CN104039960A - Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions - Google Patents

Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions Download PDF

Info

Publication number
CN104039960A
CN104039960A CN201280048952.XA CN201280048952A CN104039960A CN 104039960 A CN104039960 A CN 104039960A CN 201280048952 A CN201280048952 A CN 201280048952A CN 104039960 A CN104039960 A CN 104039960A
Authority
CN
China
Prior art keywords
mir
expression
neurogliocyte
gene
precursor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201280048952.XA
Other languages
Chinese (zh)
Other versions
CN104039960B (en
Inventor
阿隆·陈
埃兰·霍恩施泰因
欧娜·艾斯勒
沙伦·哈拉马蒂
纳马·福尔克
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yeda Research and Development Co Ltd
Original Assignee
Yeda Research and Development Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yeda Research and Development Co Ltd filed Critical Yeda Research and Development Co Ltd
Priority to CN201710223993.2A priority Critical patent/CN107115352B/en
Priority to CN202011042171.2A priority patent/CN112426538A/en
Publication of CN104039960A publication Critical patent/CN104039960A/en
Application granted granted Critical
Publication of CN104039960B publication Critical patent/CN104039960B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058—Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/08—Antiepileptics; Anticonvulsants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/18—Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/20—Hypnotics; Sedatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/22—Anxiolytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/02—Nutrients, e.g. vitamins, minerals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P39/00—General protective or antinoxious agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00—Drugs for disorders of the endocrine system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Psychiatry (AREA)
  • Plant Pathology (AREA)
  • Diabetes (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Pain & Pain Management (AREA)
  • Obesity (AREA)
  • Endocrinology (AREA)
  • Hematology (AREA)

Abstract

Micro RNAs and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone-associated medical conditions are provided.

Description

Be used for the treatment of with diagnosis and serotonin-, suprarenin-, norepinephrine-, the microRNA of the illness of L-glutamic acid-relevant with corticotropin releasing hormone and the composition that comprises microRNA
Technical field
The present invention relates to microRNA (microRNA) in its some embodiments, and more specifically but not exclusively, relates to and use microRNA for medical diagnosis on disease, treatment and monitor therapy.
Background technology
Emotional maladjustment as major depression (major depression) be in world wide the most common and increase sharply health problem in some problems, it affects approximately 10% population.Although the research of decades, paralepsy, susceptibility and available treatment mechanism behind only part is understood.Only approximately 1/3rd patient, in response to existing methods for the treatment of, therefore, is starved of better understanding pathology at present.The current etiologic etiological theory about depression is the complicated interaction between environmental factors and genetic predisposition, points out the mechanism of action of apparent genetic process.
Serotonin (5HT) is the monoamine neurotransmitter being produced by nuclei of median raphe (RN) in brain, and nuclei of median raphe is extensively outstanding to regulate multiple cognition, emotion and physiological function at whole brain.Association between serotonergic activity and the depression of imbalance is [Michelsen KA.et al., the Brain ResRev (2007) 55 (2): 329-42] generally acknowledging.In depression, the level of 5HT and the hereditary ring of production, secretion, re-uptake and inactivation of being responsible for it are lacked of proper care.In addition, the function of the antidepressant drug target that most can be used and 5HT system associated protein, makes the 5HT level [Krishnan V and Nestler EJ, Nature (2008) 455:894-902] improving in cynapse.Available therapy need to give for a long time before the alleviation that observes symptom.
MicroRNA (miR) is the subset of transcribing endogenous little (approximately 22 Nucleotide) the RNA molecule of rear inhibition of gene expression.MiR is transcribed into elementary miR molecule, and they are processed to have the precursor miR of loop-stem structure in nucleus, and it is output to tenuigenin, and they are further processed into active ripe miR herein.Ripe miR is merged in subsequently the silencing complex of RNA induction and mainly plays a role by the 3 ' non-translational region (3 ' UTR) that is incorporated into specific mrna molecule.Produce combination by means of Seed Sequences, Seed Sequences is at 8 nucleotide sequences of 6 – of 5 of miR ' end, and its base pairing is in the complementary seed matching sequence on said target mrna 3'UTR.The combination of miR causes direct mRNA unstability or translation to suppress, and finally causes the target gene protein level reducing.
MiR enriches in neural system, and initial research is mainly devoted in growth, cancer and neurodegenerative disease and normal processes as the neurone in plastic situation [Kosik KS.Nat Rev Neurosci (2006) 7:911-20].In addition, show, in people and mouse model, miR play a role in as schizophrenia, autism and depression and anxiety in mental disorder [MillerBH and Wahlestedt C, Brain Res (2010) 1338:89-99].Several researchs show recently, miR participates in regulating the gene [Millan MJ.Curr Opin Pharmacol (2011) 11 (1): 11-22] relevant to 5HT, and it has disclosed the emerging effect of miR in the adjusting of 5HT system and they and potential relation depressed associated disorders.
Application No. US20100222413(licenses to Stoffel M.et al.) the chemically modified oligonucleotide of the expression for regulating microRNA disclosed.US20100222413 further discloses the method that for example, is used for the treatment of the disease of central nervous system for reticent microRNA (miR-122, miR-16, miR-192 and miR-194).
Summary of the invention
An aspect according to certain embodiments of the present invention, it is the method for illness useful in treatment that the raising that is used for the treatment of wherein serotonin level in its experimenter of needs is provided, the method comprises and gives experimenter by the exogenous polynucleotide of coding at least one microRNA or its precursor, or at the encode exogenous polynucleotide of at least one microRNA or its precursor of experimenter's cells, thereby treatment illness, wherein microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
An aspect according to certain embodiments of the present invention, the exogenous polynucleotide that encode at least one microRNA or its precursor be provided are identified for treating the application in the medicine that the wherein raising of serotonin level is illness useful in treatment in manufacture, and wherein microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
An aspect according to certain embodiments of the present invention, method for improve serotonin level in its experimenter's synaptic cleft of needs is provided, the method comprises the exogenous polynucleotide that give experimenter by the exogenous polynucleotide of at least one microRNA of coding or its precursor or express at least one microRNA of coding or its precursor in serotonin serotonergic neuron, thereby improve serotonin level in synaptic cleft, wherein microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
An aspect according to certain embodiments of the present invention, the neurogliocyte of transcribing the separation of controlling lower nucleic acid construct of expressing at least one microRNA or its precursor that is included in cis acting controlling element is provided, and wherein microRNA selects the group that free miR-135, miR-335, miR-26 and miR-182 form.
An aspect according to certain embodiments of the present invention, the polynucleotide of the separation of encode at least one microRNA or its precursor are provided, being used for the treatment of the wherein raising of serotonin level is the upper useful illness for the treatment of, and wherein microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
An aspect according to certain embodiments of the present invention, in its experimenter of needs treatment is provided, and wherein low suprarenin or noradrenaline levels are the methods of illness useful in treatment, the method comprises and gives experimenter by the exogenous polynucleotide of coding miR-19 or its precursor or at experimenter's cells coding miR-19 or the exogenous polynucleotide of its precursor, thus treatment illness.
An aspect according to certain embodiments of the present invention, the exogenous polynucleotide that coding miR-19 or its precursor be provided are identified for treatment in manufacture, and wherein low suprarenin or noradrenaline levels are the application in the medicine of illness useful in treatment.
An aspect according to certain embodiments of the present invention, provides the cell of the separation that comprises nucleic acid construct, and this nucleic acid construct is expressed miR-19 or its precursor transcribing of cis acting controlling element under control.
An aspect according to certain embodiments of the present invention, provides the polynucleotide of the separation of coding miR-19 or its precursor, and being used for the treatment of wherein low suprarenin or noradrenaline levels is the upper useful illness for the treatment of.
An aspect according to certain embodiments of the present invention, provide in its experimenter of needs treatment wherein low corticotropin releasing hormone (CRH) level be the method for the upper useful illness for the treatment of, the method comprises and gives experimenter by the exogenous polynucleotide of coding miR-15 or its precursor or at experimenter's cells coding miR-15 or the exogenous polynucleotide of its precursor, thus treatment illness.
An aspect according to certain embodiments of the present invention, the exogenous polynucleotide that coding miR-15 or its precursor be provided manufacture be identified for treatment wherein low corticotropin releasing hormone (CRH) level be the application in the medicine of the upper useful illness for the treatment of.
An aspect according to certain embodiments of the present invention, provides the cell of the separation that comprises nucleic acid construct, and this nucleic acid construct is expressed miR-15 or its precursor transcribing of cis acting controlling element under control.
An aspect according to certain embodiments of the present invention, provides the polynucleotide of the separation of coding miR-15 or its precursor, and being used for the treatment of wherein low corticotropin releasing hormone (CRH) level is the upper useful illness for the treatment of.
An aspect according to certain embodiments of the present invention, provide in its experimenter of needs treatment wherein low L-glutamic acid receptor level be the method for illness useful in treatment, the method comprises and gives experimenter by the exogenous polynucleotide of coding miR-181 or its precursor or at experimenter's cells coding miR-181 or the exogenous polynucleotide of its precursor, thus treatment illness.
An aspect according to certain embodiments of the present invention, the exogenous polynucleotide that coding miR-181 or its precursor be provided manufacture be identified for treatment wherein low L-glutamic acid receptor level be the application in the medicine of illness useful in treatment.
An aspect according to certain embodiments of the present invention, provides the cell of the separation that comprises nucleic acid construct, and this nucleic acid construct is expressed miR-181 or its precursor transcribing of cis acting controlling element under control.
An aspect according to certain embodiments of the present invention, provides the polynucleotide of the separation of coding miR-181 or its precursor, and being used for the treatment of wherein low L-glutamic acid receptor level is the upper useful illness for the treatment of.
An aspect according to certain embodiments of the present invention, the nucleic acid construct of the nucleotide sequence that comprises coding microRNA or its precursor is provided, wherein microRNA or its precursor select the group of free miR-135, miR-335, miR-26, miR-27, miR-181, miR-182, miR-19 and miR-15 composition, and above-mentioned nucleotide sequence is transcribing under control at cis acting controlling element.
An aspect according to certain embodiments of the present invention, provides the pharmaceutical composition that comprises nucleic acid construct of the present invention and pharmaceutical carrier or thinner.
An aspect according to certain embodiments of the present invention, provide for regulate tryptophan hydroxylase 2(Tph2 at neurogliocyte) method of the expression of gene, thereby the method is included in the expression of adjusting the active of microRNA or its precursor or expression adjusting Tph2 gene in neurogliocyte, and wherein microRNA selects the group of free miR-181 and miR27 composition.
An aspect according to certain embodiments of the present invention, method for regulate the expression of glutamate receptor gene at neurogliocyte is provided, the method is included in the active or expression of adjusting miR-181 or its precursor in neurogliocyte, thereby regulates the expression of glutamate receptor gene.
An aspect according to certain embodiments of the present invention, provides the polynucleotide of the separation that comprises nucleotide sequence, for lowering the expression of miR-181, miR-27 or its precursor.
An aspect according to certain embodiments of the present invention, the nucleic acid construct of the nucleotide sequence that comprises the expression for lowering microRNA or its precursor is provided, wherein microRNA or its precursor select the group of free miR-181 and miR-27 composition, and nucleotide sequence is transcribing under control at cis acting controlling element.
An aspect according to certain embodiments of the present invention, the method of the expression that regulates serotonin translocator (Slc6a4) gene in neurogliocyte is provided, the method is included in the active or expression of adjusting microRNA or its precursor in neurogliocyte, wherein microRNA selects the group of free miR-135 and miR-335 composition, thereby regulates the expression of Slc6a4 gene.
An aspect according to certain embodiments of the present invention, provide and in neurogliocyte, regulated serotonin inhibition acceptor 1a(Htr1a) method of the expression of gene, the method is included in the active or expression of adjusting microRNA or its precursor in neurogliocyte, wherein microRNA selects the group of free miR-135, miR-335, miR-181, miR-182 and miR-26 composition, thereby regulates the expression of Htr1a gene.
An aspect according to certain embodiments of the present invention, the method of the expression that regulates Down's syndrome cell adhesion molecule (Dscam) gene in neurogliocyte is provided, the method is included in the active or expression of adjusting miR-182 or its precursor in neurogliocyte, thereby regulates the expression of Dscam gene.
An aspect according to certain embodiments of the present invention, provide and in neurogliocyte, regulated cell adhesion molecule L1(L1cam) method of the expression of gene, the method is included in the active or expression of adjusting miR-182 or its precursor in neurogliocyte, thereby regulates the expression of L1cam gene.
An aspect according to certain embodiments of the present invention, provide and in neurogliocyte, regulated Translin associated protein X(Tsnax) method of the expression of gene, the method is included in the active or expression of adjusting miR-182 or its precursor in neurogliocyte, thereby regulates the expression of Tsnax gene.
An aspect according to certain embodiments of the present invention, provides the method for the expression that regulates monoamine hydroxylase (MaoA) gene in neurogliocyte, the method to comprise and has adjusted the active of miR-27 or express, thereby regulates the expression of MaoA gene.
An aspect according to certain embodiments of the present invention, provide and in neurogliocyte or myocardial cell, regulated Beta-3 adrenergic receptor 1(Adrb1) method of the expression of gene, the method comprises to be adjusted the active of miR-19 or expresses, thereby regulates the expression of Adrb1 gene.
An aspect according to certain embodiments of the present invention, provide and in neurogliocyte, regulated Cannabined receptor 1(CB1) method of the expression of gene, the method is included in the active or expression of adjusting miR-19 or its precursor in neurogliocyte, thereby regulates the expression of CB1 gene.
An aspect according to certain embodiments of the present invention, provides the method for the expression that regulates CRH1 receptor gene in neurogliocyte, the method to comprise and has adjusted the active of miR-15 or express, thereby regulates the expression of CRH1 receptor gene.
An aspect according to certain embodiments of the present invention, provide and in neurogliocyte, regulated FKBPL 5(FKBP5) method of the expression of gene, the method is included in the active or expression of adjusting miR-15 or its front body segment in neurogliocyte, thereby regulates the expression of FKBP5 gene.
An aspect according to certain embodiments of the present invention, provide and in neurogliocyte, regulated cynapse chemotactic element 1a(Syntaxin1a) (Stx1a) method of the expression of gene, the method is included in the active or expression of adjusting miR-15 or its precursor in neurogliocyte, thereby regulates the expression of Stx1a gene.
An aspect according to certain embodiments of the present invention, the method that regulates serum/glucocorticosteroid to regulate the expression of kinases (Sgk1) gene in neurogliocyte is provided, the method is included in the active or expression of adjusting miR-15 or its precursor in neurogliocyte, thereby regulates the expression of Sgk1 gene.
An aspect according to certain embodiments of the present invention, the method of the expression that regulates beta 2-adrenergic receptor (Adrb2) gene in neurogliocyte is provided, the method is included in the active or expression of adjusting miR-15 or its precursor in neurogliocyte, thereby regulates the expression of Adrb2 gene.
An aspect according to certain embodiments of the present invention, provides the method for monitoring the treatment of thymoleptic, and the method comprises: the experimenter who (a) needs it by anti-depressant therapy; And (b) before treatment and after treatment, the expression level of miR-135 in measurement experimenter's blood, wherein, compared with the expression level of miR-135 before treating with thymoleptic, after treating with thymoleptic, the lower expression level of miR-135 represents effective treatment.
An aspect according to certain embodiments of the present invention, the method of diagnosing serotonin associated conditions in its experimenter of needs is provided, the method is included in the expression level of measuring miR-135 in experimenter's blood, wherein, compared with the expression level of the miR-135 in health volunteer's blood sample, the high expression level of miR-135 represents serotonin associated conditions.
According to certain embodiments of the present invention, cell is neurogliocyte.
According to certain embodiments of the present invention, neurogliocyte is serotonin serotonergic neuron.
According to certain embodiments of the present invention, miR-135 is as set forth at SEQ ID NO:58 to SEQ IDNO:62.
According to certain embodiments of the present invention, miR-335 is as set forth in SEQ ID NO:63 to SEQID NO:64.
According to certain embodiments of the present invention, miR-26 is as set forth in SEQ ID NO:65 to SEQID NO:69.
According to certain embodiments of the present invention, miR-182 is as set forth in SEQ ID NO:70 to SEQID NO:71.
According to certain embodiments of the present invention, illness choosing freely depression, anxiety, stress, the group that forms of fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia, somnopathy, food associated disorders, retardation of growth and dysgenesia.
According to certain embodiments of the present invention, in the time that microRNA is miR-135, illness is depression or anxiety.
According to certain embodiments of the present invention, cell is neurogliocyte or myocardial cell.
According to certain embodiments of the present invention, miR-19 is as set forth in SEQ ID NO:72 to SEQID NO:76.
According to certain embodiments of the present invention, illness choosing freely stress, the group of anxiety, memory impairment and heart trouble composition.
According to certain embodiments of the present invention, miR-15 is as set forth in SEQ ID NO:77 to SEQID NO:80.
According to certain embodiments of the present invention, illness choosing freely depression, anxiety, stress, the group that forms of fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia, somnopathy, food associated disorders, retardation of growth and dysgenesia.
According to certain embodiments of the present invention, in neurogliocyte and cis acting controlling element to transcribe polynucleotide under control be active.
According to certain embodiments of the present invention, in myocardial cell and cis acting controlling element to transcribe polynucleotide under control be active.
According to certain embodiments of the present invention, miR-181 is as set forth in SEQ ID NO:85 to SEQID NO:94.
According to certain embodiments of the present invention, illness is selected the group of free epileptic seizures, Huntington Chorea, schizophrenia, fragile X mental retardation, generalized anxiety disorder and cancer composition.
According to certain embodiments of the present invention, in neurogliocyte or myocardial cell, cis acting controlling element is active.
According to certain embodiments of the present invention, experimenter is people experimenter.
According to certain embodiments of the present invention, in the time that adjusting comprises the expression of raising Tph2 gene, regulate to be included in and in neurogliocyte, lower miR-181 and/or miR-27.
According to certain embodiments of the present invention, method is further included in the expression of measuring Tph2 gene in neurogliocyte and after miR-181 and/or the miR-27 downward.
According to certain embodiments of the present invention, glutamate receptor gene selects free metabotropic glutamate receptor 1(Grm1), glutamate receptor ionic kainic acid 3(Grik3), metabotropic glutamate receptor 5 (Grm5), glutamate receptor ionic kainic acid 2(Grik2) and metabotropic glutamate receptor 7(Grm7) group of composition.
According to certain embodiments of the present invention, in the time that adjusting comprises the expression of lowering Slc6a4 gene, regulate to be included in and in neurogliocyte, raise miR-135 and/or miR-335.
According to certain embodiments of the present invention, aforesaid method is further included in neurogliocyte and is raising the expression of measuring Slc6a4 gene after miR-135 and/or miR-335.
According to certain embodiments of the present invention, in the time that adjusting comprises the expression of lowering Htr1a gene, regulate to be included in neurogliocyte and raise miR-135, miR-335, miR-181, miR-182 and/or miR-26.
According to certain embodiments of the present invention, method is further included in neurogliocyte and is raising the expression of measuring Htr1a gene after miR-135, miR-335, miR-181, miR-182 and/or miR-26.
According to certain embodiments of the present invention, in the time that adjusting comprises the expression of lowering MaoA gene, regulate to be included in and in neurogliocyte, raise miR-27.
According to certain embodiments of the present invention, method is further included in neurogliocyte and is raising the expression of measuring MaoA gene after miR-27.
According to certain embodiments of the present invention, in the time that adjusting comprises the expression of lowering Adrb1 gene, regulate to be included in neurogliocyte or myocardial cell and raise miR-19.
According to certain embodiments of the present invention, method is further included in neurogliocyte or myocardial cell and is raising the expression of measuring Adrb1 gene after miR-19.
According to certain embodiments of the present invention, in the time that adjusting comprises the expression of lowering CB1 gene, regulate to be included in and in neurogliocyte, raise miR-19.
According to certain embodiments of the present invention, method is further included in neurogliocyte and is raising the expression of measuring CB1 gene after CB1.
According to certain embodiments of the present invention, in the time that adjusting comprises the expression of lowering CRH1 receptor gene, regulate to be included in and in neurogliocyte, raise miR-15.
According to certain embodiments of the present invention, method is further included in neurogliocyte and is raising the expression of measuring CRH1 receptor gene after miR-15.
According to certain embodiments of the present invention, in the time that adjusting comprises the expression of lowering FKBP5 gene, regulate to be included in and in neurogliocyte, raise miR-15.
According to certain embodiments of the present invention, method is further included in neurogliocyte and is raising the expression of measuring FKBP5 gene after miR-15.
According to certain embodiments of the present invention, method obtains blood sample from experimenter before being further included in treatment.
According to certain embodiments of the present invention, thymoleptic select the group of free selectivity serotonin reuptake inhibitors (SSRI), tricyclic antidepressant and NRI (NRI) composition.
According to certain embodiments of the present invention, serotonin associated conditions is mental illness.
According to certain embodiments of the present invention, mental illness choosing freely depression, anxiety, stress, the group that forms of fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia, somnopathy and food associated disorders.
According to certain embodiments of the present invention, miR-135 comprises miR-135a or miR-135b.
Unless otherwise defined, all technology used herein and/or scientific terminology have the identical meanings of conventionally understanding as the technician in field related to the present invention.Although the method and the material that are similar to or be equal to those methods described herein and material can, for the enforcement of embodiments of the present invention or test, be described exemplary method and/or material below.The in the situation that of conflict, be as the criterion with patent specification (comprising definition).In addition, material, method and embodiment are only illustrative and not restrictive.
