CN114317709A

CN114317709A - Application of miRNA in sperms in preparation of depression detection products and anti-depression drugs

Info

Publication number: CN114317709A
Application number: CN202111466702.5A
Authority: CN
Inventors: 陈熹; 朱景宁; 张辰宇; 王延博; 陈张朋; 胡欢欢
Original assignee: Nanjing University
Current assignee: Nanjing University
Priority date: 2020-12-03
Filing date: 2021-12-03
Publication date: 2022-04-12
Anticipated expiration: 2041-12-03
Also published as: CN114317709B

Abstract

The application provides an application of miRNA in sperms in preparation of depression detection products and anti-depression drugs. A large number of researches prove that depression-like phenotype caused by father pressure can be inherited by offspring through the causal action of miRNA in sperms, a new inheritance mode of depression is disclosed, the method has important significance for comprehensively explaining the molecular mechanism of depression occurrence, and a new visual angle is provided for researching the inheritance rule of mental diseases. The miRNA in the sperms is innovatively applied to depression detection products and antidepressant drugs, and the depression is detected and treated based on the specific miRNA in the sperms, so that the depression detection accuracy and the treatment effect of the antidepressant drugs can be effectively improved.

Description

Application of miRNA in sperms in preparation of depression detection products and anti-depression drugs

Technical Field

The application relates to the technical field of biomedicine, in particular to application of miRNA in sperms in preparation of depression detection products and anti-depression drugs.

Background

Depression, also known as depressive disorder, is one of the most common and disabling mental diseases in the world, is characterized clinically by a marked and persistent mood drop, and is the major type of mood disorder. At present, depression patients worldwide are as many as 1.2-2.0 hundred million, and the causes of depression are still riddle after decades of research. Current opinion as to the cause of depression is the result of genetic and environmental co-action.

Existing studies have demonstrated that the environment affects genetics, e.g., children born and growing under a bust are more susceptible to obesity, and drinking from the father may cause the fetus to develop symptoms of alcohol syndrome, etc. However, our understanding of the genetic risk of depression remains a great gap compared to known environmental factors. The real 'depression gene' is the warrior who causes depression, and can be used for establishing a disease model on a rodent or used as a potential treatment target, but the 'depression gene' is not identified by means of gene analysis and the like at present.

Epigenetic (epigenetics) is the heritable change in gene function without a change in the DNA sequence of the gene, which ultimately results in a phenotypic change. Epigenetic characteristics, such as DNA methylation, histone modifications, and non-coding RNAs, can be transmitted to the next generation through the germline, thereby inducing a phenotype associated with the parental environment. However, the function, mechanism and scope of germline epigenetics remains unclear, particularly in terms of paternal transfer, as it has been thought that sperm merely transfer paternal DNA to oocytes.

Family studies show that the prevalence rate of the first-class relatives of depression is about 15%, and the risk of the offspring suffering from depression is obviously increased when the father is a depressed patient. Thus, sperm RNA has recently become increasingly recognized as another source of paternal genetic information beyond DNA. A range of different RNAs present in sperm can enter the oocyte at fertilization, including micrornas (mirnas), tRNA derived small RNAs (tsrnas), and long RNAs (mRNAs and long non-coding RNAs). The inherited miRNAs were found to be involved in embryonic development, transmission of variant and parental phenotypes of KIT genes to offspring, while tsRNAs and long RNAs were involved in interpersonal inheritance of diet-induced metabolic disorders and traumatic symptoms, respectively. Despite these pioneering studies, the exact mechanism by which sperm RNA remodels progeny development to replicate the paternal acquired phenotype remains a mystery. In particular, although the traumatic experience and stress of the father may adversely affect the offspring through sperm RNA, it is not clear whether the pathological symptoms of depression can be transmitted to the next generation by sperm RNA-mediated interspecies inheritance. Therefore, what role sperm miRNA plays in depression heredity specifically and whether sperm miRNA can be used for detecting, treating depression and blocking the surrogate genetics of depression become the problems to be solved urgently.

Disclosure of Invention

In view of this, the application provides an application of miRNA in sperm in the preparation of depression detection products and anti-depression drugs, so as to solve the problems in the background art.

The application provides an application of miRNA in sperms in preparation of depression detection products.

Further, the miRNA in the sperm is a base fragment with the length of 5-200 bp.

Further, the miRNA includes: at least one of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p, miR-199a-3p, miR-126a-3p, miR-191-5p and miR-184-3 p.

Further, the miRNA is a combination of at least 8 of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3 p. For example, the miRNA is a combination of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3 p.

Further, the depression detection product comprises a chip or a kit; the chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe comprises a part or all of a sequence specifically corresponding to the miRNA; the kit comprises a reagent for detecting the expression level of the miRNA, wherein the reagent comprises a primer and/or a probe aiming at the miRNA.

Furthermore, the detection product takes the content of miRNA in the sperm as a detection index, and when the content of miRNA is higher than the normal level of the same species, the risk is prompted.

Further, the normal level higher than that of the same kind of substances is higher than 2 times and more.

The application also provides an application of the miRNA in the sperms in preparation of antidepressant drugs.

Further, the antidepressant drug comprises an inhibitor of the miRNA.

Further, the inhibitor of miRNA includes: and the inhibitor of at least one miRNA in miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p, miR-199a-3p, miR-126a-3p, miR-191-5p and miR-184-3 p.

Further, the miRNA inhibitor is a combination of at least 8 of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3p inhibitors. For example, the inhibitor of miRNA is the combination of inhibitors of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3 p.

Further, the inhibitor includes a reverse complement of the corresponding miRNA or an inhibitor that inhibits replication or expression of the corresponding miRNA.

Further, the miRNA inhibitor is combined with other agents for inhibiting the miRNA expression or weakening the miRNA function in the preparation of antidepressant drugs.

A large number of researches prove that depression-like phenotype caused by father pressure can be inherited by offspring through the causal effect of miRNA in sperms, namely, sperm sRNA abnormality and embryo sRNA abnormality can be caused by father depression, DNA methylation is further inhibited, embryo dysplasia is caused, and offspring depression is easy to be caused.

The miRNA in the sperms is innovatively applied to depression detection products and antidepressant drugs, depression is detected and treated based on the specific miRNA in the sperms, the depression detection products can effectively improve the depression detection accuracy, the detection efficiency is high, the antidepressant drugs can improve the depression treatment effect, can effectively inhibit the surrogate genetics of the depression, and are easy to popularize and use on a large scale.

Drawings

FIG. 1 is a graph comparing the results of F0 generation and F1 generation tests of control group mice and CMS-induced experimental group mice in an example of the present application;

FIG. 2 is a graph showing the comparison of F0 generation and F1 generation of control group mice and CMS-induced test group mice in an example of the present application;

FIG. 3 is a schematic diagram of a strategy for a mouse culture method according to an embodiment of the present application;

FIG. 4 is a graph comparing the behavior of F0 generation and F1 generation in control group mice and CRS-induced experimental group mice in an example of the present application;

FIG. 5 is a graph comparing F0, F1 PVN, hippocampus and mPF neurons in CMS-induced experimental groups of mice in an example of the present application;

FIG. 6 is a graph showing the correlation between neuron activation and synaptic transmission at generations F0 and F1 in control mice and CMS-induced test mice according to an embodiment of the present application;

FIG. 7 is a graph comparing F2 generation performance of CMS-induced mice in experimental groups according to an example of the present application;

FIG. 8 is a graph comparing the behavior of mouse zygotes injected with sperm RNA for in vitro fertilization of offspring in one embodiment of the present application;

FIG. 9 is a graph comparing neuronal activation of in vitro fertilized offspring of mouse zygotes injected with sperm sRNA according to one embodiment of the present application;

