CN104830727B - The Methylobacterium of degradable chlorohydrocarbon and its application - Google Patents

The Methylobacterium of degradable chlorohydrocarbon and its application Download PDF

Info

Publication number
CN104830727B
CN104830727B CN201510225653.4A CN201510225653A CN104830727B CN 104830727 B CN104830727 B CN 104830727B CN 201510225653 A CN201510225653 A CN 201510225653A CN 104830727 B CN104830727 B CN 104830727B
Authority
CN
China
Prior art keywords
methylobacterium
chlorohydrocarbon
degradable
bacterium
chloroalkene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201510225653.4A
Other languages
Chinese (zh)
Other versions
CN104830727A (en
Inventor
张丽杰
何芝
赵天涛
全学军
邢志林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chongqing University of Technology
Original Assignee
Chongqing University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chongqing University of Technology filed Critical Chongqing University of Technology
Priority to CN201510225653.4A priority Critical patent/CN104830727B/en
Publication of CN104830727A publication Critical patent/CN104830727A/en
Application granted granted Critical
Publication of CN104830727B publication Critical patent/CN104830727B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • A—HUMAN NECESSITIES
    • A62—LIFE-SAVING; FIRE-FIGHTING
    • A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
    • A62D3/00—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances
    • A62D3/02—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances by biological methods, i.e. processes using enzymes or microorganisms
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
    • B09C—RECLAMATION OF CONTAMINATED SOIL
    • B09C1/00—Reclamation of contaminated soil
    • B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F3/00—Biological treatment of water, waste water, or sewage
    • C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
    • C—CHEMISTRY; METALLURGY
    • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
    • C02F2101/00—Nature of the contaminant
    • C02F2101/30—Organic compounds
    • C02F2101/36—Organic compounds containing halogen

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Environmental & Geological Engineering (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hydrology & Water Resources (AREA)
  • Water Supply & Treatment (AREA)
  • Business, Economics & Management (AREA)
  • General Chemical & Material Sciences (AREA)
  • Soil Sciences (AREA)
  • Emergency Management (AREA)
  • Toxicology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)

Abstract

The present invention relates to a kind of Methylobacterium of degradable chlorohydrocarbon and its application, the preserving number of the bacterial strain is CCTCC NO:M 2015046.The bacterium not only has height endurability to chlorohydrocarbon, but also it can be grown by sole carbon source and the energy of chlorohydrocarbon, overcome the deficiency of co -metabolic degradation technique, higher activity can be kept in dystrophy environment, applied suitable for fields such as waste water, drinking water and soil remediations, be expected to obtain new breakthrough in the biodegradable engineer applied field of chlorohydrocarbon.