Brief description of the drawings
Some embodiments by way of example and with reference to the accompanying drawings to describe the present invention only herein.Now at length specifically with reference to accompanying drawing, it is emphasized that the details illustrating is by way of example with for ease of the illustrative discussion of embodiments of the present invention.In this respect, make those skilled in the art understand how to implement embodiments of the present invention together with the description of accompanying drawing.
In the accompanying drawings:
Figure 1A-Fig. 1 I illustrates the expression of microRNA in serotonin (5HT) neurone.Figure 1A is the illustrating of miRNA of differential expression in 5HT neurone.Lowess normalized value is described to spot intensity and changes (MA figure) with respect to the ln2 multiple of average logarithm intensity; Figure 1B is the confirmation of the array result of miR PCR in real time, shows compared with the control, and in 5HT neurone, the level of the raising of miR-375.N=5 5HT cell, n=4 non-5HT.Bar represents mean value ± s.e.m.* P=0.0071; Fig. 1 C is the confirmation of the array result of miR PCR in real time, shows the reduction level of miR-135a in 5HT neurone compared with the control.N=5 5HT cell, n=4 non-5HT.* P=0.0075; Fig. 1 D is the Vean diagram (van figure, van diagram) of representative for the intersection Bioinformatics Prediction of Slc6a4, wherein has 5HT microarray results and lists the miR selecting for vitro test; Fig. 1 E is the Vean diagram of representative for the intersection Bioinformatics Prediction of Htr1a, wherein have 5HT microarray results and and list the miR selecting for vitro test; Fig. 1 F is the Vean diagram of representative for the intersection Bioinformatics Prediction of Tph2, wherein has 5HT microarray results and lists the miR selecting for vitro test; Fig. 1 G is the Vean diagram of representative for the intersection Bioinformatics Prediction of MaoA, wherein has 5HT microarray results and lists the miR selecting for vitro test; Fig. 1 H is the figure of explanation luciferase reporter gene analytical results, shows that miR-181c and miR-27b can target Tph23'UTR; And Fig. 1 I is the figure of explanation luciferase reporter gene analytical results, show that miR-27b can target Htr1a MaoA.
Fig. 2 A-Fig. 2 H illustrates target Slc6a43'UTR(SEQ ID NO:25) and Htr1a3'UTR(SEQ ID NO:27) microRNA.Fig. 2 A illustrates that the miR-135a of target Slc6a43'UTR and miR-135b(are respectively SEQ ID NO:24 and 26); Fig. 2 B illustrates that the miR-135a of target Htr1a3'UTR and miR-135b(are respectively SEQ ID NO:24 and 26); Fig. 2 C is the figure of explanation luciferase reporter gene analytical results, shows that miR-135a and miR-135b can target Slc6a43'UTR.Luciferase analytical data illustrates renilla luciferase activity, and it normalizes to the activity of the Photinus pyralis LUC reporter gene of cotransfection at the 3 ' UTR with described gene and blank carrier or in crossing the HEK293 cell of the carrier transfection of expressing specific miR.Bar represents mean value ± s.e.m.* P=0.014, * * * P=0.0002, for miR-16#, p<0.0535, for miR-27#, P=0.0967; Fig. 2 D is the figure of explanation luciferase reporter gene analytical results, shows that miR-135a, miR-135b, miR-335, miR-181C and miR-26a can target Htr1a3'UTR.* * P<0.0001, * * P=0.0029; Fig. 2 E illustrates the NO:41 for miR-135(SEQ ID NO:27-SEQ ID) the slc6a43'UTR conserved regions of seed coupling; Fig. 2 F illustrates the NO:54 for miR-135(SEQ ID NO:42-SEQ ID) Htr1a3'UTR seed coupling, show that seed 1 only occurs being in mouse 3 ' UTR, and seed 2 is high conservatives; Fig. 2 G is the figure that the reptation behavior of miR-135a and miR-135b is blocked in the sudden change of explanation miR-135 seed coupling in slc6a43'UTR.* * P<0.0001, * * P=0.0032; And Fig. 2 H be explanation separately and together with both the figure of the sudden change of miR-135 seed coupling in Htr1a3'UTR, show that miR-135b passes through two seeds and mates target Htr1a, and miR-135a is only by seed 2 target Htr1a.***P<0.0001。
Fig. 3 A-Fig. 3 J is illustrated in the level of miR-135a and miR-135b under different condition.Fig. 3 A is the explanation figure that the decline of miR-135a level regulates in RN after acute stress.Bar represents mean value ± s.e.m.(n=8 in the 0th group, n=10 in the 90th group, and in the 24th group n=9) * * * P<0.0001.* P=0.0357; Fig. 3 B is the explanation figure that the decline of miR-135b level regulates in RN after acute stress.* * P<0.0001, * * P=0.0055; Fig. 3 C is that explanation gives the figure that after (whether it is independently exposed to social failure (socialdefeat) from mouse), the rising of miR-135a level regulates in RN at acute and chronic imipramine.(contrast chronic salt solution and the chronic imipramine of contrast, n=8; Acute imipramine, n=7; The chronic salt solution of social failure, n=11; The chronic imipramine of social failure, n=9) * * P=0.003; Fig. 3 D is that explanation gives the figure that after (whether it is independently exposed to social failure from mouse), the rising of miR-135b level regulates in RN at acute and chronic imipramine.* P=0.0093; Fig. 3 E illustrates at the acute or chronic SSRI of giving and the figure of the rising of miR-135a level in RN after not being NRI or salt solution.(n=8 in each group, except acute saline n=7) * * * P<0.0001; Fig. 3 F be explanation after the acute or chronic SSRI of giving or NRI in RN the figure of unaltered miR-135b level; Fig. 3 G shows when compared with the control, the figure of the reduction of miR-135a level in the blood plasma of mouse of accepting chronic or acute SSRI.(n=8 in each group, except chronic SSRI and NRI n=7) * * P=0.0004, for acute SSRI, compared with acute saline, and * * P=0.0006, for chronic SSRI, compared with chronic salt solution; Fig. 3 H shows when compared with the control, the figure of unaltered miR-135b level in the blood plasma of mouse of accepting chronic or acute SSRI; Fig. 3 I shows that the scatter diagram shape of the single mouse miR-135a level in RN, shows the reverse dependency in the mouse of accepting SSRI or brine treatment compared with blood plasma; And Fig. 3 J shows compared with the control between the miR-135b level in the mouse of accepting SSRI treatment in RN and blood plasma, there is no the scatter diagram shape of dependency.
Fig. 4 A-Fig. 4 H illustrates the interior expression excessively of the body of miR-135b.Fig. 4 A is the schematic diagram for crossing the slow virus of expressing miR-135b; Fig. 4 B is the figure of explanation PCR in real time result, shows in the nucleus raphes dorsalis (DRN) at adult mice mistake expression miR-135b in body.Bar represents mean value ± s.e.m.(GFP injection, n=5, and miR-135OE, n=3) P=0.0032; Fig. 3 C-D illustrates DRN injection site, wherein by show GFP dyeing at injection site place.(sectional drawing adopts from Paxinos); Fig. 4 E shows compared with control mice, expresses in the mouse of miR-135b the figure of the stationary state time of reducing in RN in forced swimming test in mistake.(contrast, n=9, miR-135, n=9) P=0.0088, in 3 minutes, and P=0.00330,4 minutes; Fig. 4 F shows compared with control mice, in outstanding tail experiment, expresses in the mouse of miR-135b the figure of the stationary state time reducing in mistake in RN.P=0.07351; Fig. 4 G-Fig. 4 H shows compared with the control, in rearging cage motion, excessively expressing in the mouse of miR-135b, not have discrepant figure in RN.
Fig. 5 illustrates according to luciferase gene clone's ADRb13'UTR.Diagram: complete ADRb13'UTR(top), comprise 4 miR-19 binding sites, and the mutant form of ADRb13'UTR (bottom), lack all 4 miR-19 binding sites, be cloned into the downstream of the luciferase gene in Psicheck2 plasmid.
Fig. 6 A-Fig. 6 E illustrates that miR-19b passes through the seed coupling target ADRb13 ' UTR on its 3 ' UTR; Fig. 6 A-Fig. 6 B is the figure that the normalization method luciferase level recording in HT22 cell is described, wherein above-mentioned cell is expressed low endogenous miR-19 level after crossing expression (OE) plasmid (Fig. 6 B) transfection with GFP plasmid (Fig. 6 A) or pre-miR-19b; Fig. 6 C-Fig. 6 E is that explanation is at the figure of expressing the normalization method luciferase level recording in the HEK293T cell of high endogenous miR-19 level.With control plasmid (Fig. 6 C), miR-19b knocks out (KD) probe (Fig. 6 D) or mixed and disorderly probe (scrambled probe) transfection in contrast, and miR-19b miArrest plasmid (Fig. 6 E) or contrast miArrest plasmid transfection.***P<0.005。Carry out normalization method renilla luciferase activity and be expressed as the active ratio that the mutant form (Adrb1-mut) by Adrb1-3'UTR is realized under the condition that has control treatment to exist by Photinus pyralis LUC expression level.
Fig. 7 A-Fig. 7 D is illustrated in the differential expression of miRNA in amygdala (amygdale).Fig. 7 A-Fig. 7 B shows in amygdala the figure of the differential expression of 90 minutes miRNA after acute stress.Fig. 7 A illustrates Agilent (agilent) array result.Fig. 7 b illustrates affymetrix array result.Normalized value is described to spot intensity with respect to the log2 ratio of the average intensity of crossing condition (N=2,2) (stress vs. contrast).The intensity of every kind of miRNA is calculated as crosses over the average normalized intensity that biology repeats.MiR-15a and miR-15b are shown in red.MiR-124(its be not subject to stress scheme the confirmed neurone mark of impact) be shown as white; Fig. 7 C illustrates, miR-15a and miR-15b have corticotropin releasing hormone 1 receptor 3'UTR[CRHR1, changes (adapt) from targetscan(dot) org] semi-conservative seed coupling; And Fig. 7 D is that the uciferase activity recording in the HEK293T cell of expression plasmid or GFP expression plasmid and luciferase reporter gene plasmid (by CRFR1-3'UTR contrast (controlling controlled)) cotransfection is being crossed in explanation with miR-15b-EGFP.Carry out normalization method renilla luciferase activity by Photinus pyralis LUC expression level.
Fig. 8 is the figure of explanation luciferase reporter gene analytical results, shows that miR-182 may target Htr1a3'UTR.Luciferase analytical data illustrates renilla luciferase activity, and it normalizes to the activity of the cotransfection Photinus pyralis LUC reporter gene at the 3 ' UTR with described gene and blank carrier or in crossing the HEK293 cell of the carrier transfection of expressing specific miR.
Fig. 9 is the figure of explanation PCR in real time result of miR-182 expression level in adult mice DRN, shows the trend of the expression reducing after chronic social failure.Data representation mean value ± SEM, contrast n=7 and in social ineffective group 18 mouse, #=p=0.1.
Figure 10 represents the computer simulation of miR-182 target (on silicon, in silico) Vean diagram of Bioinformatics Prediction (two kinds of algorithms), and with the list of the potential target gene of the normal and pathologic neuronal function height correlation occurring in this prediction.
Figure 11 A-Figure 11 C illustrates that the mistake of miR-182 expresses or knock out.Figure 11 A is the schematic diagram for crossing the slow virus of expressing miR-182; Figure 11 B is the figure of explanation PCR in real time result, shows the external expression miR-182 that crosses in N2A clone; And Figure 11 C is the schematic diagram of the slow virus for knocking out miR-182.
Figure 12 A-Figure 12 D is illustrated in the miR-19 level in PFC after NRI that gives.Acute (once) or chronic (18 days) gives NRI Reboxetine.Noticeable, give after NRI acute, in PFC, miR-19a and miR-19b level reduce (Figure 12 A and Figure 12 B respectively), but at chronic raise after giving NRI (Figure 12 C and Figure 12 D respectively).
Figure 13 A-Figure 13 D illustrates, in the level that stands miR-19 in the PFC of social failed mouse and amygdala.In the sample of the amygdala from available from mouse (it stands social failed example), measure miR-19a and miR-19b level.It should be noted that with respect to control mice, in classifying as the mouse of social activity failure " susceptible ", in PFC, miR-19a and miR-19b level rising (being respectively Figure 13 A and Figure 13 B).With respect to control mice, miR-19 level also raise (being respectively Figure 13 C and Figure 13 D) in the amygdala that classify as the mouse to social activity failure " susceptible ".
Figure 14 illustrates the miRNA-19b of target CB13 ' UTR.The plasmid transfection HT-22 cell of expressing miR-19b or GFP contrast by CB13`UTR and mistake causes normalization method luciferase level to reduce by 50%.
Figure 15 A-Figure 15 B is the schematic diagram of the crown section of mouse brain.Figure 15 A is illustrated in the some cores in brain, comprises that BLA(is adapted from (adapting to certainly adapted from) mouse brain by Paxinos and Franklin); The CB1 that Figure 15 B is presented in brain distributes (adapting to from Allen Brain Atlaswww.mouse.brain-map.org/).It should be noted that according to this distribution, it is evident that, in BLA, CB1 enriches.
Figure 16 is the machine-processed schematic diagram of the proposition that memory is consolidated in the Basolateral Nucleus of amygdala (BLA).Kendall compound (CORT) is incorporated into the film not yet characterizing in conjunction with glucocorticoid receptor (mbGR), and it is synthetic with induction Endocannabinoids (eCB) that it activates Gs – cAMP/PKA approach.Endocannabinoids is released to cynapse, and they are incorporated into the CB1 acceptor on the GABA energy end that suppresses GABA release there.This inhibition that GABA discharges can be disinthibited, and norepinephrine (NE) discharges and the NE that increases postsynaptic receptor,β activates, thereby increases the fixed of aversion memory.
Figure 17 A-Figure 17 B is illustrated in the Ago2 in RISC complex body.Figure 17 A is the schematic diagram of Ago2 in RISC complex body, and it mediates the interaction between miRNA and mRNA; Figure 17 B illustrates the western blot analysis carrying out with anti-Ago2 antibody.As when by with Ago2 antibody precipitation once and can see while comparing with IgG1 contrast precipitation full brain sample once, this IP has specificity for Ago2 albumen.It should be noted that for the sample by IgG1 contrast precipitation, Ago2 albumen do not detected.
Figure 18 A-Figure 18 D illustrates social avoidance test.Separately mouse is placed in labyrinth to 3 minutes so that adapt to (Figure 18 A and Figure 18 B), then record the motion mapping by them.After 3 minutes, new ICR mouse is placed in the chamber that is close to mouse on inspection (Figure 18 C and Figure 18 D), and then record will check the motion mapping of mouse.
Figure 19 A is illustrated in hotspot graph (heatmap) diagram of the selected miRNA raising in array.
Figure 19 B is illustrated in the hotspot graph diagram of the selected miRNA lowering in array.
Figure 20 A-Figure 20 B illustrates the miR-15a(Figure 20 A from microarray results) and FKBP5(Figure 20 B) log2 express.Each red point represents the once repetition of array.Control group (CNT) has 4 repetitions, and " susceptible " group (SUSC) has 3 repetitions and " resilience " (recovering Resilient) group (RESIL) has 3 repetitions.Black line is illustrated in the mean value repeating in every group.
Figure 20 C illustrates the 3`UTR sequence (available from targetscan.org) of mouse FKBP5.
Figure 21 A-Figure 21 B illustrates, with respect to control mice, after social activity failure, in " susceptible " mouse, amygdala miR-15a(Figure 21 A) and FKBP5(Figure 21 B) level.It should be noted that in standing social failure and being characterized by the amygdala of " susceptible " mouse miR-15a level raise (Figure 21 A).In standing social failure and being characterized by the amygdala of " susceptible " mouse, FKBP5 level reduces (Figure 21 B).
Figure 22 is the schematic diagram of the 3'UTR of Stx1a, Sgk1 and Adrb2, each self-contained single miRNA-15 binding site.
Figure 23 illustrates, with respect to control mice, and standing in social failed mouse, the level of amygdala miR-181.It should be noted that miR-181 level raises in the amygdala that stand social failed mouse.
Figure 24 illustrates the Vean diagram of the intersection Bioinformatics Prediction that represents miR-181 and glutamate receptor.
Figure 25 is the schematic diagram of the complete 3'UTR of 6 kinds of potential targets of miR-181.
Figure 26 be illustrated in stress after in nuclei of median raphe the expression level of miR182.It should be noted that when stress after while testing 24 hours, as recorded by PCR in real time, the acute 30 minutes fixing expression levels that stress cause the reduction of miR182 in RN.*=P<0.01; In every group, n=8.
Figure 27 A-Figure 27 C illustrates the result that luciferase reporter gene is analyzed, and shows miR182 target DSCAM, L1CAM and TSNAX3'UTR.The data that Figure 27 A explanation luciferase is analyzed, they illustrate renilla luciferase activity, and it normalizes to the activity of cotransfection Photinus pyralis LUC reporter gene in using 3 ' UTR of retouched gene and blank carrier or crossing the N2a cell of the carrier transfection of expressing specific miR.At L1cam(Figure 27 B) and Tsnax(Figure 27 C) retarding effect of the sudden change blocking-up miR182 of miR182 seed coupling in 3'UTR.Bar represents mean value ± s.e.m.*P<0.05，**P<0.01，***P<0.001。
Figure 28 A-Figure 28 D is illustrated in the expression of miR135 in amygdala (AMY) and prefrontal cortex (PFC).Figure 28 A explanation, acute SSRI and NRI improve the miR135a level in AMY; Figure 28 B explanation, compared with salt solution, gives by acute SSRI or NRI, and the miR135b level in AMY is raised; Figure 28 C explanation, chronic SSRI is reduced in the miR135a level in PFC; And Figure 28 D explanation, by acute SSRI or NRI, the miR135b level in PFC is raised and is treated and reduced by chronic SSRI.In every group, n=7-8, *=P<0.05; *=P<0.01; * *=P<0.0001.
Figure 29 A-Figure 29 B is illustrated in the miR135 level of the raising in the mouse recycle system after social failure.Compared with control mice, after social activity failure two weeks, in the blood plasma of mouse, miR135a(Figure 29 A) and miR135b(Figure 29 B) level significantly improves (* *=P<0.01, n=7-16, in every group).
Figure 30 A-Figure 30 E illustrates the confirmation of in vitro and in vivo miR135KD.Figure 30 A-B illustrates the result that luciferase reporter gene is analyzed, and shows miR135b KD construct blocking-up miR135 target Htr1a(Figure 30 A) and slc6a4(Figure 30 B); Figure 30 C is the schematic diagram of miR135bKD and contrast virus vector; Figure 30 D-Figure 30 E illustrates DRN injection site (Figure 30 D adopts from Paxinos), and Figure 30 E is the GFP dyeing with the DRN of miR135KD slow virus infection.
Figure 31 A-Figure 31 G illustrates, in miR135KD mouse, and the anxiety-like behavior of increase and the response weakening to SSRI.Figure 31 A illustrates, tests in (open field test) at spacious, and the behavior of miR135KD mouse is similar to control mice; Figure 31 B illustrates, compared with control mice, and in rising pulse labyrinth, the anxiety-like behavior of the increase of miR135KD mouse; Figure 31 C illustrates, under basic stressed condition, but not after acute stress, compared with control mice, in the dark conversion testing of light, miR135KD mouse spends the more time in bright chamber; Figure 31 D illustrates, under basic stressed condition, but not after acute stress, compared with control mice, more times visits bright chamber miR135KD mouse; Figure 31 E illustrates, under basic stressed condition, but not after acute stress, compared with control mice, miR135KD mouse is mobile less distance in bright chamber; Figure 31 F illustrates, under basic condition and after SSRI gives, in outstanding tail experiment (tail suspension test), between miR135KD mouse and control mice, there is no difference, but, in two groups, compared with basic condition, after SSRI treatment, observe the minimizing of stationary state time.(Figure 31 F-Figure 31 G).In two groups, reduce the stationary state time by SSRI, but compared with the control, at last 2 minutes of test, the minimizing in miR135KD mouse was weakened.～=p<0.1*=p<0.05；**=p<0.01；***=p<0.001。N=10-11 in every group.
Figure 32 is the schematic diagram that miR135 mouse can be induced expression system.Transgenic mice was expressed both sides attaching and is stopped alternately (floxedtransactional stop) before miR135a sequence and GFP reporter gene.Sudden change transgenic mice is only expressed miR135a in 5-HT ePet positive cell.
Figure 33 A-Figure 33 C is illustrated in the confirmation of crossing the mouse species of expressing miR135 in 5-HT neurone.Figure 33 A illustrates, compared with control mice, crosses expression miR135 in the RN of miR135OE mouse.Figure 33 B-Figure 33 C illustrates, in miR135OE mouse RN, miR135 target gene mRNA is lowered, Slc6a4(Figure 33 B) and Htr1a(Figure 33 C) the two is all.#=p<0.1*=p<0.05; In every group, n=4.
Figure 34 A-Figure 34 E illustrates, in miR135OE mouse, and after social activity failure, the anxiety of minimizing and behavior depression.Figure 34 A illustrates, in spacious experiment, miR135OE mouse has the anxiety-like behavior of minimizing; Figure 34 B illustrates, in the dark conversion testing of light, compares less anxiety-like behavior with contrasting of miR135OE mouse; Figure 34 C illustrates, in rising pulse labyrinth, compares the anxiety-like behavior of minimizing with contrasting of miR135OE mouse; Figure 34 D illustrates, in outstanding tail experiment, compared with the control, the tendency of the stationary state time of the minimizing of miR135OE mouse; And Figure 34 E illustrates, in forced swimming test, compared with the control, the stationary state time reducing in miR135OE mouse.#=p<0.1*=p<0.05; *=p<0.01n=7-11, in every group.