FIG. 10 is a graph of a test of mouse sperm sRNA versus paternal transmission of depression in an embodiment of the present application;

FIG. 11 is a graph comparing the behavior of in vitro fertilized offspring of mouse zygotes injected with IRNA in one embodiment of the present application;

FIG. 12 is a schematic representation of the IVF progeny gene alteration following injection of synthetic miRNAs into a mouse zygote according to one embodiment of the present application;

FIG. 13 is a graph comparing the imbalance of miRNA with the behavior and neuron activation of male mice of generation F0 and mice of generation F1 in a depression-like model according to one embodiment of the present application;

FIG. 14 is a graph comparing the performance and neuronal activity of fertilized in vitro offspring injected with sperm RNA plus miRNA antisense strand from fertilized eggs according to one embodiment of the present application;

FIG. 15 is a graph of the relationship between the regulation of miRNA imbalance in fertilized eggs and depression-like model male mice generation F0 and mice generation F1 in one example of the present application;

FIG. 16 is a graph demonstrating direct regulation of depression-associated genes by miRNAs in an example of the present application;

FIG. 17 is a graph showing the specificity and validity of quantitative RT-PCR detection of piRNAs and tsRNAs in sperm in one example of the present application;

FIG. 18 is a graph showing the results of Western blotting of GluA1, GluA2, GluN2A, GluN2B, CamkII, and β -actin in an example of the present application;

FIG. 19 is a graph of the transcriptional cascade changes induced by sperm miRNA early in embryonic development in a depression model mouse according to an embodiment of the present application;

FIG. 20 is a graph of the change in non-coding miRNA in sperm of a depressed mouse according to one embodiment of the present application;

FIG. 21 shows the weight and behavior of offspring mice obtained by microinjection of sperm total RNA and miRNA antisense-embryo transplantation in one embodiment of the present application;

FIG. 22 shows the results of the immunofluorescence histochemical assay and whole cell patch clamp assay of mouse offspring obtained by microinjection of total RNA and miRNA antisense in one embodiment of the present application;

FIG. 23 shows the body weight and behavioral measurements of offspring mice obtained from miRNA mimics microinjection-embryo transfer in one embodiment of the present application.

Detailed Description

The following description of specific embodiments of the present application refers to the accompanying drawings.

In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. Also, the reagents, materials and procedures used herein are those that are widely used in the corresponding fields. Meanwhile, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

In the present application, mirna (microrna) is an endogenous small RNA of about 20-24 nucleotides in length, which has a number of important regulatory roles within the cell.

Example 1

The embodiment provides an application of miRNA in sperms in preparation of depression detection products.

Preferably, the miRNA in the sperm is a stretch of bases between 5 and 200bp in length, preferably between 10 and 70 bp.

In particular, the miRNA may include: at least one of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3 p.

The nucleotide sequence of miR-146a-5p is as follows: UGAGAACUGAAUUCCAUGGGUU

The nucleotide sequence of the miR-27b-3p is as follows: UUCACAGUGGCUAAGUUCUGC

The nucleotide sequence of the miR-30a-5p is as follows: UGUAAACAUCCUCGACUGGAAG

The nucleotide sequence of miR-152-3p is as follows: UCAGUGCAUGACAGAACUUGG

The nucleotide sequence of miR-1839-5p is as follows: AAGGUAGAUAGAACAGGUCUUG

The nucleotide sequence of the miR-143-3p is as follows: UGAGAUGAAGCACUGUAGCUC

The nucleotide sequence of the miR-9-5p is as follows: UCUUUGGUUAUCUAGCUGUAUGA

The nucleotide sequence of let-7g-5p is: UGAGGUAGUAGUUUGUACAGUU

The nucleotide sequence of miR-200a-3p is as follows: UAACACUGUCUGGUAACGAUGU

The nucleotide sequence of miR-200c-3p is as follows: UAAUACUGCCGGGUAAUGAUGGA

The nucleotide sequence of miR-30c-5p is as follows: UGUAAACAUCCUACACUCUCAGC

The nucleotide sequence of the miR-26b-5p is as follows: UUCAAGUAAUUCAGGAUAGGU

The nucleotide sequence of miR-103-3p is as follows: AGCAGCAUUGUACAGGGCUAUGA

The nucleotide sequence of the miR-29a-3p is as follows: UAGCACCAUCUGAAAUCGGUUA

The nucleotide sequence of miR-101a-3p is as follows: UACAGUACUGUGAUAACUGAA

The nucleotide sequence of miR-199a-3p is as follows: ACAGUAGUCUGCACAUUGGUUA

Preferably, the miRNAs are a combination of at least 8 of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p, miR-199a-3p, miR-126a-3p, miR-191-5p and miR-184-3p, such as 8, 9, 10, 11 of these miRNAs, 12 types, 13 types, 14 types, 15 types and 16 types. For example, the miRNA is a combination of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3 p.

Preferably, the detection product takes the content of miRNA in sperm as a detection index, and when the content of miRNA is higher than the normal level of the same species, the risk is indicated. More preferably, the above normal level is 2 times or more higher than the same species.

Each miRNA of the present embodiment may be at least one of its primary miRNA, precursor miRNA, and mature miRNA, and both the primary miRNA and the precursor miRNA can be cleaved and expressed into mature miRNA in human cells.

Each miRNA of the present embodiments may also comprise a variant thereof, i.e. a functional equivalent of a constitutive nucleic acid molecule, which variant is capable of exhibiting the same function as the miRNA nucleic acid molecule and may be mutated by deletion, substitution or insertion of nucleotide residues.

In addition, on the premise of not influencing the functions of the miRNA, protective bases can be added at one end or two ends of the miRNA, or the miRNA is subjected to base modification, so that the stability of the miRNA is ensured.

The depression detection product comprises a chip or a kit; the chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe comprises a part or all of a sequence specifically corresponding to the miRNA; the kit comprises a reagent for detecting the expression level of the miRNA, wherein the reagent comprises a primer and/or a probe aiming at the miRNA.

The miRNA in the sperms is innovatively applied to the depression detection product, depression is detected based on the specific miRNA in the sperms, and the depression detection accuracy can be effectively improved.

Example 2

On the basis of example 1, this example provides a depression detection product.

The depression detection product comprises miRNA as described in example 1.

The depression detection product can be a chip or a kit; the chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe comprises a part or all of a sequence specifically corresponding to the miRNA; the kit comprises a reagent for detecting the expression level of the miRNA, wherein the reagent comprises a primer and/or a probe aiming at the miRNA.

The oligonucleotide probes may also include existing miRNA oligonucleotide probes capable of diagnosing depression or depressive disorders. In practical application, the detection probes for one, two or more miRNAs can be placed on the same chip for detection.

The reagent may also comprise existing miRNA primers and/or probes capable of diagnosing depression or depression tendency. In practical application, the detection primers and/or probes for one, two or more miRNAs can be placed in the same kit for detection.

The depression detection product provided by the embodiment develops a new depression detection angle from the genetic mechanism of depression, and has high detection efficiency and high accuracy.

Example 3

The embodiment provides application of miRNA in sperms in preparation of antidepressant drugs. The antidepressant drug comprises an inhibitor of the miRNA.

Specifically, the inhibitor of miRNA includes: inhibitors of at least one miRNA selected from miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3 p. The sequences of these mirnas are shown in example 1.

Preferably, the inhibitor of miRNA is a combination of at least 8 of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3p inhibitors, such as 8, 9, 10, 11, 12, 13, 14, 15 and 16 of miRNA. For example, the inhibitor of miRNA is the combination of inhibitors of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3 p.