Description

The Methylobacterium of degradable chlorohydrocarbon and its application
Technical field
The invention belongs to technical field of environmental microorganism, and in particular to a kind of Methylobacterium of degradable chlorohydrocarbon and its should With.
Background technology
Chlorohydrocarbon is widely used in the fields such as chemical industry, medicine, agricultural chemicals as important organic solvent and product intermediate. Because use and storage are improper, the mode such as chlorohydrocarbon is by volatilizing, leaking, discharge of wastewater is drained into natural environment.In recent years Numerous studies show, the chlorinated hydrocarbon contaminants such as trichloro ethylene have potential " three cause " (carcinogenic, teratogenesis, mutagenesis) effect and Genetic toxic effect, such as micro trichloro ethylene exposure contact can cause liver, kidney and central lesion, cause a series of machines Body function disorder symptoms, seriously jeopardize human health.With the international, country ecological environment is proposed in sustainable development it is more next Higher requirement, how to effectively eliminate chlorohydrocarbon pollution has turned into the important research content of field of environment protection.
It is biodegradable because it has high efficiency and low cost from the point of view of solving pollution in wide area, it is considered to be Eliminate the maximally effective approach of chloroalkene pollutant.Biodegradation includes anaerobic and aerobic biodegradation two ways.Anaerobism The dechlorination bacterium such as degraded conventional Hyphomicrobium, Dehalococcoides, make high chlorinatedorganic reduction dechlorination.Dechlorination bacterium Consortium often is formed with acetogen (homoacgtogens) and methanogen (methanogens), in carbon source and exogenous electron Under the conditions of donor is existing, chlorohydrocarbon provides the energy for anaerobe as electron acceptor and while is degraded.But anaerobism drops There is halfway defect of degrading in solution, the product after dechlorination often has bigger bio-toxicity and carcinogenicity.And aerobic degradation Approach can be degradable by hydroxylation or epoxidation chlorohydrocarbon, relative to halfway anaerobic organism of degrading Degraded, aerobic biodegradation have significant advantage.
Methane-oxidizing bacteria (Methanotrophs) degradating chloro hydrocarbon belongs to the study hotspot in the field.In methane-oxidizing bacteria The methane monooxygenase contained can be by epoxidised approach degradating chloro hydrocarbon, but because methane-oxidizing bacteria must pass through addition The form of the Co metabolism of carbon source realizes the degraded of chlorohydrocarbon, and this limits chlorohydrocarbon aerobic oxidation in engineering to a certain extent Application.
The content of the invention
It is an object of the invention to provide a kind of Methylobacterium of degradable chlorohydrocarbon, the bacterium can degradating chloro alkane and/ Or chloroalkene, the fields such as waste water, drinking water and soil remediation are can be applied to, especially suitable for chloroalkene pollutant in waste water Degraded and geobiont modification, have the meaning being widely popularized.
The technical scheme is that：
The Methylobacterium of degradable chlorohydrocarbon, its preserving number are CCTCC NO:M 2015046 is (on January 18th, 2015 It is preserved in China typical culture collection center, address：Wuchang, wuhan Luo Jia Shan Wuhan University collection), Classification And Nomenclature For：Methylobacterium sp.R1, its 16S rDNA sequence such as SEQ ID NO:Shown in 1.
The Methylobacterium of degradable chlorohydrocarbon of the present invention, belongs to Methylobacter.Colony diameter 1~2mm, it is semi-transparent Bright, circular regular bacterium colony, low projection, neat in edge is homogeneous, and surface is glossy, and color is in yellow more, is Gram-negative Bacterium, no spore, amphitrichous, moved with the raw polar flagellum in one side, obligate aerobic, optimum growth temp is 28~30 DEG C, and pH is 7.0。
Methylobacterium of the present invention being capable of degradating chloro alkane and/or chloroalkene.Wherein chloroalkene is selected from three At least one of vinyl chloride, dichloroethylene, vinyl chloride, chloralkane is in tetrachloromethane, chloroform and dichloroethanes At least one.
The Methylobacterium of degradable chlorohydrocarbon of the present invention can be applied to the neck such as waste water, drinking water and soil remediation Domain, available for biocatalyst.
The Methylobacterium of degradable chlorohydrocarbon of the present invention, Methylobacterium is named as in the application Methylobacterium sp.R1, it is isolated from household refuse landfill sites coating, bacterial strain DNA sequencing commission Dalian treasured biotech firm completes, and the length of Methylobacterium Methylobacterium sp.R1 16S rDNA bases measure is 1233bp(SEQ ID NO:1), base sequence is compared discovery and Methylobacterium in GenBank GenBanks Methylobacterium sp.SAP462, Methylobacterium sp.XJLW and Methylobacterium Radiotolerans homology highests, reach more than 97%.Pass through a series of Physiology and biochemistries and technique carried out to the bacterial strain Optimum Experiment shows that Methylobacterium Methylobacterium sp.R1 provided by the invention can efficient degradation chloroalkene/chlorine It is as follows for alkane, major advantage：