Embodiment
The present invention, in its some embodiments, relates to microRNA, and more specifically but do not relate to exclusively microRNA and be applied to medical diagnosis on disease, monitoring and treatment.
With reference to accompanying drawing and the explanation of enclosing, the principle that the present invention may be better understood and operation.
Explaining in detail before at least one embodiment of the present invention, should be understood that, application of the present invention be not necessarily limited to statement in the following description or by the illustrational details of embodiment.Can implement in every way or put into practice or carry out the present invention.In addition, should be understood that, the phrase and the term that adopt are herein for illustrative purposes, and should not be regarded as restrictive.
Previously established in the serotonergic activity of imbalance and mental disorder as the association between anxiety and depression, but the not yet complete basic molecular mechanism that is deconstructed into these diseases.MicroRNA (miR) is the subset of small RNA molecular, and its adjusting is transcribed rear genetic expression and enriched in brain.
In the time that enforcement is of the present invention, the present inventor has been found that specific microRNA (miR) participates in the adjusting of serotonin (5HT) neuroglia genes involved, and the illness that therefore relates to adjusting and abnormal serotonin Horizontal correlation is as mental disorder.
As hereinafter and illustrated in the embodiment part of following, the present inventor has determined the miR expression pattern in 5HT neurone, it reports mouse (ePET-YFP) nuclei of median raphe (RN) available from 5HT, wherein utilizes miR microarray (referring to the table 2A-table 2B in the embodiment part of following).Analysis of biological information available from unique miR expression and distribution of the serotonin serotonergic neuron of array to determine miR, the serotonergic genes involved of its supposition target key, as serotonin translocator (Slc6a4, Fig. 1 D), serotonin autoreceptor (Htr1a, Fig. 1 E), tryptophan hydroxylase 2(Tph2, Fig. 1 F) and monoamine hydroxylase (MaoA, Fig. 1 G).Further vitro test is for the miRNA target of the 3'UTR of these genes, and this for example illustrates specific miR(, miR-135), it is target and adjusting 5HT neurone gene (referring to Fig. 1 H-Fig. 1 I and Fig. 2 C-Fig. 2 D) specifically.The present inventor further illustrates, and after acute stress (Fig. 3 A-Fig. 3 D) and with (Fig. 3 E-Fig. 3 J) after antidepressive treatment, the miR-135 expression level in RN and blood plasma is changed.After social activity failure, in the RN of adult mice, in body, miR-135 crosses to express and has reduced behavior depression (Fig. 4 A-Fig. 4 H).In addition, the present inventor has illustrated, miR-182 as the activity of neuronal activity (by directly suppressing Htr1a, Fig. 8) and the active regulon of spiritual pathology behavior (Fig. 9) and miR-15 as the activity of the regulon of stress reaction [by direct inhibition CRH1R(Fig. 7 A-Fig. 7 B), FKBPL 5(FKBP5) (Figure 21 A-Figure 21 B) and Stx1a, Sgk1 and Adrb2(Figure 22)].The present inventor also illustrates, by miR-19, Beta-3 adrenergic receptor (Adrb1) and Cannabined receptor 1(CB1) particular target to.MiR-19 crosses expression inhibiting Adrb1(Fig. 6 A-Fig. 6 C) miR-19 knock out strengthen Adrb1 express (Fig. 6 D-Fig. 6 E).MiR-19 crosses expression and also suppresses CB1(Figure 14).The present inventor it has also been found that the target for miR-181.Specifically, the present inventor illustrates, miR-181 regulates glutamate receptor (Figure 24 and Figure 25) specifically.To sum up, these results have confirmed, by miRNA or the sequence that regulates it if miR-135, miR-335, miR-181, miR-182, miR-26, miR-27, miR-15 and miR-19 are as treatment pattern.
Therefore, according to one aspect of the present invention, provide and in its experimenter of needs, treated the method that the wherein raising of serotonin level is illness useful in treatment, the method comprises and gives experimenter by the exogenous polynucleotide of at least one microRNA of coding or its precursor or at the encode exogenous polynucleotide of at least one microRNA or its precursor of experimenter's cells.
According to a kind of embodiment, being used for the treatment of the wherein raising of serotonin level is the upper useful illness for the treatment of, and above-mentioned microRNA comprises miR-135, miR-335, miR-26 and miR-182.
According to another aspect of the present invention, provide in its experimenter of needs treatment wherein low suprarenin or noradrenaline levels be the method for illness useful in treatment, the method comprises and gives experimenter by the exogenous polynucleotide of coding microRNA or its precursor or at experimenter's cells coding microRNA or the exogenous polynucleotide of its precursor.
According to a kind of embodiment, being used for the treatment of wherein low suprarenin or noradrenaline levels is the upper useful illness for the treatment of, and above-mentioned microRNA comprises miR-19.
According to another aspect of the present invention, provide in its experimenter of needs treatment wherein low corticotropin releasing hormone (CRH) level be the method for the upper useful illness for the treatment of, the method comprises and gives experimenter by the exogenous polynucleotide of coding microRNA or its precursor or at experimenter's cells coding microRNA or the exogenous polynucleotide of its precursor.
According to a kind of embodiment, being used for the treatment of wherein low corticotropin releasing hormone (CRH) level is the upper useful illness for the treatment of, and above-mentioned microRNA comprises miR-15.
According to another aspect of the present invention, provide in its experimenter of needs treatment wherein low L-glutamic acid receptor level be the method for illness useful in treatment, the method comprises and gives experimenter by the exogenous polynucleotide of coding microRNA or its precursor or at experimenter's cells coding microRNA or the exogenous polynucleotide of its precursor.
According to a kind of embodiment, being used for the treatment of wherein low L-glutamic acid receptor level is the upper useful illness for the treatment of, and above-mentioned microRNA comprises miR-181.
Term " treatment " refers to and suppresses or stop the development of disease, obstacle or illness and/or cause weakening, alleviate or disappearing of disease, obstacle or illness, or prevent from occurring disease, obstacle or illness in experimenter, wherein above-mentioned experimenter can have the risk of disease, obstacle or illness, suffers from disease, obstacle or illness but be not yet diagnosed as.It will be understood by those skilled in the art that the whole bag of tricks and measure to be used for the development of assess disease, obstacle or illness, and similarly, the whole bag of tricks and measuring can be used for weakening, alleviating or disappearing of assess disease, obstacle or illness.
As used in this article, term " experimenter " comprises Mammals, preferably under any age, suffers from the mankind of pathology.Preferably, the dangerous individuality with development pathology contained in this term.
As used in this article, phrase " wherein the raising of serotonin level is the upper useful illness for the treatment of " refers to such disease or obstacle: the level that wherein improves serotonin can prevent the generation of disease or relative medical symptom, or stops progression of disease or relative medical symptom (as described in further detail below).
As used in this article, term " serotonin " refers to monoamine neurotransmitter [being also called as serotonin (5-HT)].Serotonin is set forth in for example CAS 50-67-9.
According to a kind of embodiment, method for improve serotonin level in synaptic cleft is provided, and the method comprises the exogenous polynucleotide of coding at least one microRNA or its precursor is given to experimenter or for example express the exogenous polynucleotide of at least one microRNA of coding or its precursor experimenter in serotonin serotonergic neuron at neurogliocyte.
As used in this article, term " synaptic cleft " refers to the region between two neurones, and electronics or chemical signal pass through by it.
" neurogliocyte " refers to neurone or neurogliocyte (for example, oligodendrocyte or astroglia cell).
As used in this article, term " serotonin serotonergic neuron " refers to such neurone: its secretion serotonin or can serotonin reuptake (, by expressing the Serotonin Transporter on their cell surface).
Wherein the raising of serotonin level is that the upper useful illness for the treatment of can comprise, for example, any emotional maladjustment, comprise depression, anxiety, stress, fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia; Somnopathy, food associated disorders, retardation of growth and dysgenesia.
According to a kind of embodiment, wherein the raising of serotonin level is that the upper useful illness for the treatment of comprises depression.
According to a kind of embodiment, in the time that illness is depression or anxiety, microRNA is miR-135.
Be understandable that, depression or anxiety may be not necessarily relevant to serotonin.
As used in this article, phrase " wherein low suprarenin or noradrenaline levels are the upper useful illnesss for the treatment of " refers to such disease or obstacle: the expression or the activity that wherein reduce suprarenin or norepinephrine can prevent the generation of disease or relative medical symptom or stop progression of disease or relative medical symptom (as described in further detail below).
As used in this article, term " suprarenin " refers to hormone and neurotransmitter (being also called as suprarenin).Suprarenin is set forth in for example CAS 51-43-4.
As used in this article, term " norepinephrine (noradrenaline) " refers to the catecholamine (being also called as norepinephrine (norepinephrine)) as hormone and neurotransmitter.Norepinephrine is set forth in for example No. CAS (l) 51-41-2 (l) and 138-65-8 (dl)).
Wherein low suprarenin or noradrenaline levels are that the upper useful illness for the treatment of can comprise, for example, stress-related disorder, anxiety, memory impairment, heart trouble (for example palpitaition, tachycardia, irregular pulse), have a headache, tremble, hypertension and acute lung edema.
As used in this article, phrase " wherein low corticotropin releasing hormone (CRH) level is the upper useful illness for the treatment of " refers to such disease or obstacle: the expression or the activity that wherein reduce CRH can prevent the generation of disease or relative medical symptom or stop progression of disease or relative medical symptom (as described in further detail below).
As used in this article, term " corticotropin releasing hormone (CRH) " refers to polypeptide hormone and neurotransmitter (being also called as corticotropin releasing factor (CRF) or corticoliberin).CRH is set forth in for example NP_000747.1.
Wherein in low CRH level, the upper useful illness for the treatment of can comprise, for example, stress, depression, anxiety, stress, fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia, somnopathy, food associated disorders, retardation of growth, dysgenesia and obesity.
As used in this article, phrase " wherein low L-glutamic acid receptor level is the upper useful illness for the treatment of " refers to such disease or obstacle: the expression or the activity that wherein reduce glutamate receptor can prevent the generation of disease or relative medical symptom or stop progression of disease or relative medical symptom (as described in further detail below).
As used in this article, term " glutamate receptor " refers to the cynapse acceptor (for example, Grm1, Grik3, Grm5, Gria2, Grik2 and Grm7) on the film that is usually located at neuronal cell.Glutamate receptor is set forth in for example NP_000822.2[glutamate receptor ionic kainic acid 3(Grik3)]; NP_000817.2, NP_001077088.1, NP_001077089.1[glutamate receptor ionic AMPA2(Gria2)]; NP_001159719.1, NP_068775.1, NP_786944.1[glutamate receptor ionic kainic acid 2(Grik2)]; NP_000833.1, NP_001137303.1[metabotropic glutamate receptor 5 (Grm5)]; NP_000835.1, NP_870989.1[metabotropic glutamate receptor 7(Grm7)]; NP_000829.2, NP_001107801.1[metabotropic glutamate receptor 1(Grm1)].
Wherein low L-glutamic acid receptor level is that the upper useful illness for the treatment of can comprise, for example, and epileptic seizures (for example epilepsy), Huntington Chorea, schizophrenia, fragile X mental retardation, generalized anxiety disorder and cancer (for example melanoma).
As used in this article, term " microRNA or its precursor " refers to as the microRNA of transcribing rear regulon (miRNA) molecule.MicroRNA is processing microRNA precursor before front miR(conventionally).Front miR is one group of precursor miRNA molecule of being transcribed by rna plymerase iii, and it is processed into functional miRNA effectively, for example, enters after culturing cell in transfection.Normally not expressing in the cell type of this miRNA, front miR can be used for bringing out specific miRNA activity, therefore guides the function of (adress) its target by lower the expression of its target in " (miRNA) obtain function (gain of(miRNA) function) " experiment.There is front miR design and can be easy to be designed for any research for all known miRNA listing in miRNA registration table.Can with itself or coding from be connected in nucleic acid construct precursor molecule (as described further below) give cell by microRNA.
Be understandable that, the microRNA of this instruction can in conjunction with, connect, regulate, processing, disturb, strengthen, stable and/or remove to stablize any microRNA target.Such target can be any molecule, include but not limited to DNA molecular, RNA molecule and polypeptide, as but be not limited to serotonin genes involved, as serotonin translocator (, SERT or Slc6a4), serotonin inhibition acceptor 1a(Htr1a), tryptophan hydroxylase 2(Tph2) and monoamine hydroxylase (MaoA); Adrenoceptor or norepinephrine receptor (adrenergic receptor is as Adr1); Adenylate cyclase 1 type (ADCY1); Crh receptor is as Crh1R; Or any other molecule, for example FKBPL 5(FKBP5), Cannabined receptor 1(CB1), the relevant X protein (Tsnax) of Down's syndrome cell adhesion molecule (Dscam), Translin and cell adhesion molecule L1(L1cam) (all describing in further detail hereinafter).
Be understandable that, can pass through various databases, comprise for example microRNA registration table (http://wwwdotsangerdotacdotuk/Software/Rfam/mirna/indexdotshtml), determine microRNA of the present invention.
Can be by the exogenous polynucleotide of coding microRNA being given to experimenter or implementing method of the present invention at the exogenous polynucleotide of experimenter's cells coding microRNA.
Term " polynucleotide " refers to strand oligomer or double-stranded oligomer or the polymer of Yeast Nucleic Acid (RNA), thymus nucleic acid (DNA) or their stand-in.This term comprises polynucleotide and/or oligonucleotide, it (is for example derived from naturally occurring nucleic acid molecule, RNA or DNA), synthetic polyribonucleotides and/or oligonucleotide molecules, it by key between naturally occurring base, sugar and covalency nucleosides (for example, main chain) form, and there is synthetic polyribonucleotides and/or the oligonucleotide of the part (its effect is similar to corresponding naturally occurring part) of non-natural existence.
The length of polynucleotide of the present invention is chosen as 100 Nucleotide or still less, be chosen as 90 Nucleotide or still less, be chosen as 80 Nucleotide or still less, be chosen as 70 Nucleotide or still less, be chosen as 60 Nucleotide or still less, be chosen as 50 Nucleotide or still less, be chosen as 40 Nucleotide or still less, be chosen as 30 Nucleotide or still less, for example, 29 Nucleotide, 28 Nucleotide, 27 Nucleotide, 26 Nucleotide, 25 Nucleotide, 24 Nucleotide, 23 Nucleotide, 22 Nucleotide, 21 Nucleotide, 20 Nucleotide, 19 Nucleotide, 18 Nucleotide, 17 Nucleotide, 16 Nucleotide, 15 Nucleotide, 12 to 24 Nucleotide alternatively, alternatively between 5-15, alternatively between 5-25, most preferably, an about 20-25 Nucleotide.
Can be according to any oligonucleotide synthesis method being known in the art, comprise that enzymatic synthesizes or solid phase synthesis, produce according to the polynucleotide (comprising oligonucleotide) of instruction design of the present invention.For carry out the instrument of solid phase synthesis and reagent can be commercial available from, for example, Applied Biosystems.Can also adopt for above-mentioned any other synthetic mode; the reality of oligonucleotide is synthetic to be in those skilled in the art's limit of power and can to complete by ripe method; as be specified in; for example: Sambrook; J.and Russell; D.W. (2001), " Molecular Cloning:A LaboratoryManual "; Ausubel, R.M.et al., eds. (1994,1989), " Current Protocols inMolecular Biology, " Volumes I-III, John Wiley & Sons, Baltimore, Maryland; Perbal, B. (1988), " A Practical Guide to Molecular Cloning, " John Wiley & Sons, New York; And Gait, M.J., ed. (1984), " Oligonucleotide Synthesis "; Adopt solid state chemistry, for example cyanoethyl phosphoramidite (cyanoethyl phosphoramidite), then removes protection, desalination and purifying, and it passes through, for example, and automatization trityl method (trityl-on method) or HPLC.
Be understandable that the polynucleotide (as described further below) that can utilize expression vector to produce to comprise RNA molecule.
Preferably, polynucleotide of the present invention are polynucleotide of modifying.Can utilize the whole bag of tricks being known in the art to modify polynucleotide.
For example, oligonucleotide of the present invention or polynucleotide can comprise heterocycle nucleosides, and it is made up of purine and pyrimidine bases, and with 3'-to-5' phosphodiester bond bonding.
The oligonucleotide preferably using or polynucleotide are those adorned oligonucleotide or polynucleotide (as broadly described hereinafter) in key or base between main chain, nucleosides.
The specific examples of operable according to this aspect of the invention preferred oligonucleotide or polynucleotide comprises the oligonucleotide or the polynucleotide that comprise key between modification main chain or non-natural nucleoside.Oligonucleotide or the polynucleotide with modification main chain comprise those oligonucleotide or polynucleotide, it retains phosphorus atom in main chain, as be disclosed in U.S. Patent number US4, 469, 863, US4, 476, 301, US5, 023, 243, US5, 177, 196, US5, 188, 897, US5, 264, 423, US5, 276, 019, US5, 278, 302, US5, 286, 717, US5, 321, 131, US5, 399, 676, US5, 405, 939, US5, 453, 496, US5, 455, 233, US5, 466, 677, US5, 476, 925, US5, 519, 126, US5, 536, 821, US5, 541, 306, US5, 550, 111, US5, 563, 253, US5, 571, 799, US5, 587, 361, and US5, 625, 050.
Preferably modified oligonucleotide or polynucleotide main chain comprise, for example: thiophosphatephosphorothioate; Chirality thiophosphatephosphorothioate; Phosphorodithioate; Phosphotriester; Aminoalkyl group phosphotriester; Methyl and other phosphonate esters, comprise 3'-alkylene phosphonic acids ester and chiral phosphonate; Phosphinate; Phosphoramidite, comprises the amino phosphoramidite of 3'-and aminoalkyl group phosphoramidite; Sulfo-phosphoramidite; Alkylthio phosphonic acid ester; Alkylthio phosphotriester; And there is the borine substituted phosphate (boranophosphates) of normal 3'-5' key, their 2'-5' keyed jointing analogue, and those have the borine substituted phosphate of reversed polarity, wherein the phase adjacency pair of nucleosides unit connects in the mode of 3'-5' to 5'-3' or 2'-5' to 5'-2'.Can also use various salt, mixing salt and the free acid form of above-mentioned modification.
Alternately, the modified oligonucleotide or the polynucleotide main chain that wherein do not comprise phosphorus atom have such main chain, and it is by key between short-chain alkyl or cycloalkyl nucleosides, mixes between heteroatoms and alkyl or cycloalkyl nucleosides key between key or one or more short chain heteroatoms or heterocycle nucleosides and form.These main chains comprise that those have the main chain of morpholino key (part forms the sugar moieties from nucleosides), siloxane main chain, sulfide, sulfoxide and sulfone main chain, formyl radical and thioformyl main chain, methylene radical formyl radical and thioformyl main chain, the main chain that comprises alkene, sulfamate backbone, methylene radical imino-and methylene radical diazanyl main chain, sulphonate and sulphonamide main chain, amide backbone, and there is N, O, S and the CH of mixing 2other main chains of integral part, as be disclosed in U.S. Patent number US5, 034, 506, US5, 166, 315, US5, 185, 444, US5, 214, 134, US5, 216, 141, US5, 235, 033, US5, 264, 562, US5, 264, 564, US5, 405, 938, US5, 434, 257, US5, 466, 677, US5, 470, 967, US5, 489, 677, US5, 541, 307, US5, 561, 225, US5, 596, 086, US5, 602, 240, US5, 610, 289, US5, 602, 240, US5, 608, 046, US5, 610, 289, US5, 618, 704, US5, 623, 070, US5, 663, 312, US5, 633, 360, US5, 677, 437 and US5, 677, 439.
According to the present invention, operable other oligonucleotide or polynucleotide are those oligonucleotide or polynucleotide of being modified in key between sugar and nucleosides, that is, the main chain of nucleotide units is replaced by new group.Keep elementary cell with suitable polynucleotide target complementation.The example of such oligonucleotide mimetic comprises peptide nucleic acid(PNA) (PNA).PNA oligonucleotide refers to the main chain of the involved acid amides of sugar backbone wherein, the oligonucleotide that amino-ethyl glycine main chain replaces in particular.Base is retained and is incorporated into directly or indirectly the aza nitrogen atom of the amide moieties of main chain.The United States Patent (USP) of the preparation of instruction PNA compound includes but not limited to U.S. Patent number US5,539,082, US5,714,331 and US5,719,262, be incorporated into herein with way of reference separately.Operable other backbone modifications are disclosed in U.S. Patent number US6,303,374 in the present invention.