Preferably, the inhibitor comprises the reverse complement of the corresponding miRNA or an inhibitor that inhibits replication or expression of the corresponding miRNA.

In practical application, the miRNA inhibitor is combined with other agents for inhibiting the miRNA expression or weakening the miRNA function in the preparation of antidepressant drugs.

The miRNA in the sperms is innovatively applied to the antidepressant, the inheritance of depression is weakened by inhibiting the content of the specific miRNA in the sperms through the miRNA inhibitor, the depression is treated, and the treatment effect of the antidepressant can be effectively improved.

Example 4

Based on example 3, this example provides an antidepressant. The antidepressant drug includes an inhibitor of miRNA as described in example 3.

The antidepressant of this embodiment may also include a pharmaceutically acceptable carrier including, but not limited to, diluents, buffers, emulsions, encapsulating agents, excipients, fillers, adhesives, sprays, transdermal absorbents, humectants, disintegrants, absorption enhancers, surfactants, colorants, flavoring agents, adjuvants, desiccants, adsorptive carriers, and the like.

The dosage form of the antidepressant of this embodiment may be tablets, capsules, powders, granules, pills, suppositories, ointments, solutions, suspensions, lotions, gels, pastes, and the like.

The antidepressant medicament has good treatment effect on depression and depression related diseases. The depression-related diseases can be diseases generated in the process of formation of depression or diseases which have certain correlation with depression, such as complications and sequelae caused by depression.

The antidepressant of the embodiment can also be used for treating depression patients by combining with other therapeutic drugs or therapeutic means with antidepressant effect to improve the therapeutic effect.

Such therapeutic agents include selective 5-hydroxytryptamine reuptake inhibitors (SSRI, such as fluoxetine, paroxetine, sertraline, fluvoxamine, citalopram and escitalopram), 5-hydroxytryptamine and norepinephrine reuptake inhibitors (SNRI, such as venlafaxine and duloxetine), norepinephrine and specific 5-hydroxytryptamine antidepressants (NaSSA, such as mirtazapine), and the like; the above treatment means includes psychological treatment, physical treatment, etc., and the present application is not limited thereto.

The antidepressant drug provided by the embodiment develops a new treatment angle of depression from the genetic mechanism of depression, has good curative effect and is suitable for large-scale popularization and application.

Example 5

The present example sets up a control group and a test group, and the same number of 8-week-old C57BL/6J mice were selected for both the control group and the test group.

First, a Chronic Mild Stress (CMS) -induced depression mouse model was established for the mice of the test group, and specifically, the mice of the test group were subjected to a 5-week chronic mild stress test, i.e., the mice were subjected to stresses of wet cage, food deprivation, restraint, stroboscopic illumination time (150 times/min), light-dark cycle inversion, cage tilt (45 °) and noise (90-105dB), all of which were applied at different time points, and to avoid habituation, an unpredictable factor was also added to the stress. The control mice were maintained under normal feeding conditions without stress, and both the control mice and the test mice were weighed twice a week.

As shown in FIG. 1B, CMS-induced F0 male mice (F0-Dep) in the experimental group had significantly reduced body weight compared to non-stressed F0 male mice (F0-Ctl) in the control group.

As shown in fig. 1C and 1D, CMS-induced F0 male mice (F0-Dep) in the test group exhibited significant depressive behavior such as longer resting time in the Forced Swim Test (FST) and lower sucrose intake in the Sucrose Preference Test (SPT) compared to non-stressed F0 male mice (F0-Ctl) in the control group.

To confirm that the above-mentioned change in mice was not caused by exercise activity, F0 and F1 mouse generations of the test and control groups were placed on an open field (50X 40 cm)³) The test is carried out, a 60 watt bulb is placed above the field, no noise or any other interference is caused, and indoor light is dim. After placing the mouse in the center of the arena, the movements were recorded with the camera for 5 minutes. The distance and body movement speed of the mice were analyzed using the TopScan software, and the results are shown in fig. 2.

Fig. 2A is a graph comparing the locomotor activity in open field of CMS-induced F0 male mice (F0-Dep) of the test group and non-stressed F0 male mice (F0-Ctl) of the control group (n ═ 15 mice per group); fig. 2B is a graph comparing the activity of CMS-induced F1 male mice (F1-Dep) in the test group and non-stressed F1 male mice (F1-Ctl) in the control group in exercise in open field (n ═ 16 mice per group); FIGS. 2C and 2D are graphs comparing the performance of FST (17-20 mice per group) and SPT (16-18 mice per group) of F1-Dep versus F1-Ctl after exposure to CVS stimulation for 1, 2 or 3 weeks; fig. 2E and 2F are comparative plots of the assessment results of performance assessment of FST and SPT in F1 generation male and female mice, respectively, under baseline conditions or after exposure to CVS (n-15-25 mice per group), with data shown as mean ± Standard Error (SEMs). From the test results of fig. 2, the test results were similar to those of fig. 1C and 1D, indicating that the longer resting time in the FST test and the lower sucrose intake in the SPT test in the test group mice were not due to changes in exercise, activity, etc.

In addition, plasma corticosterone is a key hormone of hypothalamus-pituitary-adrenal axis (HPA) axis, the plasma corticosterone level is significantly increased, and is also a characteristic marker of stress intensity (21, 25), in order to measure the corticosterone level of mice, blood samples of mice of control and test groups were taken using animal needles between 7 to 9 am, blood samples were collected in EDTA-coated tubes, plasma was separated after centrifugation at 2000g speed for 20 minutes in an environment of 4 ℃, corticosterone in 10 μ l of plasma was measured using enzyme-linked immunosorbent assay (ELISA) kit (yolkinozu biosciences), three replicates were measured per sample, and the result is shown in fig. 1E, where CMS of the test group induced significant increase in plasma corticosterone level of F0 male mice.

Depression is caused by changes in molecular, cellular, and synaptic neurotransmission in different brain regions and discrete neural circuits resulting from inadaptable stress. Hypothalamic paraventricular nucleus (PVN) is an important component of the HPA axis, and as shown in figure 1F, CMS-induced mRNA expression of Corticotropin Releasing Hormone (CRH) was significantly elevated in the F0 male mice (F0-Dep) of the experimental group, consistent with elevated plasma corticosterone levels. Together, these results indicate that CMS-induced HPA axis activation in F0 male mice is excessive.

The hippocampus, medial prefrontal cortex (mPFC) and lateral reins (LHb) participate in the pathophysiology of depression, together forming an evolutionarily conserved core neural circuit, critical to flexible and adaptive behavioral responses to environmental conditions and internal states. Glutamatergic neurotransmitter dysfunction and neurotrophic factor loss are frequently observed in hippocampus and medial prefrontal cortex, particularly in patients with depression. Analysis of the gene expression profiles of hippocampus and medial prefrontal cortex of CMS-induced F0 male mice in the experimental group revealed aberrant expression of glutamate signaling genes (GluA1 and GluA2 down-regulated, GluN2A and/or GluN2B up-regulated), whereas glutamate signaling genes were reduced in expression, in contrast to significant up-regulation of β CamKII in the lateral reins.

Immunoblot analysis of CMS-induced F0 male mice (F0-Dep) from the test group and non-stressed F0 male mice (F0-Ctl) from the control group demonstrated the abnormal expression of glutamate receptor subunits and signaling proteins mediating synaptic transmission and plasticity in the hippocampus and medial prefrontal cortex of CMS-induced F0 male mice from the test group, as shown in FIG. 1G.

To study the genetic regularity of depression, CMS-induced F0 male mice (F0-Dep) in the test group and non-stressed F0 male mice (F0-Ctl) in the control group were mated with healthy female mice, respectively, and the specific mating and culturing methods are shown in FIG. 3.

