CN104826131A - Use of miR-17-92 gene cluster in preparation of medicines for treating mental diseases - Google Patents
Use of miR-17-92 gene cluster in preparation of medicines for treating mental diseases Download PDFInfo
- Publication number
- CN104826131A CN104826131A CN201510179139.1A CN201510179139A CN104826131A CN 104826131 A CN104826131 A CN 104826131A CN 201510179139 A CN201510179139 A CN 201510179139A CN 104826131 A CN104826131 A CN 104826131A
- Authority
- CN
- China
- Prior art keywords
- mir
- gene cluster
- anxiety
- purposes
- mental disorder
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a use of miR-17-92 gene cluster in the preparation of medicines for treating mental diseases. The use is of real significance to basic researches and further clinic application, and new protein encoding genes and untranslated miRNAs having a response effect to antidepressants are detected through the miR-17-92 gene; related research visual field is developed to lay a good foundation for development of new antidepressants; and new anti-depression targets can be developed, miRNA is a micro-molecule, can be extremely easily synthesized in vitro and can be introduced into cells, so the control of the expression level of the miRNA in vivo becomes possible.
Description
Technical field
The present invention relates to technical field of pharmaceuticals, be specifically related to the purposes of a kind of miR-17-92 gene cluster in preparation treatment mental disorder medicine.
Background technology
Due to heredity, the fast pace of environment and the modern life and pressure, emotionality associated conditions (mood disorders) is appeared suddenly all the more.In China, the sickness rate of depression is 3%-5%, and patients with depression estimates at 3,000 ten thousand people.The only investigation display of several province such as Hebei, Zhejiang, the prevalence of anxiety neurosis is at 5%-7%.But due to low at Chinese patients consultation rate, the number of anxiety and depression patient may be higher than what add up.In U.S.'s impact of anxiety disorder that has 4,000 ten thousand adults to be subject to every year.Patient the experience fear brought of long-term anxiety and helpless after, probably produce serious losing one's temper, such as suicidal tendency.Countries in the world take a large amount of expenditure on anxiety and depression patient, become a large financial burden of society.
Anxiety and depression have a large amount of disease symptoms (comorbidity) altogether clinically.Taking antidepressant drug is a kind of effectively treatment means.Tricyclic antidepressant imipramine (imipramine) and selectivity five hydroxytryptamine reuptake inhibitor (selective serotonin re-uptake inhibitors, SSRI) fluoxetine (fluoxetine), two classes are used for the treatment of the medicine of depression or anxiety exactly.But antidepressant drug is ineffective to all patients.The pathomechanism of these mental maladjustment diseases, and the molecule mechanism of antidepressant drug action target spot still fails to understand dawn.Therefore, carry out the research of Anxiety And Depression Symptoms molecule mechanism, and develop the depressed medicine of brand-new anxiety and treatment means, it is heavy to be that this research field works instantly.
The discovery of micro rna (microRNA, miRNA), makes the level that people are able to from gene regulation, by new angle research brain development and ripe mechanism.MiRNA is the endogenous non-coding tiny RNA that a class is made up of 22 nucleotide.By the enzyme action effect of RNAase III-Dicer, miRNA precursor is processed into ripe miRNAs.Ripe miRNA can identify his target messenger RNA (messenger RNA, mRNA), and is attached to the 3 ' noncoding region (3 ' untranslated region, 3 ' UTR) of target messenger RNA.Thus reduce this mRNA stability, or block the translation of mRNA.It is found that in some anxious patients's brains, miRNA expression Fang Sheng changes, but specifically which miRNA works in anxiety and depression disease, and react to antidepressant drug, we still do not know.
Summary of the invention
The object of the invention is to overcome the deficiencies in the prior art, provide a kind of micro rna miR-17-92 as the new target drone of anxiety and depression disease Treatment and diagnosis.Present inventor, through research, confirms that a micro rna-miR-17-92 reacts to antidepressant drug, and can as the new target drone of anxiety and depression disease Treatment and diagnosis.The major gene RNA sequence that miR-17-92 gene family comprises is: miR-17, caaagugcuuacagugcagguag; MiR-19, ugugcaaaucuaugcaaaacuga; MiR-92, agguugggauuugucgcaaugcu.