(1) Methylobacterium Methylobacterium sp.R1 grow by carbon source and the energy of chloroalkene/chloralkane, Methane-oxidizing bacteria is overcome to have to that by the Co metabolism approach of additional carbon chloroalkene/chloralkane degraded could be realized Limitation.
(2) biocatalyst, Liquid Culture are used as by the use of Methylobacterium Methylobacterium sp.R1 intact cell Cell density (bacterium solution absorbance under 600nm) can reach 1.2, and greater activity can be still maintained after departing from environmental system.
(3) bacterium has height endurability to chloroform, can the chloro alkene such as efficient degradation trichloro ethylene, dichloroethylene, vinyl chloride The chloralkane such as hydrocarbon and tetrachloromethane, chloroform, dichloroethanes.
(4) medium component that Methylobacterium Methylobacterium sp.R1 expand needed for culture is simple, and cost is low. Change, can be widely popularized especially suitable for chloroalkene contaminant degradation in waste water and geobiont.
The present invention solves the problems, such as that aerobic biodegradation chlorinated hydrocarbon contaminants can not be engineered in the prior art.
For above and other objects of the present invention, feature and advantage can be become apparent, under especially exemplified by preferred embodiment, and Coordinate accompanying drawing, be described in detail below.
Brief description of the drawings
Fig. 1 is Methylobacterium Methylobacterium sp.R1 stereoscan photograph；
Fig. 2 is Methylobacterium Methylobacterium sp.R1 phylogenetic tree；
Fig. 3 is Methylobacterium Methylobacterium sp.R1 growth curve.
Embodiment
With reference to embodiment, the invention will be further described, but the implementation of the present invention is not limited to this.
1st, experiment material
The composition of the Methylobacterium minimal medium of table 1 is as follows：
Nutriment Mass concentration (mg/L)
KH2PO4 242
NaHPO4.12H2O 167
NH4Cl 25
MgSO4 68
CaCl2 36
FeCl3 0.25
CoCl2.6H2O 1.965
MnSO4.H2O 0.04
ZnSO4.H2O 0.04
Remaining reagent is commercially available analysis net product.
Granulated garbage is selected from household refuse landfill sites coating, and the present embodiment chooses the long-living bridge refuse landfill in Chongqing (weight Qing Shi Nan'an Districts), take 4mm to sieve granulated garbage on lower and 2mm sieves, add a certain amount of chloroform and adjust pH to suitable Methylobacterium Growth, it is closed in methane and air Mixture to tame 2 weeks to realize the rejuvenation of bacterial strain.
2. strain is enriched with and Optimal Experimental
1) enrichment culture：Weigh overburden soil 1g to be put into 100ml minimal mediums, be placed in 27 DEG C, 160 turns/min shaking tables Vibrate 2h.Take bacteria suspension 2ml to be dispensed as seed liquor access in the 100ml serum bottles of 20ml minimal mediums, be capped rubber Plug seals；1ml trichloro ethylene saturated solutions are added, then shaken cultivation 1 week under the conditions of 30 DEG C, 160 turns/min.
2) pure bacterium separation：10 times are carried out to bacterium solution to be serially diluted, dilution factor is made as 10 with the sterile distilled water cooled down-1、10-2Dilution, medium culture is carried out using tilt-pour process, flat board is inverted in vacuum desiccator, and into drier A certain amount of trichloro ethylene is passed through, is then sealed with preservative film, drier is placed in biochemical cultivation case, 30 DEG C of 4~5d of culture, The good strain of growing way is repeatedly passed on, purified.
3) Optimal Experimental：Certain density bacteria suspension is prepared using pure bacterial strain, is added to equipped with a certain amount of inorganic salts culture In the serum bottle of base, the sealing of tool plug, vibrates under the conditions of 30 DEG C, 160 turns/min after the trichloro ethylene that addition concentration is 20mg/L Culture, certain interval of time detection bacterial concentration and trichloro ethylene concentration.
3. strain idenfication is tested
Enter performing PCR amplification purpose fragment using QIAquick Genomic DNA Buffer Set.5 μ l are taken to carry out 3% fine jade Sepharose electrophoresis, DNA sequencing is carried out using gel extraction purpose fragment.DNA sequencing commission Dalian treasured biotech firm completes. DNA sequencing is carried out as primer using Seq Forward, Seq Reverse, Seq Internal.16S rRNA amplifications use wide spectrum (the SEQ ID NO of primers F 27:2-AGAGTTTGATCATGGCTCAG) and R1492 (SEQ ID NO:3- TACGGTTACCTTGTTACGACTT)。
4. detection method
The OD values of bacterium solution are detected using UV2000 spectrophotometers, wavelength 600nm.Viable cell concentrations use flat-plate bacterial colony Counting method determines.Dry cell weight is dried to constant weight by 10ml bacterium solutions at 80 DEG C, is weighed with precision electronic balance.Each experiment At least do 2~3 groups of parallel tests, it is ensured that RSD is less than 5%.