The test group and the control group F1 mice are screened for depression-like symptoms, and the results are shown in figure 1I, wherein the test group F1 mice (F1-Dep) grow normally, and the weight gain is not different from the control group F1 mice (F1-Ctl). As shown in fig. 1J, fig. 1K, the mice of the experimental group F1 also exhibited similar resting time and sucrose intake as the mice of the control group F1 under baseline conditions; however, after exposure to mild Chronic Variable Stress (CVS) lasting 2 weeks, the test group F1 mice reproduced a paternal depression-like phenotype including significantly longer floating time and less sucrose consumption, while the control group F1 mice did not exhibit depression-like behavior. As shown in fig. 2B, the open field trial also confirmed that these behavioral phenotypes of the experimental group F1 mice were independent of motor activity. Furthermore, as shown in fig. 1L, plasma corticosterone levels were significantly elevated in the F1 generation mice of the test group.

To validate the correlation of environmental stimuli with the development of depression-like symptoms in offspring, we progressively strengthened CVS stimuli from 1 week to 3 weeks. As shown in fig. 2C, fig. 2D, although CVS at 1 week was insufficient to induce an increase in immobility and a decrease in sucrose consumption in mice of F1 generation of test group, CVS at 2 or 3 weeks resulted in significant depression-like behavior in mice of F1 generation of test group. In addition, behavioral testing evaluations were performed on male and female F1-generation mice, respectively, and the results of fig. 2E and 2F show that both genders exhibited similar tendencies to the depressive-like phenotype after exposure to CVS.

As shown in fig. 4A, 4B, interspecies transmission of stress vulnerability was also observed in another depression-like model established by chronic immobilization stress (CRS). As shown in fig. 4C-4E, similar to the CMS model, CRS-induced F0 male mice (F0-Dep) generated F1 offspring (F1-Dep) exhibited normal behavioral performance under baseline conditions, but were more susceptible to depression-like behavior than the control F1 generation mice (F1-Ctl) at mild CVS exposure. These results indicate that CRS-induced male mice have low offspring resistance to stress.

To explain the depressive-like behavior observed in F1-Dep, we performed molecular analyses in several key brain regions associated with depression. As shown in FIGS. 1M and 5, F1-Dep has similar gene expression profile to F0-Dep when exposed to CVS, characterized by overexpression of CRH mRNA in PVN; mRNA dysregulation of glutamate receptors, synapsin and neurotrophic factors in hippocampus and mPFC; LHb GluA1/2, Rab3A, BDNF and beta CamKII mRNA are upregulated.

Immunoblot analysis was performed to verify the above results, which are shown in FIG. 1N, confirming the abnormal expression of glutamate signaling and synaptophysin in the hippocampus and mPFC of F1-Dep. In addition, we performed whole genome sequencing of the hippocampus transcriptomes of F0-Dep and F1-Dep and compared them with unstressed F0-Ctl and F1-Ctl. The pattern and intensity of genome-wide overlap was identified in a thresholdless manner by rank-rank hyper-geometric overlap (RRHO) analysis, as shown in fig. 1O, indicating significant overlap between F0 Dep and F0 Ctl and between F1 Dep and F1-Ctl for up-and down-regulated hippocampal genes. Hierarchical clustering also showed similar hippocampal gene profiles in F0-Dep and F1-Dep, while the gene profiles of F0-Ctl and F1-Ctl belong to different cluster groups, as shown in FIG. 1P. The biological process of the gene may be altered and then subjected to gene clustering analysis.

As shown in fig. 1Q and fig. 3, F0-Dep vs F0-Ctl and F1-Dep vs F1-Ctl share 6 GO clusters, and these overlapping GO functional classes are directly related to "nervous system development", "synaptic signaling", "localization, transport", "signaling regulation", "cognition, behavior", and "locomotion". These data strongly suggest that the F1 progeny from F0-Dep may be impaired by inappropriate changes in molecular and signaling, and are therefore more susceptible to stress-induced depression-like symptoms.

To dissect the functional changes of hippocampus, mPFC and LHb, we assessed neuronal activation and synaptic transmission by c-Fos immunocytochemistry, sensitive labeling technique of neuronal activation and whole-cell patch clamp recordings. As shown in fig. 6A, 6D and 7A, with increasing crhmmrna and plasma corticosterone, CRHergic neurons in PVN of F0-Dep were significantly activated compared to PVN of F0-Ctl. Thus, CRHergic neurons in PVN of F1-Dep were significantly activated compared to F1-Ctl, indicating a significant increase in HPA axis activity of F1-Dep. Similarly, as shown in FIGS. 5B and 5C, a significant increase in neuronal activation was also observed in LHb of F1-Dep. However, as seen in fig. 6B, 6C, 6E, 6F, 7B and 7C, neuronal activation in the hippocampus and mPFC of F0-Dep was significantly silenced compared to F0-Ctl. Thus, neuronal activation was significantly reduced in hippocampus and mPFC of F1-Dep compared to F1-Ctl. These results show that depression is associated with reduced hippocampus and mPFC neuronal activation, while hyperactivity of LHb and PVN play a causal role in depression.

In addition, as shown in fig. 6G and 6H, compared to F0-Ctl, the frequency and amplitude of spontaneous excitatory postsynaptic currents (sEPSCs) of the hippocampus and mPFC pyramidal neurons of F0-Dep were significantly reduced, and the frequency and amplitude of spontaneous excitatory postsynaptic currents (sEPSCs) of the hippocampus and mPFC pyramidal neurons of F1-Dep were also reduced to a similar extent as compared to those of F1 Ctl. These results indicate that, although F1-Dep was normally fed and not exposed to stress like F0-Dep, the pattern of synaptic transmission and neuronal activity in the neural circuits of F1-Dep is similar to F0-Dep.

Subsequently, we performed the following test for the question of whether a depression-like trait would be inherited to the F2 generation. As shown in FIG. 3 and FIG. 8A, males of F1-Dep and F1-Ctl were crossed with normal females, and F2 progeny (F2-Dep and F2-Ctl) were examined for each index. As shown in fig. 8B, fig. 8C, F2-Dep was insensitive to CVS stimulation compared to F2-Ctl, indicating that inheritance of depression susceptibility is episomal rather than cross-generational inheritance.

Example 6

There is increasing evidence that paternal features obtained during environmental exposure can be inherited by sperm to offspring, however, the active components of sperm that link the paternal environment to the offspring fate remain to be elucidated. Sperm RNA has previously been considered a negligible residue in spermatogenesis and has recently been found to be transmitted to fertilized eggs during fertilization.

To assess whether sperm RNA is associated with increased progeny depression-like phenotype, we purified total RNA from sperm of F0-Dep and F0-Ctl mice of example 5 and injected it into normal zygotes (RNA injection quantity normalized to about 10 sperm) and then transferred embryos to surrogate mothers to produce progeny (RNA-Dep vs RNA-Ctl); the RNA was isolated by replacing sperm with Diethylpyrocarbonate (DEPC) water, and injected into normal fertilized eggs, and the resulting offspring was used as a control group. As shown in FIG. 9, RNA-Ctl was not different in behavior compared to the control group, indicating that the injection of sperm RNA from F0-Ctl into fertilized eggs did not affect the phenotype of the offspring. Notably, RNA-Dep did not exhibit significant depressive-like behavior under baseline conditions compared to RNA-Ctl, which produced significant depressive-like behavior for CVS. In general, injection of sperm RNA into fertilized eggs produces the same depressive-like behavioral changes as those of offspring born from stress-induced F0-Dep.