The present invention is realized by following technical scheme, the present invention relates to the purposes of a kind of miR-17-92 gene cluster in preparation treatment mental disorder medicine.
Preferably, described mental disorder is depressive and anxiety neurosis.
Preferably, described miR-17-92 gene cluster comprises one or more in following combination: miR-17, miR-19, miR-92.
Preferably, the sequence of described miR-17 is caaagugcuuacagugcagguag.
Preferably, the sequence of described miR-19 is ugugcaaaucuaugcaaaacug.
Preferably, the sequence of described miR-92 is agguugggauuugucgcaaugcu.
Preferably, described application is specially: the expression promoting miR-17-92 gene cluster, and then promotes antidepressant ability.
Preferably, described application is specially: the expression promoting miR-17-92 gene cluster, and then promotes anxiety ability.
Preferably, described application is specially: the expression promoting miR-17-92 gene cluster, and then promotes anxiety and antidepressant ability simultaneously.
Preferably, described application is specially: described miR-17-92 gene cluster as preparation diagnosis depression or diagnosis anxiety neurosis, or diagnoses the application in the target agent of depression and anxiety neurosis simultaneously.
Compared with prior art, the present invention has following beneficial effect: because depressed and anxiety disorder have a lot of disease altogether, clinical conventional antidepressant therapy treats anxiety.But it is invalid that existing clinical drug still treats some patients.Especially antidepressants and its action target are in the acknowledgement mechanism of molecular level, still rarely known by the people.Anxiety and depression symptom, brings huge stress and Somatic discomfort to patient.Anxiety patient more than 25%, all cannot be cured all the life.The present invention has realistic meaning for basic research and further clinical practice.By miR-17-92, researcher can detect the new protein coding gene and the non-coding miRNAs that antidepressants are had to response effect; The research vision that expansion is correlated with by the present invention, for development of new antidepressant drug in future is laid a solid foundation.Further, the present invention is by the new anti depressant therapy target spot of developing, and because miRNA is micromolecule, in very easily external synthesis and transfered cell, in manipulator, miRNA expression more and more becomes possibility.Therefore, miRNA day by day becomes the gene therapy new tool of human neurologic disease.With miRNA as antidepressant new therapeutic targets antianxity, also have a bright future.
Accompanying drawing explanation
By reading the detailed description done non-limiting example with reference to the following drawings, other features, objects and advantages of the present invention will become more obvious:
Fig. 1. in the anxiety test of pressure inducement, pressure impels miR-17-92 expression to reduce.On the contrary, after mice takes antidepressants, the expression of miR-17-92 is gone up.
Fig. 2. in Morris water maze laboratory, compare wild type (wild-type, WT), miR-17-92 conditionality knock-out mice (KO) does not show the learning and memory hypofunction of significance.
Fig. 3. in spacious field experiment (open field), as compared to wild type (wild-type, WT) mice, miR-17-92 conditionality knocks out Mus (KO) has the anxiety of significance to be inclined to; N>10, * *: p<0.01.
Detailed description of the invention
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The test method of unreceipted actual conditions in the following example, usual conveniently condition, such as Pehanorm Brooker equimolecular clone: the condition described in the laboratory manual third edition (Science Press, 2002), or according to the condition that each manufacturer advises.
