheat stripe rust bacteria and primer thereof | |
| CN104232782B (en) | A kind of detect tobacco soil-borne fungus pathogen PCR primer and application and method | |
| CN104774955A (en) | Botryosphaeria dothidea detection method | |
| CN105331714A (en) | Peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and rapid detection method thereof | |
| CN108018378A (en) | A kind of Luohu virus Taq-man fluorescence probe quantitative PCRs detection kit and detection method | |
| CN104313128B (en) | Method based on loop-mediated isothermal amplification technique detection Fusarium graminearum and Primer composition | |
| CN106381340B (en) | Botrytis cinerea LAMP detection primer, detection kit and its application | |
| CN104946760B (en) | A kind of method and dedicated kit for detecting Pythium inflatum | |
| CN105349655A (en) | Peronophythora litchii molecular detection primers and detection method thereof | |
| CN107828905A (en) | Tobacco smoke pollution LAMP detection primer and detection method | |
| CN110564882B (en) | Double TaqMAN probe fluorescent quantitative PCR detection method for piroplasmosis | |
| CN104195254B (en) | Method based on loop-mediated isothermal amplification technique detection Herba Equiseti Hiemalis's Fusariumsp and Primer composition | |
| CN104004842A (en) | Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals | |
| CN104830854B (en) | For detecting the primer probe sequence of beet Pseudoperonospora cubensis and detection kit | |
| CN104293957B (en) | A kind of early stage rapid molecular detection method of Botrytis cinerea | |
| CN105177182A (en) | Real-time fluorescence PCR (polymerase chain reaction) DPO (dual priming oligonucleotide) primer and kit for detecting grapevine leafroll-associated virus No.3 | |
| CN105821159A (en) | Nested RT-PCR detection method for differentiating variant strains and classic strains of PEDV | |
| CN102643903B (en) | PCR (Polymerase Chain Reaction) detection primer for phytophthora capsici leonian, kit containing primer and application thereof | |
| CN108411017A (en) | Detect the LAMP primer and method of pseudomonas syringae tomato pvs oryzae and oryzicola | |
| CN105200122A (en) | Quantitative detection kit for wheat stripe rust and application thereof | |
| CN104404151A (en) | Kit for detecting blackstem bacteria of sunflowers | |
| CN103451298B (en) | Kit for detecting physiological races of brussels sprouts wilt pathogens I and II and detection method thereof | |
| CN106957915A (en) | Primer and kit for detecting apple tree/pear tree rot pathogen and quantitative detection method | |
| CN102925568B (en) | Primer and probe for detecting acidovorax citrulli and detection method for acidovorax citrulli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180619 Termination date: 20200513 |