In order to reduce the active components in sperm RNA, small RNA (sRNA, <200nt) fractions were specifically enriched from sperm of F0-Dep and F0-Ctl and microinjected into wild-type zygotes to generate IVF progeny (sRNA-Dep vs sRNA-Ctl; sRNA injection was normalized to approximately 10 sperm), equal amounts of synthetic scrambled RNA (scrRNA, random sequence, 0-50nt in length) were RNA-isolated instead of sperm and injected into zygotes to generate mock control progeny. As shown in FIGS. 10A-C, while sRNA-Dep, sRNA-Ctl and mock control exhibited the same performance under baseline conditions, and sRNA-Ctl and mock control exhibited similar performance after exposure to CVS, sRNA-Dep was more susceptible to CVS-induced depression-like behavior, including longer resting time in the FST test and lower sucrose intake in the SPT test. As shown in FIGS. 10D-F and 11A, sRNA-Dep showed abnormal activation of the HPA axis, including elevated plasma corticosterone levels, stimulation of CRH expression, and enhanced activation of the herpetic neurons in PVN, compared to sRNA-Ctl. Also, as shown in FIG. 12, activation of genes and neurons associated with depression was significantly increased in LHb of sRNA-Dep compared to sRNA-Ctl.

Furthermore, as shown in fig. 10G-fig. 10K and fig. 11B-fig. 11C, abnormal expression of depression-related genes/proteins and decreased neuronal activation were observed in hippocampus and mPFC of sRNA-Dep compared to sRNA-Ctl. As shown in FIGS. 10L and 10M, sEPSCs decreased in both frequency and amplitude in both hippocampal and mPF pyramidal neurons of sRNA-Dep.

As shown in fig. 13A-13C, we specifically enriched long RNA (> 200nt) fractions from sperm of F0-Dep and F0-Ctl and microinjected them into wild-type zygotes to generate IVF progeny (lra-Dep vs-lra-Ctl). In contrast to lRNA-Ctl, lRNA-Dep showed no significant depressive-like behavior under baseline conditions and after CVS exposure. These results indicate that sperm ribonucleic acids (sRNAs), but not lRNAs, are involved in the induction of progeny depressive-like symptoms by sperm RNA.

The sperm carries a large number of sRNAs including miRNAs, PIWI interacting RNAs (piRNAs), and tsRNAs. To determine which specific sperm sRNA subtypes caused progeny abnormalities, we examined sRNA profiles of sperm from F0-Dep and F0-Ctl by RNA deep sequencing. As shown in FIG. 14A, length distribution analysis showed that sRNA components in sperm from F0-Dep and F0-Ctl were similar. Differentially expressed sRNAs were analyzed using stringent thresholds (mean reading >500, fold change >2 and P <0.05) and, as shown in FIGS. 15A, 2 and 4, 19 miRNAs, 24 piRNAs and 0 tsRNAs in F0-Dep sperm were found to be significantly different from those in F0 Ctl sperm. Whereas a greater proportion of miRNAs were expressed in the F0 Dep sperm, most of the piRNAs showed a downward trend, as shown in fig. 15A. Quantitative RT-PCR analysis confirmed the accuracy of RNA deep sequencing. As shown in fig. 15B, a total of 16 and 1 miRNAs were demonstrated to be significantly up-and down-regulated in F0-Dep sperm; 1 and 5 piRNAs were significantly up-and down-regulated, respectively, in F0-Dep sperm; 0 tsRNAs were significantly altered in F0-Dep sperm. As shown in FIG. 14, when 19 miRNAs were evaluated in F1-Ctl and F1-Dep sperm (at baseline conditions without CVS stimulation), no significant change was found in the miRNAs in F1-Dep sperm. These results are consistent with our observed inability of the depression-like trait to pass from the F1 generation to the F2 generation. Taken together, the above results indicate that sRNAs are indeed very sensitive to stress experienced by the father and are differentially expressed in sperm after exposure to pressure.

Example 7

Because miRNAs have a broad regulatory role in embryonic development, inherited miRNAs are hypothesized to redirect the development of a depressed-like phenotype in remodeled offspring. Thus, a subset of synthetic miRNAs or an equal amount of scrambled RNA mimicking the 16 highest expressing sperm miRNAs in F0-Dep was injected into normal fertilized eggs (miRNAs injected at levels comparable to natural conditions) and the IVF progeny were evaluated for depression-like phenotype (miRNA Dep vs SCRNA Ctl) as shown in fig. 12A-12C, although under baseline conditions, the progeny did not exhibit behavioral changes and miRNA-Dep was more susceptible to depression-like behavior of CVS. Plasma cortisol levels were also higher than in the control group. Furthermore, as shown in fig. 12E-12G, neuronal activation of miRNA-Dep inhibition-associated brain regions was also remodeled to an abnormal state. As shown in fig. 12H, fig. 12I, miRNA-Dep has a similar neuroelectrophysiological phenotype as F0-Dep. As shown in fig. 12J, a portion of marker genes that reproduce depressive signals were also aberrantly expressed in miRNA-Dep, including overexpression of CRH in PVN and down-regulation of some glutamate receptors, synaptic plasticity genes, and neurotrophic factors in hippocampus and mPFC. Thus, miRNA-mediated epigenetic mechanisms may at least partially contribute to the intergenerative transmission of the vulnerability to stress-induced depression.

To investigate whether the inheritance of depression is mediated by a specific set of miRNAs, normal oocytes were first fertilized by sperm from F0-Dep or F0-Ctl, and then injected with a set of miRNA antisense strands at the fertilized egg stage to block the increase of 16 sperm miRNAs to neutralize the effect of the inherited sperm miRNAs, yielding IVF offspring (F1-Dep + anti or F1-Ctl + anti); controls were fertilized with sperm from F0-Dep or F0-Ctl, and then injected with scrambled RNA to generate IVF progeny (F1-Dep + scrRNA or F1-Ctl + scrRNA). As shown in fig. 13A, 13B, there was no difference in performance between the four groups under the baseline condition. As shown in FIGS. 15D, 15E, F1-Dep + scrRNA showed considerable depression-like behavior compared to F1-Ctl + scrRNA after exposure to CVS, while F1-Dep + Anti showed relatively normal behavior, almost comparable to that in F1-Ctl + scrRNA. As a control, F1-Ctl + Anti showed no depression-like behavior compared to F1Ctl + scrna, indicating that miRNA antisense strand injected alone into fertilized eggs had no significant effect on progeny phenotype.

Also, as shown in FIG. 15F, plasma corticosterone levels were similar for F1-Ctl + Anti and F1-Ctl + scrRNA, while high plasma corticosterone levels for F1-Dep + scrRNA were significantly reduced in F1-Dep + Anti. Furthermore, as shown in FIGS. 15G-15J, Ctl + Anti exhibited normal neuronal activation and synaptic transmission for F1-Dep compared to F1-Ctl + scrRNA, and aberrations of neuronal activation and synaptic transmission for PVN, hippocampus, and mPF of F1-Dep + scrRNA were significantly reduced compared to F1-Ctl + scrRNA, and returned to near-normal state. Again verifying that the miRNA antisense strand was able to counteract the vulnerability of the depressive-like phenotype induced by the genetic miRNAs, fertilized egg co-injection of miRNA antisense strand and progeny of sperm RNA from F0-Dep (RNA Dep + Anti) was compared to sperm RNA from F0-Dep or F0-Ctl and scrambled RNA (RNA Dep + scrna or RNA Ctl + scrna), as shown in fig. 14A-fig. 14L, with similar behavioral responses in these three groups of progeny under baseline conditions. RNA-Dep + scrRNA shows an increased risk of depressive-like behavior compared to RNA-Ctl + scrRNA, which is insensitive to RNA-Dep + Anti for depressive-like behavior under CVS stimulation. Thus, in RNA-Dep + scrRNA, elevated plasma corticosterone levels, abnormal neuronal activation and synaptic transmission return to normal.