Oligonucleotide of the present invention or polynucleotide can also comprise base modification or replacement.As used in this article, " unmodified " or " natural " base comprises purine base adenine (A), guanine (G), pyrimidine bases thymus pyrimidine (T), cytosine(Cyt) (C) and uridylic (U)." modify " base and include but not limited to other synthetic and natural bases, as: 5-methylcytosine (5-me-C); 5-hydroxymethyl cytosine; Xanthine; Xanthoglobulin; 2-aminoadenine; The 6-methyl of VITAMIN B4 and guanine and other alkyl derivatives; The 2-propyl group of VITAMIN B4 and guanine and other alkyl derivatives; 2-paper substrate, 2-thio-thymine and 2-sulfo-cytosine(Cyt); 5-halo uridylic and cytosine(Cyt); 5-proyl uridylic and cytosine(Cyt); 6-azo uridylic, cytosine(Cyt) and thymus pyrimidine; 5-uridylic (pseudouracil); 4-paper substrate; VITAMIN B4 and guanine that 8-halogen, 8-amino, 8-thiol, 8-alkylthio, 8-hydroxyl and other 8-replace; 5-halogen, 5-bromine, 5-trifluoromethyl and other 5-replace in particular uridylic and cytosine(Cyt); 7-methyl guanine and 7-methyladenine; Guanozola and 8-azaadenine; 7-deazaguanine and 7-denitrogenation VITAMIN B4; And 3-deazaguanine and 3-denitrogenation VITAMIN B4.Other modified base comprises those bases, and it is disclosed in: U.S. Patent number US3,687,808; Kroschwitz, J.I., ed. (1990), " The Concise EncyclopediaOf Polymer Science And Engineering, " pages858-859, John Wiley & Sons; Englisch et al. (1991), " Angewandte Chemie, " International Edition, 30,613; And Sanghvi, Y.S., " Antisense Research and Applications, " Chapter15, pages289-302, S.T.Crooke and B.Lebleu, eds., CRC Press, 1993.Above-mentioned modified base is particularly useful for improving the binding affinity of oligomeric compound of the present invention.These modified bases comprise pyrimidine, 6-aza-pyrimidine and N-2, the N-6 of 5-replacement and the purine that O-6-replaces, and comprise 2-aminopropyl VITAMIN B4,5-proyl uridylic and 5-proyl cytosine(Cyt).5-methylcytosine replaces demonstration and can improve nucleic acid duplex stability and reach 0.6-1.2 DEG C of (Sanghvi, Y.S.et al. (1993), " Antisense Research and Applications; " pages276-278, CRC Press, BocaRaton), and be that at present preferred base replaces, even more particularly when with the sugar-modified combination of 2'-O-methoxy ethyl.
According to a kind of embodiment, miRNA polynucleotide of the present invention have the nucleotide sequence (referring to table 1A) as set forth in SEQ IDNO:58-SEQ ID NO:94.
Table 1A:miRNA polynucleotide sequence
Sequence miRNA
SEQ?ID?NO:77-SEQ?ID?NO:80 miR-15
SEQ?ID?NO:72-SEQ?ID?NO:76 miR-19
Sequence miRNA
SEQ?ID?NO:65-SEQ?ID?NO:69 miR-26
SEQ?ID?NO:81-SEQ?ID?NO:84 miR-27
SEQ?ID?NO:58-SEQ?ID?NO:62 miR-135
SEQ?ID?NO:85-SEQ?ID?NO:94 miR-181
SEQ?ID?NO:70-SEQ?ID?NO:71 miR-182
SEQ?ID?NO:63-SEQ?ID?NO:64 miR-335
As mentioned in the text and illustrate in embodiment part subsequently, microRNA is the molecule that is derived from the processing of specific precursor (, front miRNA), utilize specific miRNA precursor molecule can realize the rise of specific miRNA function.
The also sequence of imagination and miRNA and their precursor homology.For ripe miRNA, homology level should be relatively high, but (for example allow higher degree of freedom (more ordersof freedom) in precursor level, at least 60%, 70%, 80%, 85%, 90%, 95% or more than), as long as sequence change be in hairpin instead of in the nucleic acid fragment corresponding to ripe miR.
Conventionally give target cell (for example neurogliocyte or myocardial cell) using such precursor polynucleotide agent as a part for expression construct.In this case, polynucleotide agent is for example connected in nucleic acid construct, under the control of cis-acting regulatory element (promotor), and above-mentioned cis-acting regulatory element can for example, guide the expression of microRNA in target cell (neurogliocyte or myocardial cell) with composing type or induction type mode.
The example of microRNA polynucleotide of the present invention agent includes but not limited to for example GenBank accession number NR_029485RNA of miR-15(), miR-19(is GenBank accession number NR_029489.1 for example), miR-26(is GenBank accession number NR_029500 and NR_029499 for example), miR-27(is GenBank accession number NR_029501RNA for example), miR-135(is GenBank accession number NR_029677.1 for example), miR-335(is GenBank accession number NR_029899.1 for example), miR-181(is GenBank accession number NR_029611.1 for example) and for example GenBank accession number NR_029614 of miR-182().
The example of neuronal cell specificity promoter includes but not limited to synapsin promotor, calmodulin promotor and the Thy1 promotor of neuronspecific enolase gene promoter, synapsin promotor, enhancing.
The example of myocardial cell's specificity promoter includes but not limited to heart NCX1 promotor and α-myoglobulin heavy chain (α MHC) promotor.
Expression construct of the present invention can also comprise other sequence, and it makes it be suitable for copying and integrating in eukaryotic cell (for example, shuttle vectors).Typical cloning vector comprises transcribes and translation initiation sequence (for example, promotor, enhanser) and transcribing and translation termination (for example, polyadenylation signal).Expression construct of the present invention may further include enhanser, and it can be close to or also can be used for turning from it record away from promoter sequence.
Enhancer element can stimulate homology or the allogeneic promoter from connecting to transcribe and reach to 1,000 times.In the time being placed on the downstream of transcription initiation site or upstream, enhanser is active.The many enhancer elements that are derived from virus have widely host range and in Various Tissues, are active.For example, SV40 early gene enhanser is applicable to many cell types.Be applicable to other enhancers/promoters combination of the present invention and comprise those combinations: it is derived from polyomavirus or people or mouse cytomegalovirus (CMV) and the long tandem repetitive sequence (LTR) from miscellaneous retroviruses (as mouse leukaemia virus, mouse or Rous sarcoma virus and HIV).Referring to Gluzman, Y.and Shenk, T., eds. (1983) .Enhancers and Eukaryotic Gene Expression, Cold SpringHarbor Press, Cold Spring Harbor, N.Y., it is incorporated into herein with way of reference.
Polyadenylation sequence can also be added expression construct of the present invention to improve the efficiency of expression that can test section.For accurate and effective polyadenylation, need two kinds of different sequential elements: be positioned at the rich GU in downstream in polyadenylation site or the sequence of rich U; And the highly conserved sequence of 6 Nucleotide, i.e. AAUAAA, it is positioned at 11-30 Nucleotide place of the upstream in above-mentioned site.Be applicable to termination and polyadenylation signal that termination of the present invention and polyadenylation signal comprise that those are derived from SV40.
Except the embodiment of having described, expression construct of the present invention conventionally can comprise other its be used for improving the expression level of cloning nucleic acid or be used for promoting the specialized element of identification of the cell that carries recombinant DNA.For example, some animal viruss comprise the DNA sequence dna promoting allowing virus genomic extrachromosomal replication in cell type.Episomal replication is with the plasmid of these virus replication, as long as provide the suitable factor by being carried at gene on plasmid or the genome of host cell.
Expression construct of the present invention can or can not comprise eucaryon replicon.If there is eucaryon replicon, utilize appropriate selection mark, can be in eukaryotic cell amplification vector.If construct does not comprise eucaryon replicon, sequestered amplification is impossible.On the contrary, recombinant DNA is incorporated into the genome of engineering cell, and wherein promotor guides the expression of desired nucleic acid.
Can utilize suitable gene delivery vector/method (transfection, transduction etc.) and suitable expression system that nucleic acid construct is introduced to target cell of the present invention (for example neurogliocyte or myocardial cell).
The example of mammalian expression vector include but not limited to pcDNA3, pcDNA3.1(+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41 and pNMT81, more than can be available from Invitrogen; PCI, it can be available from Promega; PMbac, pPbac, pBK-RSV and pBK-CMV, more than can be available from Strategene; PTRES, it can be available from Clontech; And their derivative.
Can also use the expression vector comprising from eucaryon virus as retroviral regulatory element.SV40 carrier comprises for example pSVT7 and pMT2.The carrier that is derived from bovine papilloma virus comprises pBV-1MTHA, and the carrier that is derived from Epstein-Barr virus comprises pHEBO and p2O5.Other exemplary carrier comprise pMSG, pAV009/A +, pMTO10/A +, pMAMneo-5 and baculovirus pDSVE.
System based on lipid can be used for these constructs to send and enter target cell of the present invention (for example neurogliocyte or myocardial cell).
Liposome comprises any synthetic (that is, the non-natural exists) structure being made up of lipid bilayer, and it seals a constant volume.Liposome comprises milk sap, foam, micelle, insoluble monolayer, liquid crystal, phosphatide dispersion, platy layer etc.Can prepare liposome [Monkkonen, J.et al., 1994, J.Drug Target, 2:299-308 by any known method in this area; Monkkonen, J.et al., 1993, Calcif.Tissue Int., 53:139-145; Lasic D D., Liposomes Technology Inc., Elsevier, 1993,63-105.(chapter3); Winterhalter M, Lasic D D, Chem PhysLipids, 1993September; 64(1-3): 35-43].Liposome can be positively charged, neutrality or electronegative.For mononuclear phygocyte system (MPS) picked-up, liposome can be hydrophobic, and this is can be to be difficult for occurring MPS picked-up because the wetting ability of liposome membrane is sheltered (for example,, by the lipid and the hydrophilic particle that utilize polyoxyethylene glycol to connect).Further preferably, liposome does not comprise bulk shield lipid as Sphingolipids,sialo-GM 1and phosphatidylinositols, this is because these lipids prevent MPS picked-up.
Liposome can be that single lipid layer can be maybe multi-disc layer.If therapeutical agent is hydrophilic, can utilize larger unilamellar vesicle further to improve sending of it, this is the larger internal capacity due to them.On the contrary, if therapeutical agent is hydrophobic, can utilize multilamellar vesicle further to improve sending of it.Alternately, therapeutical agent (for example oligonucleotide) can not penetrate lipid bilayer, therefore maintenance is adsorbed in to surface of liposome.In this case, the surface-area that increases liposome can further improve sending of therapeutical agent.Suitable liposome according to the present invention be non-toxicity liposome as, for example, those preparations are from the lipid of phosphatidylcholine phospho-glycerol and cholesterol.The diameter range of the liposome using can be 0.1-1.0 micron.But, can also use and be adapted to pass through cytophagous phagocytotic other size ranges.For making liposome setting (sizing liposomes), can use homogenizing, it relies on shears and larger liposome can be fragmented into less liposome.Can comprise the Boston by Microfluidics of by homogenizer easy to use, the microfluidization device that MA manufactures.In typical homogenizing program, carry out recirculation liposome until observe selected liposome size by standard emulsion homogenizer.Can differentiate (laser beam particle sizediscrimination) by conventional laser beam particle size and monitor particle size distribution.Extruding liposome by aperture polycarbonate membrane or asymmetric ceramic membrane is the effective ways for liposome size being reduced to the distribution of sizes relatively clearly limiting.Conventionally,, by film one or many loop suspension, distribute until realize desired liposome size.Can extrude liposome to realize reducing gradually of liposome size by less pore membrane successively.
Can the agent of microRNA polynucleotide be added to liposome by any method being known in the art.For example, the agent of microRNA polynucleotide can be encapsulated in liposome.Alternately, it can be attracted on surface of liposome.Can be used for medicament to add the additive method of liposome of the present invention is that those are by Alfonso et al., method [the The science and practice ofpharmacy describing, Mack Publishing, Easton Pa19th ed., ] and those methods of being described by Kulkarniet al. [J.Microencapsul.1995,12 (3) 229-46] (1995).
The liposome using is in the method for the invention preferably through alveolar-capillary barrier.Therefore, liposome of the present invention does not preferably comprise alveolar-capillary barrier target polysaccharide (for example seminose) in their membranous part.Preferably, liposome of the present invention does not comprise peptide in their membrane portions, and it is the acceptor on alveolar-capillary barrier by liposome target.The example of above-mentioned peptide includes but not limited to transferrin, Regular Insulin, the anti-transferrin receptor antibodies of IGF-1, IGF-2, anti-insulin receptor antibody, anti-IGF-1 receptor antibody and anti-IGF-2 receptor antibody.
In order to determine the liposome of the particularly suitable according to the present invention; can carry out screening assay as mensuration; it is described in Application No. US20040266734 and Application No. US20040266734 and Danenberg et al.; Journal of cardiovascular pharmacology2003,42:671-9; Circulation2002,106:599-605; Circulation2003,108:2798-804.
The carrier of operable according to this aspect of the invention other non-lipids (non-lipid based) includes but not limited to polylysine and branch-shape polymer.
Expression construct can also be virus.The example of virus formulation body includes but not limited to adenovirus carrier, retroviral vector, vaccinia virus vector, gland relevant viral vector (adeno-associatedviral vectors), polyomavirus vector, α virus vector, rhabdovirus carrier, lentiviral vectors and herpesvirus vector.
Retroviral vector is to be specially adapted to a class carrier of the present invention.Defective type retrovirus is conventional for transgenosis is entered to mammalian cell (about summary, referring to Miller, A.D.(1990) .Blood76,271).Can utilize well-known molecular engineering to build the recombinant retrovirus that comprises polynucleotide of the present invention.Can remove the part of reverse transcription virus gene group to give retrovirus replicanism defect, then replication defect type retrovirus can packagedly enter virion, and it can be used for by adopt standard technique to carry out target cell infection with helper virus simultaneously.For Restruction retrovirus in or body outer by virosome and can be referring to for the scheme of cells infected, for example, Ausubel et al. (1994) Current Protocols in Molecular Biology(Greene Publishing Associates, Inc. & John Wiley & Sons, Inc.).Retrovirus has been used for several genes to introduce many different cell types, comprises neuronal cell, epithelial cell, endotheliocyte, lymphocyte, sarcoplast, liver cell and medullary cell.
According to a kind of embodiment, use lentiviral vectors (a class retroviral vector) according to this instruction.Lentiviral vectors is widely used as carrier, and this is the genomic ability that is incorporated into Unseparated Cell and somatoblast due to them.When cell entry cell, when the viral genome of rna form is reversed record with generation DNA, then it be inserted into genome by viral integrase enzyme at random site.Carrier (provirus) is retained in genome and in the time that it divides, is passed to the filial generation of cell.For safety reasons, lentiviral vectors carries the needed gene of copying of they never.In order to produce slow virus, several plasmid transfection is entered to so-called package cell line, be generally HEK293.One or more plasmids (being commonly called packaging plasmid) coding virion albumen (as capsid) and reversed transcriptive enzyme.Another kind of plasmid comprises the genetic material of being sent by carrier.It is transcribed is to exist ψ (psi) sequence to produce single strand RNA virus genome and feature.This sequence is used for genome packaging to enter virion.
Slow virus pLKO.1 carrier for the specific embodiment of introducing neurogliocyte or myocardial cell and express the suitable lentiviral vectors of polynucleotide sequence of the present invention.
The suitable expression vector of operable according to this aspect of the invention another kind is adenovirus carrier.Adenovirus be broad research with routine use gene transfer vector.The key advantages of adenovirus carrier comprises the relatively high transduction efficiency of somatoblast and rest cell, natural taxis to far-ranging epithelium and is easy to produce high-titer (Russel, W.C. (2000) J Gen Virol81,57-63).Adenovirus DNA is transported to nucleus, but is not incorporated into wherein.Thereby, being minimized by means of the risk of the mutagenesis of adenovirus carrier, short-term is expressed and is specially adapted to treat cancer cells simultaneously.The adenovirus carrier using in experimental cancer therapy is described in Seth et al. (1999). " Adenoviral vectors for cancer gene therapy; " pp.103-120, P.Seth, ed., Adenoviruses:Basic Biology to Gene Therapy, Landes, Austin, TX).
Suitable virus expression carrier can also be the chimeric adenovirus/retroviral vector that is combined with retrovirus and adenovirus integral part.Such carrier can be than more effectively (Pan et al. (2002) .Cancer Letts184,179-188) of the traditional expression vector for the tumour cell of transduceing.
For example, in the time expression construct of the present invention being introduced to target cell (neurogliocyte or myocardial cell) by virus infection, be at least 10 for the viral dosage infecting 3, 10 4, 10 5, 10 6, 10 7, 10 8, 10 9, 10 10, 10 11, 10 12, 10 13, 10 14, 10 15or higher pfu or virion.
Regardless of the method or the construct that adopt, provide the cell of the separation that comprises nucleic acid construct, wherein above-mentioned nucleic acid construct coding microRNA (as described in detail) above.
As used in this article, term " separation " refers at least in part and is separated by for example human body of physical environment.
According to a kind of embodiment, the cell of transcribing the separation of controlling lower nucleic acid construct of expressing at least one microRNA or its precursor that is included in cis acting controlling element is provided, and wherein microRNA selects the group that free miR-135, miR-335, miR-15, miR-19, miR-26, miR-27, miR-181 and miR-182 form.
According to a kind of embodiment, the neurogliocyte of transcribing the separation of controlling lower nucleic acid construct of expressing at least one microRNA or its precursor that is included in cis acting controlling element is provided, and wherein microRNA selects the group that free miR-135, miR-335, miR-26 and miR-182 form.
According to a kind of embodiment, provide the cell of the separation of transcribing the nucleic acid construct of controlling lower expression miR-19 or its precursor that is included in cis acting controlling element.
According to a kind of embodiment, provide the cell of the separation of transcribing the nucleic acid construct of controlling lower expression miR-15 or its precursor that is included in cis acting controlling element.
According to a kind of embodiment, cell is neurogliocyte or myocardial cell.
According to a kind of embodiment, neurogliocyte is that neurone is as serotonin serotonergic neuron.
In body, (in vivo) (, in organism or experimenter) or in vitro (ex vivo) (for example, in tissue culture), offer cell by microRNA or its precursor, that is, and and target cell of the present invention (for example neurogliocyte or myocardial cell).The in the situation that of vitro treatment cell, aforesaid method preferably includes following steps: such cell is returned and gives individuality (isolated cells treatment).
For vitro treatment, preferably use preparation of the present invention (for example, the polynucleotide of coding microRNA) to process cell, thereafter they are needed to its experimenter.
Can utilize any suitable approach that gives to give extracorporeal treatment cell of the present invention, the approach that gives is as approach in approach, gi tract in intravenous route, intraperitoneal approach, kidney, subcutaneous route, through skin approach, intramuscular approach, intradermal routes, intrathecal route, epidural approach and rectum approach.According to preferred embodiment at present, can utilize in intravenously, kidney, in gi tract and/or intraperitoneal is introduced ex vivo treatment cell of the present invention individual.
Cell of the present invention (for example neurogliocyte or myocardial cell) can be derived from autologous source or be derived from allogeneic and originate as people's corpse or donor.Because in the time giving health, non-autogenous cell likely brings out immune response, so developed some methods and reduce the possibility of the repulsion of non-autogenous cell.These methods before being included in and transplanting, suppress acceptor immunity system or by non-autogenous cell be encapsulated in that immunity separates, in semipermeable partition.
Encapsulation technology is generally categorized as microencapsulation, and it relates to coccoid carrier; And macroscopic view encapsulation (macroencapsulation), it relates to larger flat sheet and hollow-fibre membrane (Uludag, H.et al. (2000) .Technology of mammalian cell encapsulation.Adv Drug DelivRev42,29-64).
Be well known in the art and comprise for example those methods for the preparation of the method for microcapsule; it is disclosed in: Lu; M.Z.et al. (2000) .Cell encapsulation with alginate and α-phenoxycinnamylidene-acetylated poly (allylamine) .Biotechnol Bioeng70,479-483; Chang, T.M.and Prakash, S. (2001) Procedures formicroencapsulation of enzymes, cells and genetically engineeredmicroorganisms.Mol Biotechnol17,249-260; And Lu, M.Z., et al. (2000) .Anovel cell encapsulation method using photosensitive poly (allylamine α-cyanocinnamylideneacetate) .J Microencapsul17,245-521.
For example, utilize with the mixture of the terpolymer shell of HEMA (HEMA), methacrylic acid (MAA) and methyl methacrylate (MMA) in modification collagen prepare microcapsule, the capsule thickness of acquisition 2-5 μ m.Can further encapsulate above-mentioned microcapsule to give electronegative smooth surface and to make plasma proteins absorption minimize (Chia with the terpolymer shell of other 2-5 μ m, S.M.et al. (2002) .Multi-layered microcapsules for cellencapsulation.Biomaterials23,849-856).
Other microcapsule are based on alginate, marine polysaccharide (Sambanis, A. (2003) .Encapsulated islets in diabetes treatment.Diabetes Thechnol Ther5,665-668) or its derivative.For example, can in the situation that having calcium chloride to exist, be used for preparing microcapsule by the polyelectrolyte complex between polyanion sodium alginate and Ushercell and poly-(methylene radical--the guanidine) hydrochloride of polycation.
Be understandable that, in the time using less capsule, can improve cell encapsulation.Therefore, in the time that capsule size is decreased to 400 μ m from 1mm, can improve quality control, mechanical stability, diffusion and the external activity (Canaple of for example encapsulate cells, L.et al. (2002) .Improving cellencapsulation through size control.J Biomater Sci Polym Ed13,783-96).In addition; discovery has microenvironment that the surface chemistry performance of the little hole dimension to 7nm, customization of good control and the nanoporous biological capsule of accurate microarchitecture can successful immunocyte (referring to Williams; D. (1999) .Small is beautiful:microparticle and nanoparticletechnology in medical devices.Med Device Technol10,6-9; And Desai, T.A. (2002) .Microfabrication technology for pancreatic cell encapsulation.ExpertOpin Biol Ther2,633-646).
The example of the immunosuppressor that can use together with vitro treatment includes but not limited to that methotrexate, endoxan, ciclosporin, ciclosporin A, chloroquine, Oxychloroquine, sulfasalazine (sulphasalazopyrine), golden salt, Beracilline, leflunomide, azathioprine, A Nabai are stagnant, biological agent and the NSAID (non-steroidal anti-inflammatory drug) (NSAID) of infliximab (REMICADE.sup.R), etanercept, TNF α, retarding agent, target inflammatory cytokine.The example of NSAID includes but not limited to acetylsalicylic acid, choline salicylate magnesium, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, R-ETODOLAC, fenoprofen, flurbiprofen, indomethacin, Ketoprofen, ketorolac, meclofenamic acid, Naproxen Base, nabumetone, Phenylbutazone, piroxicam, sulindac, tolmetin, paracetamol, Ibuprofen BP/EP, Cox-2 inhibitor and U-26225A.