Embodiment 1
The research delivered is pointed out, chronic stress can bring out mice and produce anxiety neurosis.Whether first applicant demonstrates the anxiety that pressure causes relevant with miR-17-92 expression in the brain.C57/BL6 mice in the tenth week age was placed in small space after two weeks, induce the anxiety of mice.Applicant is extracted the RNA in cerebral hippocampus district, finds that the expression of miR-17-92 significantly reduces (Fig. 1).This anxiety illustrating that pressure causes can reduce the expression of miR-17-92.Further, selectivity five hydroxytryptamine reuptake inhibitor (selective serotonin re-uptake inhibitors, SSRI) fluoxetine (fluoxetine) is antidepressants conventional at present.Applicant, while granting pressure to the mice in the tenth week age, has fed fluoxetine.Applicant finds that the use of antidepressants can make the expression of mouse brain hippocampus miR-17-92 significantly go up (Fig. 1).This illustrates that miR-17-92 works to antidepressants.
Embodiment 2
In order to study the concrete function of miR-17-92, applicant has bred miR-17-92 conditionality knock-out mice (knockout, KO).At Nestin-CreER
tmthe miR-17-92 transgenic mice post-coitum of mice and floxed, only under injection tamoxifen (Tamoxifen) condition, could induce Cre active, to knock out the expression of miR-17-92 at adult brain hippocampus.This conditionality knock-out mice, is called miR-17-92KO.When the 5th week age of mice, Tamoxifen was injected in continuous 5 days to it, to activate Cre activity, has knocked out the expression of miR-17-92.When the 9th week age of mice, applicant utilizes classical Morris water maze laboratory, detects the ability of learning and memory situation of this mice.Mice is placed in the circular water maze of a diameter 1 meter.A under cover platform in water maze, is found the time of platform, can infer the ability of mice learning and memory by test mice.Applicant finds that miR-17-92 conditionality knocks out the learning and memory hypofunction (Fig. 2) that Mus does not show significance in an experiment.Our result shows, miR-17-92 gene knockout, does not affect the normal learning and memory function of mice.
Embodiment 3
It is shocking, applicant finds, knocks out miR-17-92 gene and causes mice to produce similar anxiety neurosis and depressed behavior (Fig. 3).In spacious field experiment (open field), mice is placed in the open space of 50cm X 50cm.Compare due to mice and fear cruelly to leak under open space and illumination, mice is anxiety, will more hide open space and illumination.Therefore, the time that we can be stopped at open space by test mice, the distance of creeping, judges the anxiety degree of mice.The result display of applicant, miR-17-92 knock-out mice seldom rests on Kuang Chang center, and reduction miR-17-92 expression is in the brain described, the anxiety symptom (Fig. 3) causing mice to present increasing.This illustrates that miR-17-92 can as the new pathological marker thing of anxiety and depression disease.
In sum, because depressed and anxiety disorder have a lot of disease altogether, clinical conventional antidepressant therapy treats anxiety.But it is invalid that existing clinical drug still treats some patients.Especially antidepressants and its action target are in the acknowledgement mechanism of molecular level, still rarely known by the people.Anxiety and depression symptom, brings huge stress and Somatic discomfort to patient.Anxiety patient more than 25%, all cannot be cured all the life.The present invention has realistic meaning for basic research and further clinical practice.By miR-17-92, researcher can detect the new protein coding gene and the non-coding miRNAs that antidepressants are had to response effect.This will expand research vision, for development of new antidepressant drug in future is laid a solid foundation.Further, this patent is by the new anti depressant therapy target spot of developing, and because miRNA is micromolecule, in very easily external synthesis and transfered cell, in manipulator, miRNA expression more and more becomes possibility.Therefore, miRNA day by day becomes the gene therapy new tool of human neurologic disease.With miRNA as antidepressant new therapeutic targets antianxity, also have a bright future.
Above specific embodiments of the invention are described.It is to be appreciated that the present invention is not limited to above-mentioned particular implementation, those skilled in the art can make various distortion or amendment within the scope of the claims, and this does not affect flesh and blood of the present invention.
Claims (10)
1. the purposes of a miR-17-92 gene cluster in preparation treatment mental disorder medicine.
2. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, and it is characterized in that, described mental disorder is depressive and anxiety neurosis.
3. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, and it is characterized in that, described miR-17-92 gene cluster comprises one or more in following combination: miR-17, miR-19, miR-92.
4. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, and it is characterized in that, the sequence of described miR-17 is caaagugcuuacagugcagguag.
5. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, and it is characterized in that, the sequence of described miR-19 is ugugcaaaucuaugcaaaacug.
6. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, and it is characterized in that, the sequence of described miR-92 is agguugggauuugucgcaaugcu.
7. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, and it is characterized in that, described application is specially: the expression promoting miR-17-92 gene cluster, and then promotes antidepressant ability.
8. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, and it is characterized in that, described application is specially: the expression promoting miR-17-92 gene cluster, and then promotes anxiety ability.
9. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, and it is characterized in that, described application is specially: the expression promoting miR-17-92 gene cluster, and then promotes anxiety and antidepressant ability simultaneously.
10. miR-17-92 gene cluster treats the purposes in mental disorder medicine in preparation according to claim 1, it is characterized in that, described application is specially: described miR-17-92 gene cluster as preparation diagnosis depression or diagnosis anxiety neurosis, or diagnoses the application in the target agent of depression and anxiety neurosis simultaneously.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510179139.1A CN104826131B (en) | 2015-04-15 | 2015-04-15 | Purposes of the miR-17-92 gene cluster in preparation treatment mental disorder drug |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510179139.1A CN104826131B (en) | 2015-04-15 | 2015-04-15 | Purposes of the miR-17-92 gene cluster in preparation treatment mental disorder drug |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104826131A true CN104826131A (en) | 2015-08-12 |
| CN104826131B CN104826131B (en) | 2018-12-18 |
Family
ID=53804567
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510179139.1A Active CN104826131B (en) | 2015-04-15 | 2015-04-15 | Purposes of the miR-17-92 gene cluster in preparation treatment mental disorder drug |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104826131B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317709A (en) * | 2020-12-03 | 2022-04-12 | 南京大学 | Application of miRNA in sperms in preparation of depression detection products and anti-depression drugs |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009004632A2 (en) * | 2007-07-05 | 2009-01-08 | Yeda Research And Development Co. Ltd. | Methods of identifying components of a biological pathway and use of said components in regulating diseases associated with altered cell proliferation |
| CN104011210A (en) * | 2011-10-11 | 2014-08-27 | 布里格姆及妇女医院股份有限公司 | Micrornas in neurodegenerative disorders |
| CN104039960A (en) * | 2011-08-04 | 2014-09-10 | 耶达研究及发展有限公司 | Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions |
-
2015
- 2015-04-15 CN CN201510179139.1A patent/CN104826131B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009004632A2 (en) * | 2007-07-05 | 2009-01-08 | Yeda Research And Development Co. Ltd. | Methods of identifying components of a biological pathway and use of said components in regulating diseases associated with altered cell proliferation |
| CN104039960A (en) * | 2011-08-04 | 2014-09-10 | 耶达研究及发展有限公司 | Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions |
| CN104011210A (en) * | 2011-10-11 | 2014-08-27 | 布里格姆及妇女医院股份有限公司 | Micrornas in neurodegenerative disorders |
Non-Patent Citations (2)
| Title |
|---|
| DIANA O PERKINS ET AL.: "microRNA expression in the prefrontal cortex of individuals with schizophrenia and schizoaffective disorder", 《GENOME BIOLOGY》 * |
| JENNY WONG ET AL.: "Expression of NPAS3 in the human cortex and evidence of its posttranscriptional regulation by miR-17 during development, with implications for schizophrenia", 《SCHIZOPHRENIA BULLETIN》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317709A (en) * | 2020-12-03 | 2022-04-12 | 南京大学 | Application of miRNA in sperms in preparation of depression detection products and anti-depression drugs |