The detection of chlorohydrocarbon uses gas-chromatography (Agilent 6890N).Chromatographic condition：GDX stainless steel columns (10m × 2mm), Injector temperature, column temperature and detector (ECD) temperature are respectively 80,50,120 DEG C, and hydrogen is carrier gas, flow velocity 25ml/ Min, sample size 0.2ml.
The Methylobacterium Methylobacterium sp.R1 of embodiment 1 purifying and identification
The Pseudomonas Gram-negative bacteria, 1~2mm of colony diameter, translucent, circular regular bacterium colony, low projection, edge are whole Together, homogeneous, surface is glossy, and color is in yellow more；Understood by stereoscan photograph (see Fig. 1), Methylobacterium Methylobacterium sp.R1 are in rod-short, 0.6~1um of diameter, 2~4um of length, no spore, atrichia；Obligate need Oxygen, optimum growth temp are 28~30 DEG C, pH 7.0.
Bacterial strain DNA sequencing commission Dalian treasured biotech firm completes, Methylobacterium Methylobacterium sp.R1's The length of 16S rDNA bases measure is 1233bp (SEQ ID NO:1), base sequence enters in GenBank GenBanks Row it was found that with Methylobacterium Methylobacterium sp.SAP462, Methylobacterium sp.XJLW and Methylobacterium radiotolerans homology highests, have reached more than 97%, can be concluded that Methylobacterium Methylobacterium sp.R1 belong to Methylobacter.
From phylogenetic tree (see Fig. 2), in Methylobacterium Methylobacterium sp.R1 and methane-oxidizing bacteria I type bacterium belong to α-Proteobacteria, though Methylobacterium Methylobacterium sp.R1 are Methylobacterium (methyl Bacterium category), but current report is not classified as methane-oxidizing bacteria, and include Methylobacterium in methane-oxidizing bacteria classification Methylobacter sp (are also methyl bacterial category).And from phylogenetic tree it was found from, the affiliation of the two is not Close, Methylobacterium sp. are the G- bacillus for having methylotrophy and methanotrophic characteristic concurrently, it is also possible to glucose or Other complicated nutrients make carbon source and the energy.
The Methylobacterium Methylobacterium sp.R1 of embodiment 2 growth characteristics
The culture medium 100ml that concentration of glucose is 2g/L is configured, is fitted into 500ml serum bottles, and add Methylobacterium bacterium Liquid (OD600nmFor 0.8) 3ml, cover plug and shake up, be put into shaking table and be set in 30 DEG C, cultivate under the conditions of 160 turns/min, periodically survey Determine the OD of bacterium solution600nmValue determines thalli growth situation.The growth curve of Methylobacterium Methylobacterium sp.R1 bacterial strains See Fig. 3.The period of delay of bacterial strain is about 25h.Thalli growth is rapid after logarithmic phase is entered, and OD values rise to 1.2 and only used 15h, The stage of stable development is just reached afterwards, growth curve illustrates that the bacterium can obtain larger cell concentration by culture medium of glucose.
The Methylobacterium Methylobacterium sp.R1 of embodiment 3 test to different chlorohydrocarbon degradation effects
Trichloro ethylene, dichloroethylene, vinyl chloride, tetrachloromethane, chloroform and the dichloro that concentration is 2g/L is respectively configured Ethane solution, and respectively take 100 μ l to be respectively added in the 100ml serum bottles containing 20ml minimal mediums, will be above-mentioned inorganic Salt culture medium high-temp steam sterilizing under the conditions of 121 DEG C, add 1ml Methylobacterium bacterium into bottle with micropipettor after cooling Liquid (OD600nmShaken up 0.8), to cover plug, be put into shaking table and be set in 30 DEG C, cultivate 40h, Ran Houyong under the conditions of 160 turns/min The content of gas Chromatographic Determination chlorohydrocarbon, and its degradation effect is determined, determine the OD of bacterium solution600nmValue determines thalli growth situation. As shown in Table 2, Methylobacterium Methylobacterium sp.R1 can degrade trichloro ethylene, dichloroethylene, chloroethene well This six kinds of chlorohydrocarbons of alkene, tetrachloromethane, chloroform and dichloroethanes, wherein it is best to the degradation effect of trichloro ethylene, reach 88.9%, the degradation effect of dichloroethanes is poor, is 28.7%.In general, Methylobacterium Methylobacterium Sp.R1 is better than chloralkane to the degradation effect of chloroalkene.
Degradation effects of the Methylobacterium sp.R1 of table 2 to chlorohydrocarbon
Methylobacterium Methylobacterium sp.R1 are to the height endurability of chlorohydrocarbon and its drop of uniqueness in the present invention Characteristic is solved, overcomes the deficiency of co -metabolic degradation technique, but also can be grown by sole carbon source and the energy of chlorohydrocarbon, is expected to The biodegradable engineer applied field of chlorohydrocarbon obtains new breakthrough.
Listed above is only the specific embodiment of the present invention.It is clear that the invention is not restricted to above example, may be used also To there is many deformations.All changes that one of ordinary skill in the art directly can export or associate from present disclosure Shape, it is considered as protection scope of the present invention.