For interior therapeutic, for example, by the preparation polynucleotide of microRNA (, coding) itself or give experimenter as a part for pharmaceutical composition.Preferably, preparation above-mentioned composition is to allow through hemato encephalic barrier (BBB).
Comprising to the ordinary method of central nervous system (CNS) for drug delivery: Neurological Surgery strategy (for example, intracerebral injection or Intraventricular infusion); Molecule manipulation preparation (for example, produce chimeric fusion protein, it comprises the transit peptides for endothelial cell surface molecule with avidity, and itself can not pass the preparation of BBB) is to attempt the one of the endogenous transporting pathway that utilizes BBB; Be used for increasing the pharmacology strategy of the lipid solubility (for example, the ligation of water-soluble agents and lipid or cholesterol carrier) of preparation; And the of short duration destruction of destroying (produce from mannitol solution infusion and enter carotid artery or use biologically active agent as the angiotensin peptides) integrity to BBB by hypertonicity.
Comprise that for the method for drug delivery after BBB intracerebral transplantation (as used pin) and convection current strengthen distribution.N.F,USP MANNITOL can be for walking around BBB.Equally, mucous membrane (for example, nose) gives can be used for walking around BBB.
All right, give organism by microRNA polynucleotide of the present invention agent with pharmaceutical composition (the wherein agent of microRNA polynucleotide and suitable carrier or mixed with excipients).
As used in this article, " pharmaceutical composition " refers to that one or more active ingredients described herein and other chemical compositions are as carrier suitable on physiology and the preparation of vehicle.The object of pharmaceutical composition is to promote compound to give organism.
In this article, term " active ingredient " refers to the peptide of being responsible for biological effect.
Hereinafter, the phrase " carrier for physiology " of use and " pharmaceutical carrier " be can exchange and carrier or thinner referred to, biological activity and performance that it does not cause the significant stimulation to organism and does not eliminate (abrogate) compound that gives.These phrases comprise adjuvant.
In this article, term " vehicle " refers to and is added into pharmaceutical composition further to promote the inert substance giving of active ingredient.The example of vehicle includes but not limited to calcium carbonate, calcium phosphate, various types of sugar and starch, derivatived cellulose, gelatin, vegetables oil and polyoxyethylene glycol.
Can be referring to " Remington ' s PharmaceuticalSciences, " Mack Publishing Co. for preparing and giving the technology of medicine, Easton, PA, latest edition, it is incorporated into herein with way of reference.
That the suitable pathways giving can for example comprise is oral, rectum, through mucous membrane in particular intranasal, intestines or gi tract send outward, comprise intramuscularly, subcutaneous and intramedullary injection and intrathecal injection, directly injection in ventricle, intravenous injection, peritoneal injection, nasal injection or intraocular injection.
Alternately, can give pharmaceutical composition with part instead of system mode, for example, by pharmaceutical composition being injected directly into patient's tissue regions.
Can prepare pharmaceutical composition of the present invention by the process being well known in the art, for example, make, levigate, emulsification, encapsulate, hold back or frozen dried by means of routine mixing, dissolving, granulation, drageeing.
Therefore can prepare in a usual manner pharmaceutical composition used according to the invention, wherein utilize one or more to be convenient to active ingredient to be processed into the carrier for physiology (comprising vehicle and auxiliary agent) of preparation that can be medicinal.Suitable preparation depends on the selected approach that provides.
In order to inject, the active ingredient of pharmaceutical composition can be formulated in the aqueous solution, preferably in physiological compatibility damping fluid as Han Keshi solution, Ringer's solution or physiology salt buffer.For giving through mucous membrane, in preparation, use the permeate agent that is suitable for the barrier that will permeate.Above-mentioned permeate agent is normally known in the art.
Give for oral, can be by active compound and the pharmaceutical carrier combination being well known in the art be carried out to easily compounding pharmaceutical composition.Above-mentioned carrier makes it possible to pharmaceutical composition to be mixed with tablet, pill, drageeing, capsule, liquid, gelifying agent, syrup, slurry, suspensoid etc., for patient's oral absorption.Can utilize solid excipient for the preparation of the pharmaceutical preparation orally using, wherein, adding after suitable auxiliary agent (if necessary), grind alternatively the mixture of generation the mixture of processing granular, to obtain tablet or drageeing core.Suitable vehicle is that in particular, weighting agent, as sugar, comprises lactose, sucrose, N.F,USP MANNITOL or sorbyl alcohol; Cellulose preparation as, for example, W-Gum, wheat starch, Starch rice, yam starch, gelatin, gum tragacanth, methylcellulose gum, Vltra tears, Xylo-Mucine; And/or physiology uses polymkeric substance as polyvinylpyrrolidone (PVP).If necessary, can add disintegrating agent, if cross-linked polyvinylpyrrolidone, agar or Lalgine or its salt are as sodium alginate.
Drageeing core is provided with suitable coating.For this purpose, can use concentrated sugar soln, it can comprise arab resin, talcum powder, polyvinylpyrrolidone, carbopol gel, polyoxyethylene glycol, titanium dioxide, lacquer solution and suitable organic solvent or solvent mixture alternatively.Dyestuff or pigment can be added to tablet or drageeing coating, for identifying or be used for characterizing the various combination of active compound doses.
The pharmaceutical composition that can orally use comprises: the sucking fit capsule (push-fit capsules) of being made up of gelatin; And by gelatin and softening agent, the soft seal capsule agent of making as glycerine or sorbyl alcohol.Sucking fit capsule can with weighting agent if lactose, tackiness agent are if starch, lubricant are as talcum powder or Magnesium Stearate, and the mixture of stablizer comprises active ingredient alternatively.In soft capsule, can or be suspended in suitable liquid by solubilization of active ingredient, as fatty oil, Liquid Paraffin or liquid macrogol.In addition, can add stablizer.Should have and be suitable for the selected dosage that gives approach for the oral all formulations that give.
Give for oral cavity, composition can adopt the tablet of preparation in a usual manner or the form of lozenge.
For giving of entering by snuffing, can since the form of sprays of self-pressurization bag or nebulizer send easily active ingredient used according to the invention, wherein by means of suitable propelling agent, for example, Refrigerant 12, trichlorofluoromethane, dichloro tetrafluoro ethane or carbonic acid gas.The in the situation that of pressurised aerosol, can determine dose unit by the valve that the amount for sending metering is provided.Can be formulated into inclusion compound and suitable powder matrix as the powdered mixture of lactose or starch for the capsule of for example gelatin that uses at divider and cartridge case.
Pharmaceutical composition described herein can be formulated for gi tract and give outward, for example, and by injecting or continuous infusion.Can be with unit dosage, for example, with ampoule or with multi-dose container, the sanitas that it has interpolation alternatively, is provided for the formulation of injecting.Composition can be suspensoid, solution or the emulsion in oiliness or aqueous carrier, and can comprise preparaton as suspension agent, stablizer and/or dispersion agent.
The pharmaceutical composition giving outward for gi tract comprises the aqueous solution of the active ingredient of water-soluble form.In addition, the suspensoid of active ingredient can be prepared as the suitable injection suspension based on oiliness or water-based.Suitable lipophilic solvent or carrier comprise that fatty oil is as sesame oil, or synthetic fatty acid ester is as ethyl oleate, triglyceride level or liposome.Water-based injection suspension can comprise such material, and it improves the viscosity of suspensoid, as Xylo-Mucine, sorbyl alcohol or dextran.Alternatively, the preparation of solubleness that suspensoid can also comprise suitable stablizer or improve active ingredient is so that preparation height concentrated solution.
Alternately, before use, active ingredient can have powder type, and for the carrier with suitable, for example, aseptic, pyrogen-free water-based solution forms.
Pharmaceutical composition of the present invention can also be mixed with to the suppository base of for example routine of use if the rectal compositions of theobroma oil or other glyceryl ester is as suppository or retention enema.
Be applicable to pharmaceutical composition of the present invention and comprise the composition of the active ingredient that wherein comprises significant quantity to accomplish the end in view.More particularly, treatment significant quantity refers to effectively the amount of the active ingredient (peptide) of preventing, alleviating or improve the symptom of obstacle (for example, diabetes) or extend experimenter's to be treated lifetime.
According to one embodiment of the present invention, cross expression miR-135 and there is antidepressant effects.
Determine that treatment significant quantity is in those skilled in the art's limit of power, in particular in view of detailed disclosure is provided herein.
For any preparation using in the method for the invention, can measure estimation treatment significant quantity or dosage by external and cell cultures at first.For example, can in animal model, prepare dosage to realize desired concentration or to tire.Such information can be used for determining more accurately the useful dosage in the mankind.
Can pass through standard pharmacy procedure, external, in cell cultures or laboratory animal, to determine active ingredient described herein toxicity and therapeutic efficiency.Data external available from these and cell cultures mensuration and zooscopy can be used for for preparation the mankind's a series of dosage.Dosage can depend on the formulation of use and the approach that gives of employing.Can select definite preparation, the approach giving and dosage in view of patient's the state of an illness by indivedual doctors.(referring to for example, Fingl, et al., 1975, " ThePharmacological Basis of Therapeutics ", Ch.1p.1).
Can regulate individually dosage and interval so that enough blood plasma levels of active ingredient to be provided, thus induction or inhibition biological effect (minimum effective concentration, MEC).MEC can be different because of every kind of preparation, but can be estimated by vitro data.To depend on personal feature and give approach for realizing the necessary dosage of MEC.Detection assay can be used for determining plasma concentration.
Depend on seriousness and the responsiveness of illness to be treated, administration (dosing) can be that single or multiple gives, and wherein continues the course for the treatment of some day to some weeks or until cure or realize weakening of morbid state.
The amount of composition certainly, to be given by depending on experimenter to be treated, painful seriousness, give mode, prescription doctor's judgement etc.The dosage giving and time are by the careful and lasting monitoring in response to individual change of illness state.
Be understandable that, have animal model, whereby, can before human therapy, test preparation of the present invention.For example can use depressed, stress, animal model model as helpless in acquistion (LH), chronic mild stress (CMS) model of anxiety, social failure stress (SDS) model and maternal deprivation model.
If necessary, composition of the present invention may reside in bag or distribution device, and as the test kit of FDA approval, it can comprise the one or more unit dosage that contain active ingredient.Above-mentioned bag is passable, for example, comprises metal or plastic foil, as blister pack.Bag or distribution device can be with the specification sheetss for giving.Above-mentioned bag or divider can also accommodate notice, and it is followed container and has by the form that regulates the government organs of manufacture, use or sale of medicine to specify, above-mentioned notice can reflect the approval of the form that mechanism gives composition or people or animal doctor.Above-mentioned notice for example, can be the label of prescription drugs or the product inset of approval by U.S.'s food and FAD approval.The composition that comprises preparation of the present invention being formulated in consistency pharmaceutical carrier can also be prepared, is placed in suitable container, and sign is used for the treatment of appointment illness (as being described in further detail) above.
Be understandable that, except the agent of microRNA polynucleotide, therapeutic composition of the present invention can also comprise and be used for the treatment of depression, stress, anxiety, other known medicines of sleep deprivation etc., as but be not limited to selectivity serotonin reuptake inhibitors (SSRI), serotonin-NRI (SNRI), norepinephrine energy and specific serotonergic antidepressive (NaSSA), norepinephrine (norepinephrine) reuptake inhibitor (NRI), norepinephrine-dopamine reuptake inhibitor, selectivity serotonin reuptake enhanser, the agent of disinthibiting of norepinephrine-Dopamine HCL, tricyclic antidepressant (for example imipramine), oxidase inhibitor (MAOI).These medicines can be with single or be included in goods with independent packaging.
The present inventor shows, cross the inhibition of expressing miR-27 and can causing MaoA (referring to embodiment 1, hereinafter), cross the inhibition of expressing miR-135 and can causing Slc6a4 (referring to embodiment 1, hereinafter), cross expression miR-135, miR-335, miR-26, miR-181 or miR-182 can cause the inhibition of Htr1a (referring to embodiment 1, hereinafter), cross the inhibition of expressing miR-19 and can causing Adr1 (referring to embodiment 2, hereinafter) and cause the inhibition of CB1 (referring to embodiment 3B, hereinafter), and cross and express inhibition that miR-15 can cause Crh1R (referring to embodiment 4, hereinafter) and cause the inhibition of FKBP5 (referring to embodiment 4B, hereinafter).
Therefore, according to one embodiment of the present invention, the method of the expression for regulate serotonin translocator (Slc6a4) gene at neurogliocyte is provided, the method comprises the active or expression that regulates microRNA or its precursor, and wherein microRNA selects the group of free miR-135 and miR-335 composition.
As used in this article, term " serotonin translocator (Slc6a4) " refers to the monoamine transporter (being also called SERT) participating in from synaptic cleft re-uptake serotonin.Exemplary Slc6a4 is set forth in NP_001036.1.
According to another kind of embodiment, provide for regulate serotonin inhibition acceptor 1a(Htr1a at neurogliocyte) method of the expression of gene, the method is included in the active or expression that regulates microRNA or its precursor in neurogliocyte, and wherein microRNA selects the group of free miR-135, miR-335, miR-181, miR-182 and miR-26 composition.
As used in this article, term " serotonin inhibition acceptor 1a(Htr1a) " refers to as the autoreceptor in presynaptic neuron and mediates the g protein coupled receptor of the inhibition that serotonin discharges.Exemplary Htr1a is set forth in NP_000515.2.
According to another kind of embodiment, the method for the expression that regulates monoamine hydroxylase (MaoA) gene in neurogliocyte is provided, the method comprises to be adjusted the active of miR-27 or its precursor or expresses.
As used in this article, term " monoamine hydroxylase (MaoA) " refers to that degraded amine neurotransmitter is as the enzyme of Dopamine HCL, norepinephrine and serotonin.Exemplary MaoA is set forth in NP_000231.1.
According to one embodiment of the present invention, provide and in neurogliocyte, regulated tryptophan hydroxylase 2(Tph2) method of the expression of gene, the method is included in the active or expression that regulates microRNA or its precursor in neurogliocyte, and wherein microRNA selects the group of free miR-181 and miR27 composition.
As used in this article, term " tryptophan hydroxylase 2(Tph2) " refers to the enzyme of its catalysis first step and rate-limiting step in the biosynthesizing of serotonin.Exemplary Tph2 is set forth in NP_NP_775489.2.
According to another kind of embodiment, provide and in neurogliocyte or myocardial cell, regulated Beta-3 adrenergic receptor 1(Adrb1) method of the expression of gene, the method comprises to be adjusted the active of miR-19 or its precursor or expresses.
As used in this article, term " Beta-3 adrenergic receptor 1(Adrb1) " refers to the acceptor of the physiological effect of its mediation suprarenin and norepinephrine.Exemplary Adrb1 is set forth in NP_000675.1.
According to another kind of embodiment, the method for the expression that regulates beta 2-adrenergic receptor (Adrb2) gene in neurogliocyte is provided, the method comprises to be adjusted the active of miR-15 or its precursor or expresses.
As used in this article, term " beta 2-adrenergic receptor (Adrb2) " refer to its directly to C class L-type calcium channel Ca(V) 1.2 relevant acceptors.Adrb2 is set forth in for example NP_000015.1.
According to another kind of embodiment, the method for the expression that regulates CRH1 receptor gene in neurogliocyte is provided, the method comprises to be adjusted the active of miR-15 or its precursor or expresses.
As used in this article, term " CRH1 type " refers to its acceptor in conjunction with corticotropin releasing hormone (CRH).CRH1 type is set forth in for example NP_001138618.1, NP_001138619.1, NP_001138620.1 and NP_004373.2.
According to another kind of embodiment, the method for the expression that regulates glutamate receptor gene in neurogliocyte is provided, the method comprises to be adjusted the active of miR-181 or its precursor or expresses.
According to another kind of embodiment, glutamate receptor gene comprises metabotropic glutamate receptor 1(Grm1), glutamate receptor ionic kainic acid 3(Grik3), metabotropic glutamate receptor 5 (Grm5), glutamate receptor ionic kainic acid 2(Grik2) and metabotropic glutamate receptor 7(Grm7) (as above described in further detail).
According to another kind of embodiment, the method for the expression that regulates Down's syndrome cell adhesion molecule (Dscam) gene in neurogliocyte is provided, the method comprises to be adjusted the active of miR-182 or its precursor or expresses.
As used in this article, term " Down's syndrome cell adhesion molecule (Dscam) " refers to the cell adhesion molecule that it plays a role in neurone ego anachoresis (neuronal self-avoidance).Dscam is set forth in for example NP_001380.2.
According to another kind of embodiment, provide for regulate cell adhesion molecule L1(L1cam at neurogliocyte) method of the expression of gene, the method comprises to be adjusted the active of miR-182 or its precursor or expresses.
As used in this article, term " cell adhesion molecule L1(L1cam) " refers to neuronal cell adhesion molecule.L1cam is set forth in for example NP_000416.1, NP_001137435.1, NP_076493.1.
According to another kind of embodiment, provide and in neurogliocyte, regulated the be correlated with method of expression of X protein (Tsnax) gene of Translin, the method comprises to be adjusted the active of miR-182 or its precursor or expresses.
As used in this article, term " Translin be correlated with X protein (Tsnax) " refers to the interactional albumen specifically with translin.Tsnax is set forth in for example NP_005990.1.
According to another kind of embodiment, provide and in neurogliocyte, regulated Cannabined receptor 1(CB1) method of the expression of gene, the method comprises to be adjusted the active of miR-19 or its precursor or expresses.
As used in this article, term " Cannabined receptor 1(CB1) " refers to cell-membrane receptor (being also called as CNR1).CB1 is set forth in for example NP_001153698.1, NP_001153730.1, NP_001153731.1, NP_057167.2, NP_149421.2.
According to another kind of embodiment, provide and in neurogliocyte, regulated FKBPL 5(FKBP5) method of the expression of gene, the method comprises to be adjusted the active of miR-15 or its precursor or expresses.
As used in this article, term " FKBPL 5(FKBP5) " refers to the albumen that is incorporated into specifically immunosuppressor FK506 and rapamycin.FKBP5 is set forth in for example NP_001139247.1, NP_001139248.1, NP_001139249.1, NP_004108.1.
According to another kind of embodiment, provide and in neurogliocyte, regulated cynapse chemotactic element 1a(Syntaxin1a) (Stx1a) method of the expression of gene, the method comprises to be adjusted the active of miR-15 or its precursor or expresses.
As used in this article, term " cynapse chemotactic element 1a(Syntaxin1a) (Stx1a) " refers to nervous specific albumen.Stx1a is set forth in for example NP_001159375.1, NP_004594.1.
According to another kind of embodiment, the method that regulates serum/glucocorticosteroid to regulate the expression of kinases (Sgk1) gene in neurogliocyte is provided, the method comprises to be adjusted the active of miR-15 or its precursor or expresses.
As used in this article, term " serum/glucocorticosteroid regulates kinases (Sgk1) " refers to serine/threonine protein kitase.Sgk1 is set forth in for example NP_001137148.1, NP_001137149.1, NP_001137150.1, NP_005618.2.
This instruction imagination raises (improving) or lowers the expression level of (reducing) said gene.
Conventionally for example, by microRNA polynucleotide being given to target cell or expressing microRNA polynucleotide and lower the genetic expression (as described in further detail hereinbefore) according to this instruction in target cell (neurogliocyte or myocardial cell).
According to a kind of embodiment, in the time that adjusting comprises the expression of lowering Slc6a4 gene, regulate and comprise rise miR-135 and/or miR-335.
According to a kind of embodiment, in the time that adjusting comprises the expression of lowering Htr1a gene, regulate and comprise rise miR-135, miR-335, miR-181, miR-182 and/or miR-26.
According to a kind of embodiment, in the time that adjusting comprises the expression of lowering MaoA gene, regulate and comprise rise miR-27.
According to a kind of embodiment, in the time that adjusting comprises the expression of lowering Adrb1 gene, regulate and comprise rise miR-19.
According to a kind of embodiment, in the time that adjusting comprises the expression of lowering CRH1 receptor gene, regulate and comprise rise miR-15.
According to a kind of embodiment, in the time that adjusting comprises the expression of lowering CB1 gene, regulate and comprise rise miR-19.
According to a kind of embodiment, in the time that adjusting comprises the expression of lowering FKBP5 gene, regulate and comprise rise miR-15.
Alternately, according to another embodiment of the invention, for example, carry out up-regulated gene by the preparation that gives the preparation of the expression that can lower microRNA or expression can be lowered the expression of microRNA in target cell (neurogliocyte or myocardial cell) and express.
Can utilize different kinds of molecules, (for example, the reticent agent of RNA, ribozyme, DNA enzyme and antisense) transcribed and/or translated in its interference, carries out the downward of microRNA on genomic level and/or transcriptional level.
The method of lowering micro-RNA expression is well known in the art.
The nucleic acid agent of lowering miR activity includes but not limited to target stand-in, microRNA resistant gene and miRNA inhibitor.
Target stand-in or microRNA resistance target substantially with microRNA complementation, condition be allow one or more following mispairing:
(a) mispairing between the Nucleotide at the 5' of microRNA end place and the corresponding nucleotide sequence in target stand-in or microRNA resistance target;
(b) mispairing between any one Nucleotide at 9 places, position 1 to position of microRNA and the corresponding nucleotide sequence in target stand-in or microRNA resistance target; And
(c) three mispairing between any one Nucleotide at 21 places, 12Zhi position, the position of microRNA and the corresponding nucleotide sequence in target stand-in or microRNA resistance target, condition is not have plural continuous mispairing.