We further investigated the mechanism by which sperm sRNAs participate in the inheritance of depression. Since early embryonic stage represents a plasticity window important for adult phenotype, we injected sperm sRNA from F0-Dep or F0-Ctl into fertilized eggs and evaluated the change in miRNA as the embryos developed to the E3.5 blastocyst stage (sRNA-Dep-E3.5 vs sRNA-Ctl-E3.5). Of the 16 highly expressed miRNAs in F0-Dep sperm, 13 showed a 1.5-4 fold increase in sRNA-Dep-E3.5 embryos. Furthermore, when we injected synthetic mimics of 16 miRNAs or equal amounts of scrna into normal zygotes and evaluated miRNA changes at the blastocyst stage of E3.5 (miRNA-Dep-E3.5 vs scrna-Ctl-E3.5), it was found that 15 miRNA increases 2-6 fold for the 15 miRNA-Dep-E3.5 embryo. To investigate the potential impact of increased miRNAs on embryonic development, we evaluated changes in the gene profiles in sRNA-Dep-E3.5 and sRNA-Ctl-E3.5 by single cell transcriptome RNA sequencing. As shown in FIG. 19A, a total of 264 (107 up-and 157 down-regulated) embryonic genes were identified as differentially expressed in sRNA-Dep-E3.5 (fold change >2 and P < 0.05). GO analysis of these differentially expressed genes found an abundance of GO clusters whose dysfunction often led to neuropsychiatric abnormalities, such as synaptic signaling, neuronal differentiation and neuronal development, see fig. 19BHE TU 9. We evaluated whether these differentially expressed genes were potentially regulated by a set of 17 mirnas (16 up-regulating mirnas plus down-regulating miR-184). In the 264 gene set, there was a direct targeting trend for a total of 78 genes (1 up-regulation, 77 down-regulation), a number significantly higher than that obtained by random simulation, see fig. 19C. Through literature mining, many genes in the 78 gene set are involved in the regulation of neurological function and pathophysiology (e.g., synaptic plasticity, dendritic spine formation, and nerve growth). Among them, App, Tspan7, Wnk3, Ly6a, Grin3a and App were represented and characterized. Embryonic Stem (ES) cells transfected with artificial miRNA mimics showed a reduction of these 6 proteins, and luciferase reporter analysis confirmed that the corresponding miRNAs directly bind to the 3 'untranslated regions (3' -UTRs) of the 6 genes. Theoretically, these neuronal genes, which initially tend to be fine and precisely controlled early in the embryo, may be inappropriately disrupted and reprogrammed by the inherited sperm mirna.

Consistent with this hypothesis, aberrant expression of these genes was observed during embryonic development of F1-Dep and F1-Ctl and sRNA-Dep and sRNA-Ctl. Specifically, although the expression levels of App, Tspan7, Wnk3, Ly6a and Grin3a increased sharply from the 4-cell stage to the morula stage in F1-Ctl embryos, the expression of these genes was significantly delayed in F1-Dep embryos. In contrast, β CamkII was significantly induced in F1-Dep embryos when its expression in F1-Ctl embryos was maintained at basal levels, see fig. 19D. Consistently, the gene changes in early embryos of sRNA-Dep and sRNA-Ctl were identical to the gene maps of F1-Dep and F1-Ctl, see FIG. 19E. The results indicate that sperm sRNAs may leave interfering imprints in the core neuronal circuits early in embryonic development.

The experiments of examples 5-7 can demonstrate that miRNAs are very sensitive to stress experience, and that deregulation of miRNAs in sperm is a prerequisite for risk-surrogate inheritance of depression; miRNAs with antisense strand neutralization abnormalities in sperm largely rescued the acquired depression-like phenotype of F1 offspring born from F0-Dep; sperm rRNA-derived small RNA (rsRNAs) are all susceptible to dietary changes and may contribute to interspecies inheritance.

Example 8

Significant change of miRNA in sperms of mice with depression

Respectively taking epididymis of the same age male depression and mice of a control group, and separating mature sperms; total RNA was extracted using the Trizol method, and small RNAs (<200bp) were isolated from depression and normal mouse sperm using the mirVana miRNA Isolation kit, followed by high-throughput sequencing of the small RNAs. Analyzing the non-coding small RNA with the reading number of more than 1000 and the change multiple of more than 2 times, wherein the result shows that the number and the expression level of miRNA in sperm are changed remarkably, while other types of non-coding small RNA (including piRNA, tsRNA and the like) are not changed obviously (shown as A-C in figure 20); we then verified the sequencing results again using fluorescent quantitative PCR, which gave results similar to sequencing (D-F in FIG. 20). This suggests that the intracytoplasmic miRNA may be the major molecule involved in the genetic process of depression.

In particular, in figure 20 a-C, mirna (a), tsrna (b), pirna (C) volcanic profiles with marked changes in small RNAs in the sperm of depressed mice relative to the normal group after sperm small RNA sequencing analysis, red for up-regulation, green for down-regulation, and black for no significant difference (FoldChange >2, P < 0.05). D-F in FIG. 20 validation of miRNA (D), tsRNA (E), piRNA (F) expression levels in sperm of normal and depressed mice for qRT-PCR. Control term normal mouse Sperm; depression Sperm-Depression mouse Sperm. P <0.05, P <0.01, P < 0.001.

Example 9

Depression mice were constructed using the method of the above example, experimental group 1: 20 depression F0 mice, experimental group 2: 15 depressed F1 mice: comparison group: 10 normal mice. The obtaining process of the F1 mouse is as follows: of mice born by the male parent and the female parent of the normal mice, mice exhibiting behavior of depression were selected as F1-generation mice. The experimental and comparative groups were treated as follows:

a. extracting total RNA: harvesting cells or tissues, adding Trizol reagent (invitrogen), extracting total RNA according to the reagent instructions, and calculating OD₂₆₀/OD₂₈₀To identify total RNA concentration and purity, ideally OD₂₆₀/OD₂₈₀＝2.0。

b. Reverse transcription reaction:

the reaction system was 20. mu.l, and the following reagents were added to a 0.2ml thin-walled tube: reverse transcription (5 Xbuffer) 4. mu.l, dNTP mix (10mM) 1. mu.l, RNase Inhibitor 0.5. mu.l, stem-loop primer 1. mu.l, U6 Reverse primer 1. mu.l, RNA 2. mu.l, Reverse transcription 1. mu.l, RNase Free H₂O9.5 mul, adding the thin-walled tube of the reagent, centrifuging, mixing uniformly, placing in a PCR instrument, and carrying out reverse transcription according to the following procedures: 16 ℃ C: 15min, 42 ℃: 60min, 85 ℃: 5min, 4 ℃: 5min

c.PCR：

The qRT-PCR reaction system was 20 μ l, and the following reagents were added to a 96-well PCR plate: taq 0.3. mu.l, cDNA 1. mu.l, MgCl₂ 1.2μl、dNTP mixture 1.6μl、10×PCR buffer 2μl、Sybr Green or Taqman Probe 1μl、Forward primer 0.2μl、Reverse primer 0.2μl、ddH₂O12.5. mu.l, PCR conditions were: pre-denaturation: 95 ℃ for 15 min; denaturation: 95 ℃ for 15 sec; annealing and extending: 60 ℃ for 60 sec.

d. Data processing method is delta C_TThe method is carried out. C_TSetting the number of cycles when the reaction reaches a threshold value, and calculating the expression quantity of miR-103-3p, namely using an equation 2 to calculate the expression quantity of miR-103-3p in the extracted miRNA relative to a standard internal reference^-ΔCTIs represented by, wherein_T＝C_{T sample}-C_{Internal reference of T}. The internal reference is a U6 snRNA molecule, which is a housekeeping gene with the size of 100 nt.