Claims (6)

  1. A kind of 1. Methylobacterium R1 of degradable chlorohydrocarbon（Methylobacterium sp.R1）, it is characterised in that its preservation Number it is CCTCC NO:M 2015046, the Methylobacterium R1 belong to Methylobacter.
  2. 2. the Methylobacterium R1 of degradable chlorohydrocarbon according to claim 1, it is characterised in that the Methylobacterium R1's 16S rDNA sequences such as SEQ ID NO:Shown in 1.
  3. 3. the Methylobacterium R1 of the degradable chlorohydrocarbon described in claim 1 is in degradating chloro alkane and/or chloroalkene Using.
  4. 4. application according to claim 3, it is characterised in that the chloralkane is selected from tetrachloromethane, chloroform, two At least one of chloroethanes.
  5. 5. application according to claim 3, it is characterised in that the chloroalkene is selected from trichloro ethylene, dichloroethylene, chlorine At least one of ethene.
  6. 6. applications of the Methylobacterium R1 of the degradable chlorohydrocarbon described in claim 1 in biocatalyst is prepared.
CN201510225653.4A 2015-05-06 2015-05-06 The Methylobacterium of degradable chlorohydrocarbon and its application Expired - Fee Related CN104830727B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510225653.4A CN104830727B (en) 2015-05-06 2015-05-06 The Methylobacterium of degradable chlorohydrocarbon and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510225653.4A CN104830727B (en) 2015-05-06 2015-05-06 The Methylobacterium of degradable chlorohydrocarbon and its application

Publications (2)

Publication Number Publication Date
CN104830727A CN104830727A (en) 2015-08-12
CN104830727B true CN104830727B (en) 2018-03-30

Family

ID=53808929

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510225653.4A Expired - Fee Related CN104830727B (en) 2015-05-06 2015-05-06 The Methylobacterium of degradable chlorohydrocarbon and its application

Country Status (1)