Target simulation RNA is substantially similar to target RNA, and it is modified to make the cutting of its resistance to miRNA induction, for example, make the Nucleotide with the target sequence of Nucleotide 10 or 11 complementations of miRNA by variation introducing by modifying its sequence, thereby cause mispairing.
Alternately, can implement microRNA resistance target.Therefore, can introduce silent mutation at the microRNA binding site place of target gene, make to change in some way the RNA sequence of DNA and generation, thereby prevent microRNA combination, but the aminoacid sequence of protein not change.Therefore, can synthesize new sequence instead of existing binding site, wherein DNA sequence dna is changed, and causes lacking the miRNA of the target that is incorporated into it.
According to a kind of embodiment, target stand-in or microRNA resistance target are connected to the promotor that front miRNA natural and identification target gene is relevant and are introduced into vegetable cell.By this way, the target stand-in of miRN or microRNA resistance target RNA will be expressed identical with miRNA in the situation that, and target stand-in or microRNA resistance target RNA will substitute non-target stand-in/microRNA resistance target RNA of degraded by miRNA induction cutting.
Can also introduce non-functional miRNA allelotrope or miRNA resistance target gene to substitute the responsive target gene of miRNA coding allelotrope or miRNA by homologous recombination.
For example, undertaken recombinant expressed by target nucleic acid (, miRNA, target gene, reticent agent etc.) clone being entered to expression of nucleic acid construct under the expression of plant promoter.
In other embodiments of the present invention, synthetic single-chain nucleic acid is used as to miRNA inhibitor.The length of miRNA inhibitor is generally approximately 17 to 25 Nucleotide and comprises and 5' to the 3' sequence of 5' to 3' sequence at least 90% complementation of ripe miRNA.In some embodiments, miRNA inhibitor molecules is 17,18,19,20,21,22,23,24 or 25 Nucleotide in length, or can be from its derivative any scope.In addition, miRNA inhibitor has and ripe miRNA, 5' to the 3' sequence of ripe naturally occurring miRNA or be at least 90,91,92,93,94,95,96,97,98,99,99.1,99.2,99.3,99.4,99.5,99.6,99.7,99.8,99.9 or 100% in particular, or the sequence (from 5' to 3') of any scope complementation that can derive from it.
Can utilize transient transfection technology to make miRNA inhibitor exposing cell.MiRNA inhibitor can be commercial available from as companies such as Applied Biosystems.
Alternately, miRNA inhibitor can be a part (described above) for expression vector.In this case, can be with the instantaneous or stable transfected cells of carrier.
According to a kind of embodiment, in the time that adjusting comprises the expression of raising Tph2 gene, regulate and comprise downward miR-181 and/or miR-27.
According to a kind of embodiment, by the expression with lowering microRNA in conjunction with microRNA and the nucleotide sequence of the expression of downward microRNA specifically.According to the present invention, operable Exemplary core acid sequence can be purchased from any manufacturers, as, for example, purchased from Genecopoeia(miArrest, based on the inhibitor of microRNA carrier).
Therefore,, according to another kind of embodiment, the polynucleotide that separate of the nucleotide sequence that comprises the expression for lowering miR-181, miR-182, miR-26, miR-27, miR-135, miR-335, miR-15 and miR-19 or their precursor are provided.
The exemplary polynucleotide of the expression that can be used for according to the present invention lowering miR-181 include but not limited to that those are set forth in the polynucleotide of SEQ ID NO:134-SEQ ID NO:137 and SEQ ID NO:154-SEQ ID NO:157.
The exemplary polynucleotide of the expression that can be used for according to the present invention lowering miR-182 include but not limited to that those are set forth in the polynucleotide of SEQ ID NO:138-SEQ ID NO:141 and SEQ ID NO:147.
The exemplary polynucleotide of the expression that can be used for according to the present invention lowering miR-26 include but not limited to that those are set forth in the polynucleotide of SEQ ID NO:126-SEQ ID NO:129 and SEQ ID NO:145-SEQ ID NO:146.
The exemplary polynucleotide of the expression that can be used for according to the present invention lowering miR-27 include but not limited to that those are set forth in the polynucleotide of SEQ ID NO:130-SEQ ID NO:133 and SEQ ID NO:152-SEQ ID NO:153.
The exemplary polynucleotide of the expression that can be used for according to the present invention lowering miR-135 include but not limited to that those are set forth in the polynucleotide of SEQ ID NO:110-SEQ ID NO:113 and SEQ ID NO:142-SEQ ID NO:143.
The exemplary polynucleotide of the expression that can be used for according to the present invention lowering miR-335 include but not limited to that those are set forth in the polynucleotide of SEQ ID NO:114-SEQ ID NO:117 and SEQ ID NO:144.
The exemplary polynucleotide of the expression that can be used for according to the present invention lowering miR-15 include but not limited to that those are set forth in the polynucleotide of SEQ ID NO:118-SEQ ID NO:121 and SEQ ID NO:150-SEQ ID NO:151.
The exemplary polynucleotide of the expression that can be used for according to the present invention lowering miR-19 include but not limited to that those are set forth in the polynucleotide of SEQ ID NO:122-SEQ ID NO:125 and SEQ ID NO:148-SEQ ID NO:149.
Above-mentioned nucleotide sequence can further be comprised in (as above described in further detail) in expression vector.
The present invention further imagines, and for example, in cell (neurogliocyte or myocardial cell), is lowering or is raising after microRNA level, the expression of assessment target gene (for example transcript or polypeptide).
Therefore, (for example can utilize the polynucleotide of separation, polynucleotide probes, oligonucleotide probe/primer) determine target gene (for example Slc6a4, Htr1a, MaoA, Adrb1, Adrb2, CRH1 receptor, CB1, FKBP5, Tph2, Grm1, Grik3, Grm5, Grik2, Grm7, Gria2, Dscam, L1cam, Tsnax, Sgk1 and/or Stx1a) existence and/or the level of nucleotide sequence (for example transcript), the polynucleotide of above-mentioned separation can hybridize to the nucleotide sequence of target gene (for example, as be set forth in Slc6a4 or its part in NM_001045.4 for example, as be set forth in Htr1a or its part in NM_000524.3 for example, as be set forth in MaoA or its part in for example NM_000240.3 or NM_001270458.1, as be set forth in Adrb1 or its part in NM_000684.2 for example, as be set forth in Adrb2 or its part in NM_000024.5 for example, as be set forth in CRH1 receptor or its part in for example NM_001145146.1, NM_001145147.1, as be set forth in CB1 or its part in for example NM_001160226.1, NM_033181.3, as be set forth in FKBP5 or its part in for example NM_001145775.1, NM_001145777.1, as be set forth in Tph2 or its part in NM_173353.3 for example, as be set forth in Grm1 or its part in for example NM_000838.3, NM_001114329.1, as be set forth in Grik3 or its part in NM_000831.3 for example, as be set forth in Grm5 or its part in for example NM_000842.3, NM_001143831.2, as be set forth in Grik2 or its part in for example NM_001166247.1, NM_021956.4, as be set forth in Grm7 or its part in for example NM_000844.3, NM_181874.2, as be set forth in Gria2 or its part in for example NM_000826.3, NM_001083619.1, as be set forth in Dscam or its part in NM_001389.3 for example, as be set forth in L1cam or its part in for example NM_000425.3, NM_001143963.1, NM_024003.2, as be set forth in Tsnax or its part in NM_005999.2 for example, as be set forth in Sgk1 or its part in for example NM_001143676.1, NM_001143677.1, NM_001143678.1, and/or as being set forth in Stx1a or its part in for example NM_001165903.1, NM_004603.3).Such polynucleotide can be any sizes, for example, for example, as short polynucleotide (, having 15-200 base) and medium polynucleotide (, 200-2000 base) or be greater than the long polynucleotide of 2000 bases.
The polynucleotide probes of separation that the present invention uses can be any direct or indirect mark RNA molecule (for example, RNA oligonucleotide, in-vitro transcription RNA molecule), DNA molecular (for example, oligonucleotide, cDNA molecule, genome molecule) and/or they analogue [for example, peptide nucleic acid(PNA) (PNA)], it is originally special for target gene rna transcription of the present invention.
Can produce according to the oligonucleotide of instruction design of the present invention (as above described in detail) according to any oligonucleotide synthesis method being known in the art.
Oligonucleotide of the present invention has at least 17, at least 18, at least 19, at least 20, at least 22, at least 25, at least 30 or at least 40 bases, and it can change hybridization with above-described sequence specifically.
Oligonucleotide of the present invention can comprise by purine and pyrimidine bases and form and with the heterocycle nucleosides of 3' to 5' phosphodiester bond bonding.
The oligonucleotide preferably using is those adorned oligonucleotide (as above broadly described) in key or base between main chain, nucleosides.
Can utilize label or tag molecule to carry out the polynucleotide of the separation of the use of mark the present invention directly or indirectly.Such mark can be that for example, fluorescence molecule (for example, fluorescein or Texas are red), Geigers are (for example, 32p-γ-ATP or 32p-α-ATP) and chromogenic substrate [for example, fast red, BCIP/INT, can be available from (ABCAM, Cambridge, MA)].Can be by realizing direct mark by covalently bound tagged molecule for example, to polynucleotide (, utilizing solid phase synthesis) or for example, by add (, utilize in-vitro transcription reaction or cause at random mark) via polymerization.Can be by for example, by covalently bound polynucleotide or (be bonded to cold tag molecule, digoxin (digoxigenin) or vitamin H) and the tagged molecule (for example, anti digoxin antibody or streptavidin) that makes subsequently polynucleotide stand to identify especially cold label realize indirect labelling.
Above-mentioned polynucleotide can for multiple RNA detection method, as Northern engram analysis, reverse transcription PCR (RT-PCR), [for example, sxemiquantitative RT-PCR, quantitative RT-PCR, for example utilize LightCycler tM(Roche)], RNA in situ hybridization (RNA-ISH), original position RT-PCR [for example dyes, as be described in Nuovo GJ, et al.1993, Intracellular localization of polymerasechain reaction (PCR)-amplified hepatitis C cDNA.Am J Surg Pathol.17:683-90, and Komminoth P, et al.1994, Evaluation of methods for hepatitis Cvirus detection in archival liver biopsies.Comparison of histology, immunohistochemistry, in situ hybridization, reverse transcriptase polymerasechain reaction (RT-PCR) and in situ RT-PCR.Pathol Res Pract., 190:1017-25] and oligonucleotide microarray analysis is [for example, utilize Affymetrix microarray ( , SantaClara, CA)].
Can utilize for example specific antibody the formation by immunocomplex [, being present in the mixture forming between target gene antigen (aminoacid sequence) in biological sample and specific antibody] determine existence and/or the level of target gene (for example, Slc6a4, Htr1a, MaoA, Adrb1, Adrb2, CRH1 receptor, CB1, FKBP5, Tph2, Grm1, Grik3, Grm5, Grik2, Grm7, Gria2, Dscam, L1cam, Tsnax, Sgk1 and/or Stx1a) aminoacid sequence (for example protein).
Can under various temperature, salt concn and pH value (it can depend on the biological sample of method and use), form immunocomplex of the present invention, and those skilled in the art can regulate the condition that is applicable to form every kind of immunocomplex.
As used in the present invention, term " antibody " comprise complete molecule with and function fragment, if Fab, F (ab') 2, Fv or single domain molecule are as the VH of the epi-position to antigen and VL.These functional antibodies fragments are defined as follows: (1) Fab, and the fragment of the monovalent antigen binding fragment that comprises antibody molecule, can be by producing with a part that produces complete light chain and a heavy chain with papain digestion whole antibody; (2) Fab', the fragment of antibody molecule, its can by with pepsin whole antibody, a part of reducing to produce subsequently complete light chain and heavy chain obtains; Each antibody molecule obtains two Fab' fragments; (3) (Fab') 2, the fragment of antibody, it can be by original acquisition also subsequently with pepsin whole antibody and; F (ab') the 2nd, the dimer of two Fab' fragments that keep together by means of two disulfide linkage; (4) Fv, is defined as genetically engineered fragment, and the variable region that it comprises light chain and the variable region of heavy chain are expressed as two chains; (5) single-chain antibody (" SCA "), genetically engineered molecule, the variable region that it comprises light chain and the variable region of heavy chain, connected by suitable peptide linker (as the single chain molecule of gene fusion); And (6) single domain antibody, being formed by single VH or VL territory, it presents the enough avidity with respect to antigen.
Well-known (referring to for example in the art for generation of the method for polyclone and monoclonal antibody and their fragment, Harlow and Lane, Antibodies:A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988, add herein with way of reference).
Can prepare according to antibody fragment of the present invention by proteolysis antibody or for example, by the DNA that expresses encode fragment in intestinal bacteria or mammalian cell (Chinese hamster ovary cell culture or other protein expression systems).Can obtain antibody fragment by stomach en-or papain digestion whole antibody (passing through ordinary method).For example, can be by provide the F (ab') 2 that 5S fragment represents to produce antibody fragment by means of the enzymatic cutting of pepsic antibody.Can utilize thiol reductant and further cut this fragment for the blocking groups (producing the cutting from disulfide linkage) of sulfydryl alternatively, to produce 3.5S Fab' unit price fragment.Alternately, utilize pepsic enzymatic cutting directly to produce two unit price Fab' fragments and Fc fragment.These methods are described in, for example, Goldenberg, U.S. Patent number US4,036,945 and US4,331,647, and comprising reference, the full content of above-mentioned patent is incorporated into herein with way of reference.Also referring to Porter, R.R.[Biochem.J.73:119-126 (1959)].Can also use the additive method of cutting antibody, if the separation of heavy chain is to form the light heavy chain fragment of unit price, further cutting fragment, or other enzymatics, chemistry or gene engineering, as long as fragment is bonded to the antigen of being identified by complete antibody.
The association that Fv fragment comprises VH and VL chain.This association can be non-covalent, as is described in Inbar et al.[Proc.Nat'l Acad.Sci.USA69:2659-62(19720].Alternately, can by intermolecular disulfide bond or by chemical substance as the crosslinked variable chains that connects of glutaraldehyde.Preferably, Fv fragment comprises the VH and the VL chain that are connected by peptide linker.Prepare these single chain antigen binding proteins (scFv) by building structure gene, the VH that wherein said structure gene comprises the connection of coding oligonucleotide and the DNA sequence dna of VL structural domain.Structure gene is inserted to expression vector, and it is introduced into host cell subsequently as intestinal bacteria.Recombinant host cell synthesizes single polypeptide chain, two V structural domains of its center tap peptide bridge joint.Method for generation of scFv is described in, for example, and Whitlowand Filpula, Methods2:97-105 (1991); Bird et al., Science242:423-426 (1988); Pack et al., Bio/Technology11:1271-77 (1993); And U.S. Patent number US4,946,778, its full content is incorporated into herein with way of reference.
The antibody fragment of another kind of form is the peptide of the single complementary determining region of coding (CDR).Can obtain CDR peptide (" atom ") by the encode gene of CDR of target antibody of structure.For example,, by utilizing polymerase chain reaction to prepare such gene with the RNA synthetic variable region of the cell that certainly produces antibody.Referring to, for example, Larrick and Fry[Methods, 2:106-10 (1991)].
Can also utilize the various technology that are known in the art, comprise that phage display library produces antibody [Hoogenboom and Winter, J.Mol.Biol., 227:381 (1991); Marks et al., J.Mol.Biol., 222:581 (1991)].The people's such as people and Boerner such as Cole technology also can be used for preparing human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R.Liss, p.77 (1985) and Boerner et al., J.Immunol., 147 (1): 86-95 (1991)].Similarly, can be by human immunoglobulin gene's seat be introduced to transgenic animal, for example, mouse (wherein endogenous immunoglobulin genes is by inactivation partially or completely) is prepared people's antibody.Exciting after (challenge), observe people's antibody producing, it is very similar in all respects sees in the mankind, comprises gene rearrangement, assembling and antibody repertoire.This mode is described in, for example, and U.S. Patent number US5; 545,807, US5,545; 806, US5,569,825, US5; 625,126, US5,633; 425, US5,661,016; and be described in following scientific publications: Marks et al., Bio/Technology10: 779-783 (1992); Lonberg et al., Nature368:856-859 (1994); Morrison, Nature368812-13 (1994); Fishwild et al., NatureBiotechnology14,845-51 (1996); Neuberger, Nature Biotechnology14:826 (1996); And Lonberg and Huszar, Intern.Rev.Immunol.13,65-93 (1995).
According to the present invention, operable exemplary antibodies comprises for example anti-Slc6a4 antibody, for example can be available from Abnova Corporation, Abgent and MBL International; Anti-Htr1a antibody, for example can be available from Novus Biologicals, Acris Antibodies GmbH and AbnovaCorporation; Anti-MaoA antibody, for example can be available from Abnova Corporation, ProteintechGroup, Inc. and Abgent; Anti-Adrb1 antibody, for example can be online available from Biorbyt, Abgent and antibody; Anti-Adrb2 antibody, for example can be online available from Tocris Bioscience, Abnova Corporation and antibody; Anti-CRH1 receptor antibody, for example can be available from MyBioSource.com, Abcamand Novus Biologicals; Anti-CB1 antibody, for example can be available from Santa Cruz Biotechnology, Inc. and Epitomics, Inc.; Anti-FKBP5 antibody, for example can be available from BD Biosciences and Abnova Corporation; Anti-Tph2 antibody, for example can be available from Novus Biologicals and AcrisAntibodies GmbH; Anti-Grm1 antibody, for example can be available from Novus Biologicals and Biorbyt; Anti-Grik3 antibody, for example can be available from Acris Antibodies GmbH and Atlas Antibodies; Anti-Grm5 antibody, for example can be available from Biorbyt and Acris Antibodies GmbH; Anti-Grik2 antibody, for example can be available from Proteintech Group, Inc., Aviva Systems Biology and Abgent; Anti-Grm7 antibody, for example can be online available from Acris Antibodies GmbH and antibody; Anti-Gria2 antibody, for example can be available from Proteintech Group, Inc. and Abnova Corporation; Anti-Dscam antibody, for example can be available from Novus Biologicals and R & D Systems; Anti-L1cam antibody, for example can be available from GeneTex, Novus Biologicals and Acris Antibodies GmbH; Anti-Tsnax antibody, for example can be available from BD Biosciences and GenWay Biotech, Inc.; Anti-Sgk1 antibody, for example can be available from Epitomics, Inc. and Acris Antibodies GmbH; And/or anti-Stx1a antibody, for example can be available from MBL International and Spring Bioscience.
Formation and those skilled in the art that several different methods can be used for detecting immunocomplex of the present invention can determine which kind of method is applicable to every kind of immunocomplex and/or diagnostic cell type.
The specific antibody (for example, anti-Slc6a4 antibody, anti-Htr1a antibody, anti-MaoA antibody, anti-Adrb1 antibody, anti-Adrb2 antibody, anti-CRH1 receptor antibody, anti-CB1 antibody, anti-FKBP5 antibody, anti-Tph2 antibody, anti-Grm1 antibody, anti-Grik3 antibody, anti-Grm5 antibody, anti-Grik2 antibody, anti-Grm7 antibody, anti-Gria2 antibody, anti-Dscam antibody, anti-L1cam antibody, anti-Tsnax antibody, anti-Sgk1 antibody and/or anti-Stx1a antibody) that can utilize the method being known in the art to be marked to use in immunocomplex of the present invention.Be understandable that, traget antibody can be primary antibodie (that is, it is incorporated into specific antigens, for example, target gene specific antigen) or two anti-(for example, the mouse anti human antibody of the goat anti-rabbit antibody of mark, mark), and it is incorporated into primary antibodie.Antibody can be connected directly to mark or enzyme.
Antibody of the present invention can by fluorescent mark (utilization is connected to the fluorescence dye of antibody), radio-labeling (utilize radio-labeling for example, 125i, antibody) or be connected to enzyme (for example, horseradish peroxidase or alkaline phosphatase) and be used for producing colorimetric reaction together with chromogenic substrate.Connect by enzyme of the present invention the chromogenic substrate that antibody adopts and include but not limited to AEC, fast red, ELF-97 substrate [2-(the chloro-2-phosphorus of 5'-acyloxy phenyl) chloro-4 (the 3H)-quinazolinones of-6-], p-nitrophenyl phosphate (PNPP), phenolphthalein bisphosphate and ELF39-phosphoric acid ester, BCIP/INT, Vector Red(VR), for incarnadine and carmetta phosphoric acid ester (the Avivi C. of alkaline phosphatase; et al.; 1994, JHistochem.Cytochem.1994; 42:551-4), and Nova Red, diaminobenzidine (DAB), Vector (R) SG substrate, for the luminol,3-aminophthalic acid cyclic hydrazide class chemical luminous substrate of peroxidase.These enzyme substratess can be commercial available from Sigma(St Louis, MO, USA), Molecular ProbesInc.(Eugene, OR, USA), Vector Laboratories Inc.(Burlingame, CA, USA), Zymed Laboratories Inc.(San Francisco, CA, USA), Dako Cytomation(Denmark).
Can utilize the analyses of fluorescence-activated cell sorting (FACS), enzyme-linked immunosorbent assay (ELISA), western blotting and radioimmunoassay (RIA), immunoprecipitation (IP) or carry out the immunocomplex in detection of biological sample by the method based on molecular weight, biological sample is as blood sample or serum, it can comprise solubility (for example, secretion, come off) target gene polypeptide.