In this example, gene U6 was used as an internal reference, and after internal reference correction, the content of miRNA in normal mice was 0.01 relative to the internal reference gene U6, and the content of depressed mice was 0.022.

The experimental verification in this example and numerous experimental studies in other experiments (including fig. 15B and the technical description in this respect in example 8) show that the number of mirnas in sperm is 2 times or more than that in normal mice, specifically, the increase amounts of different mirnas are different, for example, the numbers of miR-146a-5, miR-27B-3p, miR-30a-5p, miR-9-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-199a-3p and the like in sperm are 2 times or more than that in normal mice; the number of miR-103-3p is 5 times or more than that of the normal mouse, the number of others is less than 2 times, and on the whole, when the number of miRNA in sperm is 2 times or more than that of the normal mouse, the probability of suffering from depression is about 90%.

Example 10

In order to further explore whether the intracospermic miRNA directly mediates the generation of depression interspinal inheritance phenomenon, reverse complementary sequences (antisense) of 13 miRNAs which are verified to be most significantly upregulated in depression sperms in the experiment are synthesized, then the antisense is added into the extracted depression sperm RNA, and then the mixed RNA is injected into normal fertilized eggs in a microinjection method: miR-103-3p with the concentration of 2 ng/. mu.L is injected into mouse fertilized eggs, and the injection amount is 1PL (picoliter). Finally, the injected embryo is transplanted to the uterus of a normal female mouse to breed offspring. The experiments were divided into 3 groups: NC + normal sperm RNA (Total-C + NC), NC + depression sperm RNA (Total-D + NC) and antisense + depression sperm RNA (Total-D + anti), wherein NC is an equi-concentration equilong-length nonsense single-stranded RNA sequence.

The three groups of RNA-injected offspring mice are detected in a resting state and after acute stimulation respectively, and the ethological indexes such as forced swimming resting time, sucrose consumption, sucrose preference and the like of the mice in the three groups are found to have no obvious change (the Total-D + anti group is obviously increased relative to the Total-D + NC group after the acute stimulation) (A-F in figure 21). Then, after giving two weeks of chronic stimulation to three groups of RNA injection offspring mice, detecting the ethological indexes again, and finding that compared with the Total-C + NC injection group offspring mice, the Total-D + NC injection group offspring mice have obviously increased forced swimming resting time (G in figure 21), the sucrose consumption is obviously reduced (I in figure 21), and obvious depression-like symptoms are displayed, which is also consistent with the existing results; more critically, the Total-D + anti injection group progeny mice had significantly reduced forced swim resting time (G in fig. 21), significantly increased sucrose consumption (I in fig. 21), and nearly returned to the control (Total-C + NC) levels after chronic stimulation relative to the Total-D + NC injection group progeny mice. The experiment shows that the miRNA antisense is added to reduce the abnormal up-regulated miRNA level in the RNA of the sperm of the depression, so that the interspinal inheritance phenomenon mediated by the RNA of the sperm of the depression can be obviously restored.

Specifically, A-C in FIG. 21: the resting state behavior detection result is obtained; a: a statistical chart of a forced swimming test of a mouse; b: mouse sucrose preference test statistical plots; c, mouse sucrose consumption test statistical chart. D-F in FIG. 21: the results of the behavioral testing after the acute stimulation; d: a statistical chart of a forced swimming test of a mouse; e: mouse sucrose preference test statistical plots; f: statistical plots of the mouse sucrose consumption assay. G-I in FIG. 21: the results of the behavioral testing after chronic stimulation; g: a statistical chart of a forced swimming test of a mouse; h: mouse sucrose preference test statistical plots; i: statistical plots of the mouse sucrose consumption assay. Total-C + NC is nonsense sequence RNA added into Total RNA from normal mouse sperms; Total-D + NC: adding total RNA from the sperm of the depressed mouse into synthetic nonsense sequence RNA; Total-D + anti: total RNA from depressed mouse sperm was added to the antisense of synthetic 13 mirnas; p <0.05, P <0.01, P < 0.001.

To further demonstrate the reversion of miRNA antisense to the RNA-mediated depression susceptibility trait in progeny mice, we examined the expression levels of c-fos protein in the hippocampal CA3 brain region, mPFC PrL region, and PVN brain region of three groups of RNA-injected mice using immunofluorescence histochemical techniques. The results showed that in hippocampus and mPFC, the neuron activation degree of the offspring mice of the Total-D + NC injection group was significantly reduced compared to the offspring mice of the Total-C + NC injection group, and the phenomenon was significantly restored when the depression sperm RNA and miRNA antisense were simultaneously injected (a and B in fig. 22). Next, we compared excitatory synaptic transmission changes between hippocampal CA3 brain regions and PrL zoned neurons of mPFC, respectively, using whole-cell patch clamp recordings. The results show that compared with the offspring mice of the Total-C + NC injection group, the brain regions such as CA3 and mPCC of the hippocampus of the offspring mice of the Total-D + NC injection group have obviously reduced frequency and amplitude of neuron spontaneous excitatory synaptic current (sEPSC) (C and D in figure 22), and the group injecting sperm RNA and miRNA antisense simultaneously can obviously recover the phenomenon. The results prove that the miRNA in the sperms directly participates in the generation of the interspinal genetic phenomenon of the depression.

Specifically, a-B in fig. 22: performing immunofluorescence histochemistry detection on the content of c-fos protein in descendant hippocampal CA3 brain region (A) and mPF PrL partition (B); NeuN (red), DAPI (blue), c-fos (green). C-D: amplitude (left) and frequency (right) statistics of spontaneous excitatory synaptic currents from neurons in CA3(C) of the offspring hippocampus and PrL partition (D) of mPFC. Total-C + NC is nonsense sequence RNA added into Total RNA from normal mouse sperms; Total-D + NC is nonsense sequence RNA added into Total RNA of sperms of the depressed mice; Total-D + anti is the antisense of Total RNA from the sperms of the depressed mice added with synthesized 13 miRNAs; p <0.05, P < 0.01.

Example 11

In this example, a control group and a test group were provided, and 50C 57BL/6J mice with an age of 8 weeks were selected for each of the control group and the test group.

Mice in the experimental group received 5 weeks of chronic mild stress tests, i.e. mice were subjected to stress of wet cages, food deprivation, restraint, stroboscopic illumination time (150/min), light-dark cycle inversion, cage tilt (45 °) and noise (90-105dB), all applied at different time points, and to avoid habituation, also to factors that increase the stress unpredictably, a Chronic Mild Stress (CMS) -induced depression mouse model was established.

The control group of mice maintained normal feeding conditions in the absence of stress.

Firstly, carrying out FST test and STP test on mice of a test group and a control group respectively to obtain the number of actual mice suffering from depression (behavior detection result), and then adopting the depression detection product (kit) provided by the application to carry out depression condition detection on the mice of each group to obtain the depression condition detection productTo detect the number of mice suffering from depression (detection result of the kit), the kit comprises dNTP/AMV reverse transcriptase, a probe capable of detecting miRNA in the application, buffer solution and MgCl₂DEPC water and Taq enzyme; the probe is a TaqMan microRNA probe which is customized and synthesized by Applied Biosystems, and the detection method is a conventional method and is not described again; the results are shown in Table 1.

TABLE 1 Depression test results of each group of mice are shown in the table

Therefore, the matching degree of the detection kit for depression to the detection result of the behavior reaches more than eighty percent, the detection accuracy is high, and a new idea of depression detection is developed.