| CN114317709B (en) * | 2020-12-03 | 2024-04-05 | 南京大学 | Application of miRNA in sperms in preparation of depression detection products and antidepressant drugs |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104826131B (en) | 2018-12-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hsiao et al. | Upregulation of haploinsufficient gene expression in the brain by targeting a long non-coding RNA improves seizure phenotype in a model of Dravet syndrome | |
| Song et al. | CSF miR-16 is decreased in major depression patients and its neutralization in rats induces depression-like behaviors via a serotonin transmitter system | |
| Roy et al. | Identification of microRNA-124-3p as a putative epigenetic signature of major depressive disorder | |
| Huang et al. | MicroRNA-374a protects against myocardial ischemia-reperfusion injury in mice by targeting the MAPK6 pathway | |
| Vialou et al. | Epigenetic mechanisms of depression and antidepressant action | |
| Sadee et al. | Missing heritability of common diseases and treatments outside the protein-coding exome | |
| Murphy et al. | MicroRNA-mediated rescue of fear extinction memory by miR-144-3p in extinction-impaired mice | |
| Hansen et al. | MicroRNA as therapeutic targets for treatment of depression | |
| Gong et al. | Altered microRNAs expression profiling in mice with diabetic neuropathic pain | |
| Stark et al. | Altered dopamine D3 receptor gene expression in MAM model of schizophrenia is reversed by peripubertal cannabidiol treatment | |
| Wu et al. | microRNA‐9‐5p alleviates blood–brain barrier damage and neuroinflammation after traumatic brain injury | |
| NZ704322A (en) | Mirna and its diagnostic and therapeutic uses in diseases or conditions associated with melanoma, or in diseases or conditions associated with activated braf pathway | |
| Lopizzo et al. | miRNAs in depression vulnerability and resilience: novel targets for preventive strategies | |
| Scott et al. | Thinking small: towards microRNA-based therapeutics for anxiety disorders | |
| WO2018152937A1 (en) | Use of pdcd4 as therapetutic target of antidepresant and/or antianxiety medicament | |
| Yu et al. | MicroRNA-572 improves early post-operative cognitive dysfunction by down-regulating neural cell adhesion molecule 1 | |
| Zhang et al. | Downregulation of MicroRNA 29a/b exacerbated diabetic retinopathy by impairing the function of Müller cells via Forkhead box protein O4 | |
| Blokhin et al. | Molecular mechanisms of psychiatric diseases | |
| Erhardt et al. | Translational approaches to anxiety: focus on genetics, fear extinction and brain imaging | |
| Pang et al. | Fastigial nucleus stimulation regulates neuroprotection via induction of a novel micro RNA, rno‐miR‐676‐1, in middle cerebral artery occlusion rats | |
| Yuan et al. | Epigenetic regulation in major depression and other stress-related disorders: molecular mechanisms, clinical relevance and therapeutic potential | |
| McNicholas et al. | A compendium of syngeneic, transplantable pediatric high-grade glioma models reveals subtype-specific therapeutic vulnerabilities | |
| Si et al. | Neuroprotective effect of miR-212-5p on isoflurane-induced cognitive dysfunction by inhibiting neuroinflammation | |
| Bowling et al. | Unlocking the molecular mechanisms of antipsychotics–a new frontier for discovery | |
| CN104826131A (en) | Use of miR-17-92 gene cluster in preparation of medicines for treating mental diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20151118 Address after: 201108, D32 building, building 3, building 4299, 6 Jin Du Road, Shanghai, Minhang District Applicant after: Tao Kang Biotechnology (Shanghai) Co., Ltd. Address before: 200240 No. 58, 10 Pujiang Road, Shanghai, Minhang District 410 Applicant before: Wang Jiayin |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20190404 Address after: 361021 Innovation Building, 1300 Jimei Avenue, Jimei District, Xiamen City, Fujian Province, 17 stories Patentee after: Taoyu Neurological Medical Research Institute (Xiamen) Co., Ltd. Address before: Room D32, Building 6, Building 3, 4299 Jindu Road, Minhang District, Shanghai 201108 Patentee before: Tao Kang Biotechnology (Shanghai) Co., Ltd. |