For western blotting, proteins extraction from cell sample and stand electrophoresis (for example, SDS-PAGE) and trace for example, to film (, nylon or PVDF).Then (for example make above-mentioned film and specific antibody, anti-Slc6a4 antibody, anti-Htr1a antibody, anti-MaoA antibody, anti-Adrb1 antibody, anti-Adrb2 antibody, anti-CRH1 receptor antibody, anti-CB1 antibody, anti-FKBP5 antibody, anti-Tph2 antibody, anti-Grm1 antibody, anti-Grik3 antibody, anti-Grm5 antibody, anti-Grik2 antibody, anti-Grm7 antibody, anti-Gria2 antibody, anti-Dscam antibody, anti-L1cam antibody, anti-Tsnax antibody, anti-Sgk1 antibody and/or anti-Stx1a antibody) interact, it can be direct mark or the antibody that further stands secondary mark.Detection can be by radioautograph, colorimetric reaction or chemoluminescence.This method allows wherein the characteristic that is quantized the amount of substrate and determined it by the relative position on film (it is illustrated in the migration distance in acrylamide gel during electrophoresis).
In biological sample the concentration of antigen lower, can carry out detectable antigens (target gene aminoacid sequence) by immunoprecipitation (IP).For immunoprecipitation analysis, specific antibody (for example anti-Slc6a4 antibody, anti-Htr1a antibody, anti-MaoA antibody, anti-Adrb1 antibody, anti-Adrb2 antibody, anti-CRH1 receptor antibody, anti-CB1 antibody, anti-FKBP5 antibody, anti-Tph2 antibody, anti-Grm1 antibody, anti-Grik3 antibody, anti-Grm5 antibody, anti-Grik2 antibody, anti-Grm7 antibody, anti-Gria2 antibody, anti-Dscam antibody, anti-L1cam antibody, anti-Tsnax antibody, anti-Sgk1 antibody and/or anti-Stx1a antibody) can with the sample that comprises target gene polypeptide (for example, cell pyrolysis liquid) direct interaction, and can utilize be connected to two of pearl resist further detect formation mixture (for example, if specific antibody is mouse monoclonal antibody, two anti-can be the anti-mouse antibodies that is connected to for example sepharose 4B).Then can precipitate pearl by centrifugation, thereafter, can for example, for example, from the protein of pearl precipitation separation (, target gene polypeptide and specific antibody) (, utilizing the sex change at 95 DEG C) and utilize antibody further to stand western blot analysis.Alternately, specific antibody can be connected with pearl two anti-add comprise antigen (target gene polypeptide) thus biological sample form immunocomplex.Alternately, if target gene polypeptide is high glycosylation albumen, can also utilize can be in conjunction with glycosylated polypeptides as concanavalin A (GE Healthcare Bio-Sciences, Uppsala, Sweden) substrate of (it can also be connected to pearl) precipitates it, then western blot analysis specific antibody (as mentioned above).
Facs analysis makes it possible to detect the antigen being present on cytolemma.Briefly, specific antibody (as mentioned above) is connected to fluorophore and detects by means of cell sorting machine, wherein when light beam passes at that time, the machine-readable light wavelength of being launched by each cell of getting of above-mentioned cell sorting.This method can adopt two or more antibody simultaneously.
Can also utilize ELISA to determine existence and/or the level of target gene polypeptide.Briefly, the sample that comprises target gene antigen is fixed on to surface as the hole of microtiter plate.Use antigen-specific antibodies (for example anti-Slc6a4 antibody that is coupled in enzyme, anti-Htr1a antibody, anti-MaoA antibody, anti-Adrb1 antibody, anti-Adrb2 antibody, anti-CRH1 receptor antibody, anti-CB1 antibody, anti-FKBP5 antibody, anti-Tph2 antibody, anti-Grm1 antibody, anti-Grik3 antibody, anti-Grm5 antibody, anti-Grik2 antibody, anti-Grm7 antibody, anti-Gria2 antibody, anti-Dscam antibody, anti-L1cam antibody, anti-Tsnax antibody, anti-Sgk1 antibody and/or anti-Stx1a antibody) and allow conjugated antigen.Then by colorimetric reaction and adopt the enzyme that is coupled in antibody to detect and quantize the existence of antibody.Conventionally the enzyme adopting in this method comprises horseradish peroxidase and alkaline phosphatase.If fine calibration and response linearity range in, the amount of the substrate existing in sample is directly proportional to the amount of the color of generation.Substrate standard is commonly used to improve quantitative accuracy.
Can also utilize radioimmunoassay (RIA) to determine existence and/or the level of target gene polypeptide.In one form, this method relates to being fixed on precipitable carrier and for example, precipitates desired antigen (target gene polypeptide) in conjunction with the albumen albumin A of I125 mark (, with) as the specific antibody on sepharose 4B and radiolabelled antibody.The number of counting in deposit seeds is directly proportional to the amount of antigen.
In the alternative form of RIA, adopt labelled antigen and unmarked antibody binding proteins.Add the sample that comprises unknown quantity antigen with difference amount.The minimizing of counting from the precipitation of labelled antigen is directly proportional to the amount of antigen in interpolation sample.
Can also utilize method based on molecular weight to determine existence and/or the level of target gene polypeptide.Because immunocomplex shows the molecular weight higher than its component, so can also adopt the method for variation that can detection molecules amount.For example, can detect immunocomplex by gel retardation assay.Briefly, load non-denaturing acrylamide gel with sample.Compare with its component, the movement (shift) of the size (molecular weight) of protein represents the existence of immunocomplex.Utilize the dyeing of nonspecific proteins matter as silver dyeing or Coomassie blue stain can observe to the movement of higher molecular weight.
Can utilize the immuning dyeing method of the combination of the antibody of in situ detection on cell come in situ detection at biological sample for example, as the target gene polypeptide in tissue slice (, specimens paraffin embedding slices or freezing microtome section).The example of immunostaining program includes but not limited to that fluorescent mark immunity group method (utilization is connected to the fluorescence dye of antibody), radio-labeling Immunohistochemical Method (utilize radio-labeling for example, 125I, antibody) and immunocytochemical method [utilizing enzyme (for example, horseradish peroxidase or alkaline phosphatase) and chromogenic substrate to produce colorimetric reaction].Be understandable that, the enzyme that is connected to antibody can use various chromogenic substrates (described above).
Preferably, the immunostaining that the present invention uses is Immunohistochemical Method and/or immunocytochemical method.
Immunostaining is preferably to utilize dyestuff (it is incorporated into non-staining cell cell) reflex transfect cell subsequently.For example, if traget antibody is incorporated at tenuigenin, the antigen of upper existence, nuclear stain (for example, hematoxylin-eosin staining agent) is suitable redying.
According to a kind of embodiment, aforesaid method is included in lowers the expression of measuring Tph2 gene after miR-181 and/or miR-27.
According to a kind of embodiment, aforesaid method is included in lowers the expression of measuring Tph2 gene after miR-181 and/or miR-27.
According to a kind of embodiment, aforesaid method is included in and raises the expression of measuring Htr1a gene after miR-135, miR-335, miR-181, miR-182 and/or miR-26.
According to a kind of embodiment, aforesaid method is included in and raises the expression of measuring MaoA gene after miR-27.
According to a kind of embodiment, aforesaid method is included in and raises the expression of measuring Adrb1 gene after miR-19.
According to a kind of embodiment, aforesaid method is included in and raises the expression of measuring CB1 gene after CB1.
According to a kind of embodiment, aforesaid method is included in and raises the expression of measuring CRH1 receptor gene after miR-15.
According to a kind of embodiment, aforesaid method is included in and raises the expression of measuring FKBP5 gene after miR-15.
The present inventor further recognizes, suffering from the experimenter of serotonin associated conditions (the above), mR135 is raised.
Therefore, method for diagnose serotonin associated conditions its experimenter of needs is provided, and the method comprises the expression level of measuring miR-135 in experimenter's blood, wherein, compare with health volunteer's blood sample, the high expression level of miR-135 represents serotonin associated conditions.
The method of analyzing the miR in blood sample is well-known in the art and is described in below.
Can utilize gold standard method further to assess and determine diagnosis.Conventionally, at least one in the comprehensive assessment of all patients medical history, health assessment and symptom contributes to determine depressed reason.Standardized survey can be useful, as the Hamilton equal for depressed, and Beck Investigation on depression table.
The present inventor further shows, in the experimenter who treats as fluoxetine (antidepressive of SSRI class) with thymoleptic, miR-135a blood plasma level reduces, and improves (referring to Fig. 3 E-J) in the miR-135a of these same subject midbrain level.
Therefore, according to another embodiment of the invention, provide the method for the treatment of monitoring thymoleptic, the method comprises: the experimenter who (a) needs it by anti-depressant therapy; And (b) before treatment and with after treatment, in experimenter's blood, measure the expression level of miR-135, wherein, compare with the expression level of miR-135 before by anti-depressant therapy, with after anti-depressant therapy, the lower expression level of miR-135 represents effective treatment.
As used in this article, term " thymoleptic " refers to for alleviating emotional maladjustment as major depression and dysthymia disorders, and anxiety disorder is as any medicine of social anxiety disorder.Exemplary thymoleptic include but not limited to selectivity serotonin reuptake inhibitors (SSRI, as citalopram, escitalopram, fluoxetine, fluvoxamine, paroxetine and Sertraline); Serotonin-NRI (SNRI, as desmethylvenlafaxine (Desvenlafaxine), duloxetine, Midalcipran and Venlafaxine); Norepinephrine energy and specific serotonergic antidepressive (as mianserin and mirtazapine); NRI (NRI, as Tomoxetine hydrochloride, Mazindol, Reboxetine and viloxazine); Norepinephrine-dopamine reuptake inhibitor (as Bupropion); Selectivity serotonin reuptake enhanser (as tianeptine); The agent (NDDI is as Agomelatine) of disinthibiting of norepinephrine-Dopamine HCL; Tricyclic antidepressant (comprising tertiary amine tricyclic antidepressant and secondary amine tricyclic antidepressant); And oxidase inhibitor (MAOI).
According to a kind of embodiment, thymoleptic comprise selectivity serotonin reuptake inhibitors (SSRI) or NRI (NRI).
Conventionally in the blood sample available from experimenter, measure the expression level of miR-135.
As used in this article, term " blood sample " refers to (fractionated) whole blood and the blood plasma of fresh whole blood, classification.Blood sample is conventionally available from the experimenter with after anti-depressant therapy, but blood sample can also be available from the experimenter before treatment for further comparing miR-135 level.
Compare with the miR-135 expression level before treatment, when in the time that treatment obtains the lower expression level of miR-135 afterwards, determine effective anti-depressant therapy.
According to another kind of embodiment, method for monitor mental illness its experimenter of needs is provided, and the method is included in the expression level of measuring miR-135 in experimenter's blood, wherein, compare with health volunteer, the high expression level of miR-135 represents mental illness.
According to another kind of embodiment, mental illness comprise depression, anxiety, stress, fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia, somnopathy and food associated disorders.
According to a kind of embodiment, miR-135 comprises miR-135a.
Can be by any method known to those skilled in the art, as for example, by northern analyze, RNA enzyme protection measures and such as PCR in real time of PCR() measure the expression level of miR-135.
Can also be by the health of assess patient, and additionally or alternatively, carry out monitor therapy by experimenter being carried out to performance testing, MRI or any other method well known by persons skilled in the art.
Expection, in maturation, in the validity period of the application's patent, many relevant inhibitor that will exploitation miRNA or alternately miRNA modify, and the scope of term microRNA is intended to deductively (a priori) and comprises all these class new technologies.
As used in this article, term " about " refer to ± 10%.
Term " comprises ", " comprising ", " containing ", " including ", " having " and their version refer to " including but not limited to ".
Term " by forming " refers to " comprise and be limited to ".
Term " substantially by forming " refers to, composition, method or structure can comprise other composition, step and/or part, but as long as the fundamental sum novel feature of composition, method or structure that other composition, step and/or the ungreat change of part are claimed.
As used in this article, unless context separately has clearly regulation, singulative " ", " one " and " being somebody's turn to do " comprise plural number denotion.For example, term " compound " or " at least one compound " can comprise multiple compounds, comprise their mixture.
In whole the application, can provide various embodiment of the present invention with range format (range format).Should be understood that, the description of carrying out with range format be only for convenience and simplicity for the purpose of, and should not be interpreted as the hard limit to scope of the present invention.Therefore, the description of scope should be regarded as having specifically disclosed all possible subrange and the indivedual numerical value in above-mentioned scope.For example, the description of scope should be regarded as having specifically disclosed subrange as 1 to 3,1 to 4,1 to 5,2 to 4,2 to 6,3 to 6 etc. as 1 to 6, and indivedual numerical value in above-mentioned scope, for example, and 1,2,3,4,5 and 6.This is suitable for, and the width of scope tube not.
In the time specifying numerical range in this article, it refers to any reference numerals (mark or integer) being included in stated limit.Phrase is used interchangeably in this article and is intended to comprise the first and second designation numbers and all marks and integer therebetween in the first designation number and the second designation number " between scope " and the first designation number " extremely " the second designation number " scope ".
As used in this article, term " method " refers to mode, means, technology and the program for completing Given task, include but not limited to that those its are known mode, means, technology and the programs of practitioner of chemistry, pharmacology, biology, biological chemistry and medical field, or mode, means, technology and the program easily developed from known mode, means, technology and program by the practitioner of chemistry, pharmacology, biology, biological chemistry and medical field.
Be understandable that, for clarity sake in the case of the embodiment separating, being described some feature of the present invention can also provide in single embodiment with array mode.On the contrary, for the of the present invention various features of being described the single embodiment in the situation that for purpose of brevity can also maybe be provided with the embodiment of any other description of the present invention dividually or with any suitable sub-combination when applicable.Some feature of describing the in the situation that of various embodiment is not considered to the basic characteristics of those embodiments, unless embodiment is inoperative in the situation that there is no those key elements.
Described above and as the of the present invention various embodiments claimed in following claim part and aspect in following examples, find experiment support.
Embodiment
Referring now to following examples, it is described together with above, with non-limiting way explanation the present invention.
Conventionally, the laboratory procedure of term used herein and employing in the present invention comprises molecule, biological chemistry, microbiology and recombinant DNA technology.Fully explain in the literature such technology.Referring to, for example, " Molecular Cloning:A laboratory Manual " Sambrook etal., (1989); " Current Protocols in Molecular Biology " Volumes I-III Ausubel, R.M., ed. (1994); Ausubel et al., " Current Protocols in Molecular Biology ", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, " A PracticalGuide to Molecular Cloning ", John Wiley & Sons, New York (1988); Watsonet al., " Recombinant DNA ", Scientific American Books, New York; Birren etal. (eds) " Genome Analysis:A Laboratory Manual Series ", Vols.1-4, ColdSpring Harbor Laboratory Press, New York (1998); Method, as be set forth in U.S. Patent number 4,666,828,4,683,202,4,801,531,5,192,659 and 5,272,057; " Cell Biology:A Laboratory Handbook ", Volumes I-III Cellis, J.E., ed. (1994); " CurrentProtocols in Immunology " Volumes I-III Coligan J.E., ed. (1994); Stites et al. (eds), " Basic and Clinical Immunology " (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), " Selected Methods in CellularImmunology ", W.H.Freeman and Co., New York (1980); Available immunoassay are described in patent and scientific literature widely, referring to, for example, U.S. Patent number 3,791,932, US3,839,153, US3,850,752, US3,850,578, US3,853,987, US3,867,517, US3,879,262, US3,901,654, US3,935,074, US3,984,533, US3,996,345, US4,034,074, US4,098,876, US4,879,219, US5,011,771 and US5,281,521; " Oligonucleotide Synthesis " Gait, M.J., ed. (1984); " Nucleic AcidHybridization " Hames, B.D., and Higgins S.J., eds. (1985); " Transcriptionand Translation " Hames, B.D., and Higgins S.J., Eds. (1984); " Animal CellCulture " Freshney, R.I., ed. (1986); " Immobilized Cells and Enzymes " IRLPress, (1986); " A Practical Guide to Molecular Cloning " Perbal, B., (1984) and " Methods in Enzymology " Vol.1-317, Academic Press; " PCR Protocols:A Guide To Methods And Applications ", Academic Press, San Diego, CA (1990); Marshak et al., " Strategies for Protein Purification andCharacterization-A Laboratory Course Manual " CSHL Press (1996); All above-mentioned full contents are incorporated into herein with way of reference.Other general reference are provided in whole presents.Program is wherein considered to be in well known in the art and is provided for convenience of reader.The all information wherein comprising adds herein with way of reference.
Embodiment 1
The differential expression of miR in serotonin neurone
Material and experimental arrangement
5HT neurone microRNA microarray
Cultivate and sorting is that the rear brain cell of ePET YFP mouse of 12 days is with from the 5HT of non-5HT neurone differentiation around neurone from gestational age.According to manufacturer specification, at Agilent mouse miRNA microarray (Agilent Tech, Mississauga, ON, Canada) design 021828(discharges 12.0 based on Sanger miRBase) upper purifying, mark and the total RNA(of hybridization comprise miRNA colony).Scanning microarray also utilizes Feature Extraction software (AgilentTechnologies) to extract and processing data.After scanning, utilize genomics Suite(Partek Inc., St.Louis, MO) analyze the intensity output data of GeneView.txt file with the difference relative expression of quantification microRNA.According to the mark in GeneView file, " gIsGeneDetected " comes log2 conversion, fractile normalization method and filtering data.In 666 mouse miR, retain 198, for further analyzing after filtration step.Then there is according to ANOVA the threshold value that 1.5 multiples of significance change and determine the miR of differential expression by utilizing.Test at ANOVA the ratio of getting it right of falling into a trap.Benjamini and Hochberg proofread and correct for false positive and reduce (multiple check correction).
3'UTR clone is entered to Psicheck2 luciferase expression plasmid
From the 3'UTR sequence of mouse gene group DNA or total brain cDNA pcr amplification Slc6a4, Htr1a, MaoA and Tph2.According to the guidance of manufacturers, 3'UTR PCR fragment is connected to pGEM-T easy carrier (Promega), and is further subcloned in Psicheck2 reporter plasmid (Promega) and in single NotI site at the 3' of luciferase end place.By means of the 3'UTR sequence (lacking miR-135 Seed Sequences) of the synthetic sudden change of the primer overhang through seed matching sequence.Cut and confirm clone's orientation by order-checking by diagnosis.
Transfection and luciferase analysis
Converge and utilize polymine by means of the Psicheck2-3'UTR plasmid of following plasmid transfection: 5ng and the over-express vector of 215ng (for specific miRNA) to 70-85% with poly-L-Lysine growth HEK293T cell with 48 hole forms, or empty miR-vec crosses expression plasmid.After transfection 24 hours, lysing cell was also measured luciferase reporter gene activity (as described earlier) [Chen A.et al.Mol Endocrinol(2005) 19:441-58].Renilla luciferase value is normalized to contrast Photinus pyralis LUC level (transcribe from same vehicle, but the impact of the 3'UTR not tested) and 6 holes under every kind of condition repeated in addition average.
Animal and dwelling
The adult C57BL/6J male mice (Harlan, Jerusalem, Israel) in 10 week age is placed in temperature-controlling chamber's (22 ± 1 DEG C) with 12 hours illumination/dark cycles putting upside down.Arbitrarily (ad libitum) obtains food and water.All experimental programs obtain the approval of Institutional Animal Careand Use Committee of The Weizmann Institute of Science.
Acute fixing stress example (paradigm)
During their dark cycle, adult mice is introduced to 50ml vent-pipe 30 minutes.
Chronic social failure
Mouse is stood social failed scheme (as described earlier) [Krishnan V.et al.Cell(2007) 131:391-404].Briefly, mouse being put into the rearging cage of aggressive ICR mouse and their healths interacts 5 minutes.During this period, mouse and the effractor of ICR mouse attack invasion show obedience attitude.Then the transparent synthetic glass separator of perforation is placed between animal and mouse is remained on in identical cage 24 hours and contact with permission sensation.Then in ensuing 10 days, with strange ICR mouse repetition said procedure.
Antidepressive treatment
Mouse is accepted i.p. injection tricyclic antidepressants-imipramine or SSRI-fluoxetine or NRI-Reboxetine (20mg/kg, in salt solution) or salt solution.Carry out the continuous 18-21 days of chronic injection, and within 24 hours before brain micro-dissection, carry out acute injection.
Micro-dissection nuclei of median raphe and sampled plasma
Except decerebrate and after it being placed in vinylformic acid brain matrix (Stoelting), obtain brain sample from mouse nuclei of median raphe (RN).Utilize standard insert (GEM) and obtain section based on appointment anatomic landmark thing.Flush end 14G syringe is used for extracting RN district since the 3mm section that matrix is removed.In addition, in the pipe that comprises EDTA, gather trunk blood to avoid solidification.At 3,500g and 4 DEG C, centrifugation is after 30 minutes, and separated plasma also remains at-70 DEG C until RNA purifying.
MicroRNA purifying and quantitative RT-PCR expression analysis
Utilize the miniature test kit of miRNeasy (Qiagen) and according to manufacturer specification, comprise microRNA from neurone, freezing brain stripping and slicing (brain punches) and the separating plasma mRNA(of classification), and use miScript Reverse transcript reagent box to process miRNA to produce cDNA.Then, use green PCR test kit (Qiagen), according to the guidance of manufacturers, is analyzed cDNA sample in AB7500 thermo cycler (Applied Biosystems).Use the Auele Specific Primer for every kind of miR together with commercial universal primer, U6snRNA is used as to internal reference simultaneously.