In this embodiment, the design of probes based on the target sequence is prior art and thus will not be described in detail, and the detection method of the kit is also a conventional method and will not be described herein.

Example 12

In this example, control groups 1-2 and test groups 1-3 were set, and 50C 57BL/6J mice with 8 weeks of age were selected for each of the control groups 1-2 and test groups 1-3.

Mice in the control and experimental groups were subjected to 5 weeks of chronic mild stress tests, i.e. mice were subjected to stress of wet cage, food deprivation, confinement, stroboscopic illumination time (150/min), light-dark cycle inversion, cage tilt (45 °) and noise (90-105dB), all applied at different time points, and to avoid habituation, a Chronic Mild Stress (CMS) induced depression mouse model was established giving an unpredictable factor to the increase in stress.

The mice of each group were kept in the same breeding environment and breeding conditions for four weeks, wherein the administration of the mice of the control groups 1-2 and the test groups 1-3 is shown in Table 2:

table 2 schematic table of administration of each group of mice

In the above tables, mg of mg/kg means the mass of the antidepressant drug mentioned above, and kg means the mass of the mouse.

The antidepressant drug described in test group 1 is a random selection of the reverse complement sequences (antisense) of 8 mirnas as claimed in the present application, and the 8 mirnas are respectively: miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-200a-3p, miR-30c-5p and miR-103-3 p.

The antidepressant drug described in test group 2 is a random selection of the reverse complement sequences (antisense) of 13 mirnas as claimed in the present application, and the 13 mirnas are respectively: miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p, miR-199a-3 p.

The antidepressant drug in test group 3 is a reverse complementary sequence (antisense) of 16 miRNAs protected by the application, and the 16 miRNAs are respectively: miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p, miR-199a-3 p.

The control group mice and the test group mice were weighed twice a week during the feeding period, and the results showed that the control group 1-2 mice had a significant weight loss compared to the test group 1-3 mice.

During the feeding period, FST test and SPT test are respectively carried out on the control group mice and the test group mice every week, and the test results show that the FST resting time of the mice of the control group 1 is continuously prolonged, the sucrose intake is continuously reduced, the FST resting time of the mice of the control group 2 is slightly shortened after the administration, the sucrose intake is slightly reduced, the FST resting time of the mice of the test groups 1-3 is obviously shortened after the administration, and the sucrose intake is obviously improved.

During the feeding period, the plasma corticosterone levels of the control mice and the test mice were measured 2 times per week, and the test results showed that the plasma corticosterone levels of the mice of the control group 1 were continuously increased, the plasma corticosterone levels of the mice of the control group 2 were only slightly increased after the administration, and the plasma corticosterone levels of the mice of the test groups 1-3 were decreased after the administration.

Therefore, the antidepressant provided by the application can effectively treat depression, has a more remarkable treatment effect compared with the existing antidepressant, is low in economic cost, and is easy to popularize and apply on a large scale.

Example 13

In order to research whether exogenous miRNA can simulate the function of endogenous sperm miRNA, the inventor synthesizes analogs (mimics) of 13 miRNA which are most obviously upregulated in sperms of depression mice, mixes the analogs, injects 1PL (skin liter) into normal fertilized eggs at physiological concentration (2 ng/mu l), then transplants the embryos into the uterus of normal generation female mice to propagate offspring, and injects nonsense sequence RNA with the same concentration and the same length into a control group.

Two groups of mice injected with synthetic RNA, tested in resting state and after acute stimulation, were found to show similar behavioural index changes (A-F in FIG. 23) such as resting time for forced swimming, sucrose consumption and sucrose preference. After that, two groups of mice injected with synthetic RNA have two weeks of chronic stimulation, and then the behavioral indexes are detected again, so that the forced swimming resting time of the mice injected with miRNA mix is obviously increased (G in figure 23), the sucrose preference is obviously reduced (H in figure 23), the sucrose consumption is not obviously different (I in figure 23), and obvious depression-like symptoms are shown. The experiment shows that the addition of exogenous miRNA mimics the miRNA-mediated interspinal inheritance phenomenon of the sperms of the depression for the most part.

Specifically, a-C in fig. 23: the resting state behavior detection result is obtained; a: a statistical chart of a forced swimming test of a mouse; b: mouse sucrose preference test statistical plots; c, mouse sucrose consumption test statistical chart. D-F: the results of the behavioral testing after the acute stimulation; d: a statistical chart of a forced swimming test of a mouse; e: mouse sucrose preference test statistical plots; f: statistical plots of the mouse sucrose consumption assay. G-I: the results of the behavioral tests after chronic stimulation(ii) a G: a statistical chart of a forced swimming test of a mouse; h: mouse sucrose preference test statistical plots; i: statistical plots of the mouse sucrose consumption assay. Control^synDepression, nonsense sequence RNA injection group^syn13 miRNA mimics injection groups. A, P<0.05，**,P<0.01。

Taken together, we further demonstrated that intrasperm mirnas did participate directly in the development of the interspecies inheritance phenomenon of depression.

In summary, the above experiments revealed that a depressive-like phenotype caused by paternal stress can be inherited by offspring through the causal action of mirnas in sperm. To understand the epigenetic mechanism of depression, an important dimension is provided for developing new antidepressant drugs. The miRNA in the sperms can be applied to depression detection products and antidepressant drugs, and the depression detection accuracy and the treatment effect of the antidepressant drugs are effectively improved.

Unless otherwise indicated, numerical ranges herein include not only the entire range within its two endpoints, but also several sub-ranges subsumed therein. The preferred embodiments and examples of the present application have been described in detail with reference to the accompanying drawings, but the present application is not limited to the embodiments and examples described above, and various changes can be made within the knowledge of those skilled in the art without departing from the concept of the present application.

Claims

1. An application of miRNA in sperm in preparing depression detection products.

2. The use of claim 1, wherein the miRNA is a 5-200bp long stretch of bases in sperm.

3. The use of claim 1, wherein the miRNA comprises: at least one of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p, miR-199a-3 p;

preferably, the miRNA is a combination of at least 8 of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3 p.

4. The use of claim 1, wherein the depression detection product comprises a chip or kit; the chip comprises a solid phase carrier and an oligonucleotide probe fixed on the solid phase carrier, wherein the oligonucleotide probe comprises a part or all of a sequence specifically corresponding to the miRNA; the kit comprises a reagent for detecting the expression level of the miRNA, wherein the reagent comprises a primer and/or a probe aiming at the miRNA.

5. The use of claim 1, wherein the assay product uses the content of miRNA in sperm as an assay indicator, and indicates a risk when the content of miRNA is higher than the normal level for the same species.

6. Use according to claim 5, wherein the above normal level of the same species is above 2-fold and above.

7. An application of miRNA in sperm in preparing antidepressant is provided.

8. The use of claim 7, wherein said antidepressant drug comprises an inhibitor of said miRNA.

9. The use of claim 8, wherein the inhibitor of miRNA comprises: inhibitors of at least one miRNA of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p, miR-199a-3 p;

preferably, the miRNA inhibitor is a combination of at least 8 of miR-146a-5p, miR-27b-3p, miR-30a-5p, miR-152-3p, miR-1839-5p, miR-143-3p, miR-9-5p, let-7g-5p, miR-200a-3p, miR-200c-3p, miR-30c-5p, miR-26b-5p, miR-103-3p, miR-29a-3p, miR-101a-3p and miR-199a-3p inhibitors.

10. The use of claim 8, wherein the inhibitor comprises the reverse complement of a miRNA or an inhibitor that inhibits replication or expression of a miRNA.

11. The use of claim 8, wherein said inhibitor of a miRNA is used in combination with another agent that inhibits the expression of said miRNA or reduces the function of said miRNA in the preparation of an antidepressant.