Country Link
CN (1) CN104830727B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115058362B (en) * 2022-06-23 2023-07-14 哈尔滨师范大学 Strain for degrading carbon tetrachloride and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5316940A (en) * 1992-04-24 1994-05-31 Board Of Regents, The University Of Texas System Constitutive soluble methane monooxygenase mutants of methanotrophic bacteria such as Methylosinus trichosporium A.T.C.C. 55314
CN101993839A (en) * 2010-07-23 2011-03-30 浙江工业大学 Methylobacterium rhodesianum H13 capable of efficiently degrading dichloromethane and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5316940A (en) * 1992-04-24 1994-05-31 Board Of Regents, The University Of Texas System Constitutive soluble methane monooxygenase mutants of methanotrophic bacteria such as Methylosinus trichosporium A.T.C.C. 55314
CN101993839A (en) * 2010-07-23 2011-03-30 浙江工业大学 Methylobacterium rhodesianum H13 capable of efficiently degrading dichloromethane and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Dual augmentation for aerobic bioremediation of MTBE and TCE pollution in heavy metal-contaminated soil;V. C. Fernandes et al.;《Biodegradation》;20081106;第20卷;第375-382页 *
Trichloroethylene Biodegradation by a Methane-Oxidizing Bacterium;C. DEANE LITTLE et al.;《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》;19880430;第54卷(第4期);第951-956页 *
二氯甲烷降解菌Methylobacterium rhodesianum H13 的分离鉴定及降解特性研究;刘洪霞等;《环境科学》;20130930;第34卷(第9期);第3613-3619页 *

Also Published As

Publication number Publication date
CN104830727A (en) 2015-08-12

Similar Documents

Publication Publication Date Title
CN107287134B (en) The preparation method and application of one pseudomonas and its bifunctional enzyme preparation
US20160185638A1 (en) Fungi-bacteria composite microecologics and methods for preparing and using the same
CN104928205B (en) One plant of Bacillus strain for being capable of efficient degradation DMP, cultural method and its application in rehabilitating soil PAEs pollutions
CN103224896B (en) Facultative methanotroph capable of degrading chlorohydrocarbons, and its applications
CN110643534B (en) Phellinus deltoidea capable of degrading triphenyl phosphate
Akcay et al. Isolation, characterization and molecular identification of a halotolerant Bacillus megaterium CTBmeg1 able to grow on halogenated compounds
Rodrigues et al. Diversity of hydrocarbon‐degrading Klebsiella strains isolated from hydrocarbon‐contaminated estuaries
CN102776125A (en) Construction method of moderate halophilic bacteria consortium capable of degrading high-salinity benzene series and application of moderate halophilic bacteria consortium
Al-Dossary et al. Biodegradation of crude oil using Aspergillus species
CN104946556B (en) A kind of arthrobacter bacteria and its application
CN104830725B (en) The greedy copper bacterium of degradable chloroalkene and its application
CN110283741A (en) One plant of rose bacillus and its application with efficient degradation polycyclic aromatic hydrocarbon function
CN110804567B (en) Serratia marcescens capable of degrading chlorobenzene and application thereof
CN104805036B (en) Application of microbacterium (Microbacterium sp.) J-1 in a variety of phthalic acid esters of degrading
CN104805033B (en) The microbacterium of one plant of degradable a variety of phthalic acid ester（Microbacterium sp.）J-1
CN105199981B (en) Eat alkali Gordonia bronchialis YC-RL2 and its application
CN102071160B (en) Microbacterium capable of utilizing methane and applications thereof
CN104830727B (en) The Methylobacterium of degradable chlorohydrocarbon and its application
CN106434413B (en) One kind is planted raw Raoul bacterium and the method using pyrene in bacterium degradation soil
CN104845890B (en) Applications of earth mould (Agromyces sp.) the MT E in a variety of phthalic acid esters of degrading
CN107164277A (en) A kind of Halomonas of degradation of phenol
CN104805018B (en) Earth mould (Agromyces sp.) MT E of one plant of a variety of phthalic acid ester that can degrade simultaneously
CN104830726B (en) Degradating chloro hydrocarbon composite bacteria agent and its application
CN104805037B (en) Achromobacter (Achromobacter sp.) MT H of one plant of degraded diisooctyl phthalate
CN107586751A (en) One plant of dioxanes degradation bacteria D2 and its application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20180330

Termination date: 20190506

CF01 Termination of patent right due to non-payment of annual fee