Table 1B: for the primer sequence of PCR in real time
SEQ?ID?NO. Primer sequence Gene
1 TATGGCTTTTTATTCCTATGTGA miR135a
2 TATGGCTTTTCATTCCTATGTGA miR135b
3 TTTGTTCGTTCGGCTCGCGTGA miR375
45 GATGACACGCAAATTCGTGAATAAGGCACGCGGTGAATGCC U6miR124
Table 1C: for the primer sequence of molecular cloning
Clone miR135b crosses expressing viral vector
By PCR miR-135b from mouse gene group DNA amplification, wherein primer adds restriction enzyme AgeI site, is then arrived pGEM-T Easy carrier (Promega, Madison, WI) by interior Slc6a4ization (inSlc6a4ed).At order-checking pGEM-T Easy and with AgeI digestion pGEM-TEasy and pEGFP carrier (Clontech laboratories Inc., Mountain View, CA), after, immature miR-135b sequence is connected to pEGFP carrier with construction expression plasmid pEGFP-miR-135b.Then, cut pEGFP-miR-135b by BamHI and BsrGI, be parallel to the plasmid with same enzyme cutting pCSC-E/Syn-eGFP, then miR-135b-eGFP sequence is connected to pCSC-E/Syn to build miR-135b-eGFP plasmid before pCSC-eSNY-, it is confirmed by restriction endonuclease analysis and DNA sequencing.
Produce lentiviral vectors
Produce recombinant slow virus (as described earlier) [Naldini L et al., Proc Natl Acad Sci U S A (1996) 93:11382-8] by the transient transfection in HEK293T cell.Briefly, within 48 and 72 hours after transfection, gather in the crops infectious slow virus, filter by 0.45 μ m hole cellulose ethanoate strainer, and concentrate by ultracentrifugation.
Intracerebral injection slow virus
For the position that stereotactic surgery and slow virus are sent provides accurate control, contriver has used computer-directed stereotaxic instrument and motor-driven nano injection device (Angle Two tMstereotaxic Instrument, myNeurolab).[Singer O.et al.NatNeurosci (2005) .8 as described earlier, 1343-9], under general anesthesia, mouse is placed on stereotaxis instrument, and definite coordinate, as defined by Franklin and Paxinos map (atlas).Utilization is connected to the Hamilton syringe of motor-driven nano injection device system and sends slow virus preparation, and carrys out injection solution with the speed of 0.2 μ l/ minute.After two week decubation, mouse is stood behavior and physiological Study, is then anaesthetized and pour into 4% paraformaldehyde of phosphate buffered.The fixing brain of serial section is the accuracy (utilizing Immunohistochemical Method) that 30 μ cut into slices to confirm injection site.
Immunohistochemical Method
As described earlier, carry out program for Immunohistochemical Method [Chen A et al.J Neurosci(2006) 26:5500-10].For GFP immunostaining, contriver has used the anti-GFP antibody of the biotinylation rising in rabbit as primary antibodie (Abcam, Cambridge, UK), and the Cy2 that streptavidin connects is as two anti-(Jackson Immunoresearch Laboratories Inc, WestGrove, PA, USA).
Behavior evaluation
Before each test, after 2 hours, in the dark stage, carry out all behavior evaluations in adaptive testing chamber.
Outstanding tail experiment
In TSE Tail Suspension Monitor(TSE Systems, Bad Homburg, Germany) in hang tail experiment.Every mouse is tied with belt by tail point, then hung 10 minutes by force transducer.Calculate and be recorded to the time of the time of motionless cost and the cost of struggling by the software based on presetting threshold value.
Improved forced swimming test
As described earlierly hang tail experiment [Krishnan V and Nestler EJ, Nature(2008) 455:894-902].In brief, the instrument of use is the plastic tank that diameter is 18cm, and its water that is full of 25 DEG C is to the degree of depth of 15cm.Every mouse is placed on to Tong center to start 6 minutes videograph test phases.Utilize EtoVision XT(Noldus, Wageningen, Holland at the test period of 2-6 minute) come the time length of automatic scoring to motionless cost.
Locomotor activity
In order to control the possibility of behavior effect of the difference that is derived from dynamic motion, in 48 hours, check the locomotor activity of mouse, it carries out the adaptation of a couple of days.Mouse is placed in separately in special rearging cage and utilizes InfraMot system (TSE Systems, Bad Hamburg, Germany) to measure advance (locomotion).
Statistical study
Data are expressed as mean+/-SEM.For test statistics significance, the in the situation that of only comparing therein two groups (as between microarray checking qPCR), use t inspection.Unidirectional ANOVA is used for comparing between many groups, as in luciferase is analyzed between difference treatment.In the situation that injecting (in acute and chronic sustained time) as SSRI NRI, 2 independent variables use two-way ANOVA.If desired, use (post hoc) t afterwards to check to disclose statistical significance.In the time of P<0.05, think that the difference between group is significant.
Result
Separate 5HT neurone by ePET YFP embryo's RN, and use miR microarray by their miR expression and distribution compared with non-5HT neurone (available from same cell core) (Figure 1A).Compared with non-5HT neurone, find in 5HT neurone that 14 kinds of miR are raised and 27 kinds lowered and exceeded 2 times (referring to following table 2A-table 2B).Utilize PCR in real time to carry out the representativeness checking of array result, pin in the miR raising in 5HT neurone as miR-375(P=0.0071; Figure 1B) and lower miR as miR-135a(P=0.0075; Fig. 1 C).In order further to study the effect of miR as the neuronic conditioning agent of 5HT, carry out bioinformatic analysis widely in hypothesis driven mode.By the target prediction of known serotonin genes involved (it had previously been proved to be relevant to psychopathology) and microarray results intersect (crossed with).Select the albumen of the target gene of expressing in following 4 kinds of 5HT neurones that are coded in RN for testing: Serotonin Transporter, it is responsible for 5HT re-uptake (being also called as SERT or Slc6a4); Serotonin inhibition acceptor 1a(is also called as Htr1a); Tryptophan hydroxylase 2(Tph2), the synthetic rate-limiting enzyme of 5HT in brain; And monoamine hydroxylase (MaoA), its inactivation 5HT.Use two kinds of different network algorithms to carry out the microRNA target prediction for these genes: Target Scan[www (dot) targetscan (dot) org] and Miranda[www (dot) microrna (dot) org], and compared with non-5RH cell, intersect with the list that changes 91 kinds of miR that reach at least ± 1.5 in 5HT neurone miR array.Based on miR array data and analysis of biological information, 8 kinds of miR are selected for further in vitro study (Fig. 1 D-G).
Table 2A: compared with non-serotonergic, raise the list of the miR of (exceeding 2 times) in 5HT neurone.
Multiple changes MicroRNA title
20.72 mmu-miR-375
11.73 mmu-miR-376c
4.44 mmu-miR-7a
2.87 mmu-miR-137
2.79 mghv-miR-M1-2
2.61 mmu-miR-709
2.51 mmu-miR-291b-5p
2.40 mmu-miR-1224
2.37 mmu-miR-1892
2.31 mmu-miR-702
2.25 mmu-miR-139-3p
2.24 mmu-miR-762
2.10 mmu-miR-671-5p
2.04 mmu-miR-483*
Table 2B: compared with non-serotonergic, the list of (the exceeding 2 times) miR lowering in 5HT neurone.
Multiple changes MicroRNA title
-5.10 mmu-miR-691
-4.11 mmu-miR-466l
-3.95 mmu-miR-17
-3.18 mmu-miR-376b
-3.13 mmu-miR-124
-3.08 mmu-miR-218
-2.99 mmu-miR-128
-2.92 mmu-miR-140*
-2.86 mmu-miR-148a
-2.86 mmu-miR-340-5p
-2.82 mmu-miR-181c
-2.72 mmu-miR-210
-2.69 mmu-miR-135a
-2.66 mmu-miR-27a
-2.45 mmu-miR-452
-2.20 mmu-miR-370
-2.19 mmu-miR-300
-217 mmu-miR-376a
.-2.13 mmu-miR-127
-2.12 mmu-miR-15b
-2.07 mmu-miR-101a
-2.06 mmu-miR-16
-2.05 mmu-miR-324-5p
-2.05 mmu-miR-434-5p
-2.03 mmu-miR-92a
-2.00 mmu-miR-669i
The miR-target between 3 ' UTR of the 5HT genes involved of test and its miR of prediction supposition target interacts with test to carry out external luciferase analysis.Contriver's discovery, Tph23'UTR is by miR-27b(P=0.0051) and miR-181C(P=0.0305, Fig. 1 H) slightly suppress (approximately 20%) and MaoA3'UTR also by miR-27b inhibition (P=0.0008, Fig. 1 I).MiR-135 target Slc6a43'UTR(Fig. 2 A and Fig. 2 C) and Htr1a3'UTR(Fig. 2 B and Fig. 2 D) system of suppressing of the translation of these transcripts caused.Although miR-135a causes Slc6a4(P=0.014) and Htr1a(P<0.0001) approximately 30% inhibition, miR-135b causes Slc6a4(P=0.0002) and Htr1a(P<0.0001) approximately 50% inhibition.In addition, by miR-335(P<0.0001), miR-181c(P=0.0029) and miR-26a(P<0.0001, Fig. 2 D) the other inhibition that produces Htr1a3'UTR.Further genome mode analysis of biological information is disclosed in miR-135 seed in slc6a43'UTR and mates (Fig. 2 E) and guard at the strong of one of two kinds of definite seeds couplings (Fig. 2 F) in Htr1a3'UTR.Its miR seed coupling of removing miR-135 of 3 ' UTR(of Slc6a4 transcript) in the mutation research miR-135a and the miR-135b target that disclose Slc6a4 be the seed matching sequence mediation by it.(Fig. 2 G) blocked in the inhibition of being induced by miR-135 completely by the sudden change in Slc6a43'UTR.Make the coupling sudden change of Htr1a miR-135 seed disclose individually or simultaneously that miR-135a mates by distally seed instead of nearside seed coupling suppresses Htr1a3'UTR, miR-135b is by two kinds of prediction sites play a role (Fig. 2 H).
Contriver further test different environment excite or pharmacological agent after the adjusting of RN-miR-135 expression in vivo.After operation mouse (that is, acute fixing stress), remove RN, extract RNA, and use PCR in real time test miR-135 level.Can change 5HT level because known by acute stress, so contriver's test is in the miR-135 of different time points level after acute restraint stress, after concurrent present acute stress, miR-135a and miR-135b are all lowered 90 minutes (P<0.0001).Compared with control mice, the level of the reduction of these miR afterwards still keep 24 hours (for miR-135a, P=0.0357, Fig. 3 A; For miR-135b, P=0.0055, Fig. 3 B).In addition, because known in depressive patient and after antidepressive pharmacological agent 5HT neuronal function and Slc6a4 and Htr1a expression level be subject to strong effect, be exposed to the environmental model (chronic social failure model) for inducing behavior depression and be exposed to the level of two kinds of miR varients of mouse of tricyclic antidepressant imipramine so contriver has tested.What is interesting is, chronic social failure stress not change the miR-135 level in nuclei of median raphe, but, stress with non-stress mouse in, the acute or chronic imipramine giving all improves the miR-135a(P=0.003 in RN; Fig. 3 C) and miR-135b(P=0.0093; Fig. 3 D) expression level.Because imipramine is not specificity 5HT reuptake inhibitor, so contriver has further tested the impact of acute and chronic selectivity serotonin reuptake inhibitors (SSRI) fluoxetine and NRI (NRI) Reboxetine, and find, strong growth (the P<0.0001 of miR-135a level after acute and chronic SSRI treatment, Fig. 3 E), in RN, there is no the strong growth (Fig. 3 F) of miR-135b level.For the interest by the variation of miR-135 level evokes in RN after treating at SSRI, contriver has tested the level of the miR-135 that circulates in mice plasma, and find, after acute and chronic SSRI gives, strong reduction (the major effect of medicine of miR-135a level, P<0.0001, Fig. 3 G) do not affect (Fig. 3 H) for circulation miR-135b level, this prompting is the strong oppositely dependency (Fig. 3 I and 3J) between the miR-135a of RN and blood plasma level after SSRI gives.
In order further to explore the importance in miR-135 level aspect whole animal, contriver is in-vivo procedures miR-135 level test its impact on mouse behavior depression in the RN of adult mice especially.For this reason, contriver uses the synapsin promotor of enhancing to build and in neurone, crosses especially the recombinant slow virus of expressing miR-135b, and it also expresses GFP reporter gene (referring to above material and experimental arrangement part and Fig. 4 A) simultaneously.Contriver is by slow virus injection being entered to the RN of adult mice, and with the miR-135b horizontal checkout of the mouse comparison that contrast slow virus injection in RN slow virus in body.The PCR in real time analysis of miR-135b level discloses and contrast slow virus and inject 10 times of inductions (P=0.0032, Fig. 4 B) that mouse is compared.The adult mice of injecting miR-135b and cross expression is exposed to chronic social failure, to cause behavior depression, and carries out performance testing subsequently.After performance testing, perfusion mouse is also analyzed the injection part bit position (Fig. 4 C-D) of brain.RN miR-135 cross expression mouse be presented at forced swimming (the 3rd minute, P=0.0088; And the 4th minute, P=0.00330; Fig. 4 E) in and in outstanding tail experiment (in last 5 minutes in test, P=0.07356, Fig. 4 F) the middle stationary state time reducing, prompting miR-135 crossed the antidepressant effects of expression without any the variation observing (Fig. 4 G-Fig. 4 H) in their rearging cage motion.
To sum up, the present inventor has determined that the specificity miR of RN serotonergic and non-serotonin serotonergic neuron expresses finger printing.The present inventor intersects the data set of this uniqueness and the miR of Bioinformatics Prediction to(for) target 5HT genes involved.Use the luciferase analysis of 3 ' UTR and in mutation research the present inventor's vitro test for the target prediction of Tph2, MaoA, Slc6a4 and Htr1a, and except miR-target interacts, also disclose the strong restraining effect of miR-135 to Sl6a4 and Htr1a3 ' UTR.In addition, contriver proves that the miR-135 in RN is lowered by acute stress, and is given, raised by SSRI medicine in particular by antidepressive.In addition, the present inventor has determined after SSRI gives the miR-135a level in RN and the reverse dependency between its level in blood plasma.Finally, the present inventor proves that locus specificity is crossed the behavior depression that expression miR-135 causes minimizing after social activity failure in adult mice RN.
Embodiment 2
MiR-19 is target 1 type Beta-3 adrenergic receptor (Adrb1) specifically
Material and experimental arrangement
3'UTR clone is entered to Psicheck2 luciferase expression plasmid
By the 3'UTR sequence of mouse gene group DNA pcr amplification ADRb1.By Epoch Biolabs, Inc.(TX, USA) the 3'UTR sequence of the synthetic sudden change that lacks all 4 kinds of miR-19 seeds couplings.According to the guidance of manufacturers, 3'UTR PCR fragment is connected to pGEM-T easy carrier (Promega), and is further subcloned into single NotI site at the 3' end place of the luciferase in Psicheck2 reporter plasmid (Promega).Cut and confirm clone's orientation by order-checking by diagnosis.
Transfection and luciferase analysis
Converge and use the following plasmid transfection of polymine to 70-85% with poly-L-Lysine growth HEK293T cell or HT22 neuronal cell with 48 hole forms: Psicheck2-3'UTR plasmid, before in pEGFP plasmid-and mmu-miR-19b crosses and expresses or independent pEGFP plasmid (clontech), and miR-19b knocks out (KD) plasmid (Genecopoeia) or contrast-KD plasmid (Genecopoeia).24 hours lysing cell measure luciferase reporter gene activity (as described earlier) [Chen A.et al.Mol Endocrinol(2005) 19:441-58] after transfection.Renilla luciferase value is normalized to contrast Photinus pyralis LUC level (transcribe from same vehicle, but the impact of the 3'UTR not tested) and 6 holes under every kind of condition repeated in addition average.
Result
Have miRNA target sequence conservative in different, evolution (it is included in the some repeating units in their 3'UTR) stress genes involved analysis of biological information disclose miR-19 as the strong candidate for target 1 type Beta-3 adrenergic receptor (Adrb1), wherein on Adrb13'UTR, there are three strong conservative and lower conservative miR-19 seed couplings.Adrb1 is adrenergic receptor, and it is expressed in the not same district of brain, comprises amygdala, hippocampus and paraventricular nucleus (PVN).Amygdala Adrb1 had previously been described to affect anxiety-like behavior [Fu A et al., BrainRes (2008) 1211:85-92; Rudoy CA and Van Bockstaele EJ; ProgNeuropsychopharmacol Biol Psychiatry (2007) 31:1119-29] and fear memory [Roozendaal B et al., J Neurosci (2004) 24:8161-9; Roozendaal B et al., Neuroscience (2006) 138:901-10].What is interesting is, Adrb1 is found to be positioned on the CRF positive cell of amygdala and is G protein coupling receptor (GPCR), and its impact that applies it via Gs is with further activated adenyl cyclase (AC).There is the gene of 10 kinds of known coding AC, i.e. ADCY1-ADCY10.Three kind (ADCY1, ADCY7 and the ADCY9s) of Bioinformatics Prediction in them are by miR-19 institute target.ADCY1 has the specific expressed and previous research of brain and shows, in mouse forebrain, the expression excessively of ADCY1 can strengthen recognition memory (recognition memory) and LTP[Wang H et al., Nat Neurosci(2004 again) 7:635-42].
Whether really regulate Adrb1 or ADCY1 to express by its supposition target sequence on Adrb1-3'UTR or ADCY1-3 ' UTR in order to study miR-19, by Adrb1-3'UTR(Fig. 5 of complete or mutant form) or the downstream that is cloned into the luciferase gene in Psicheck2 expression plasmid of ADCY1-3 ' UTR.In the ADRb1-3'UTR of mutant form, lack all 4 kinds of seeds couplings (Fig. 5) for miR-19b.In the part ADCY1-3'UTR of mutant form, only lack conservative seed coupling (in 3 kinds).
Luciferase analysis is used for determining the interactional character between miR-19 and Adrb1-3'UTR and between miR-19 and ADCY1-3 ' UTR.Endogenous express in the HT22 cell of low-level miR-19, between the luciferase level of controlling at ADRb1-3 ' UTR by complete or mutant form, do not find differences (Fig. 6 A).But, when cross expression miR-19b in HT22 cell time, in the time being driven by complete form, with respect to the ADRb1-3 ' UTR of mutant form, luciferase level significantly (approximately 2 times) reduce (except general in normalization method luciferase expression, seem non-specific minimizing) (Fig. 6 B).Endogenous express in the HEK293T cell of high-caliber miR-19b, the luciferase expression level being regulated by ADRb1-3 ' UTR is lower than the horizontal 2-4 of luciferase expression expressing in the time that ADRb1-3 ' UTR by mutant form regulates times (Fig. 6 C).
Use MiR to knock out (KD) system to operate miR-19 level in HEK293T cell.That is, (1) miRCURY LNA KD probe (Exiqon, MA, USA, Fig. 6 D), and (2) knock out sequence miArrest(Genecopoeia, Rockville, MD, USA, Fig. 6 E based on plasmid).The KD probe mixed and disorderly with respect to contrast, the anti-miR-19b of LNA-strengthens the luciferase level approximately 20% of expressing in the time being regulated by ADRb1-3 ' UTR, and the ADRb1-3 ' UTR of mutant form is not affected to (Fig. 6 D).But, with respect to contrast KD sequence, in the luciferase expression regulating at the ADRb1-3 ' UTR by complete form, on causing, the miR-19b KD based on plasmid reaches the enhancing (Fig. 6 E) to 2 times.The luciferase level driving with respect to the ADRb1-3 ' UTR by mutant form, does not realize the complete rescue of luciferase level.This can be by the miR-19b specificity of probe/genome sequence (regulating with lance thorn (spearing) miR-19a), in HEK293T cell, may be difficult to the high miR-19 level of fully lowering or it can be incorporated into the identical seed matching sequence on ADRb1-3 ' UTR at other possible miRNA(of HEK293T cells) impact explain.
Embodiment 3A
After chronic stress, in PFC and amygdala, MiR-19a and MiR-19b are raised
Material and experimental arrangement
Animal and dwelling
With CamKIIa-Cre mouse [Dragatsis I et al Genesis.(2000) 26(2): 133-5] cross-breeding miR17～92flx/flx mouse [Ventura A et al, Cell(2008) 86-875:(5) 132; 7].Transgenic mice or adult C57BL/6J male mice are placed in temperature-controlling chamber's (22 ± 1 DEG C) with 12 hours illumination/dark cycles putting upside down.Food and water can arbitrarily obtain.All experimental programs are ratified by Institutional Animal Care and Use Committee of TheWeizmann Institute of Science.
Produce the slow virus for the miR-19b operation at the brain of growing up
MiR-19b KD sequence clone is entered to slow virus plasmid, after rna plymerase iii-H1 promotor.In addition, in slow virus plasmid, before neuronal specificity promotor (synapsin of enhancing, ESyn) rear clone-miR-19b sequence.MiR-19b-KD in body and front-miR-19b-are crossed to expression (OE) experiment generation slow virus.These slow viruss are used for operating miR-19b level in target area, wherein find that miR-19 level is changed after behavior/medicine excites.
Be created in the mouse that lacks miR-19 in forebrain
In order to be created in the mouse that lacks miR-19 in forebrain, contriver is just being carried at the mouse of the gene of the Cre recombinase of encoding under CamKIIa promotor in breeding, and its small mouse carries miR bunch of miR17～92 of condition form (conditional form).MiR-19 family comprises miR-19a and miR-19b.In mouse genome, miR-19b has two identical copies, miR-19b-1 and miR-19b-2.MiR19a and miR-19b-1 are positioned at identical miRNA bunch above, i.e. miR17～92, and miR-19b-2 is positioned at different genomic gene seats, miR106a～363.The latter seems to have in mouse tissue seldom or not and expresses, and therefore knocks out miR17～92 bunch expectation and by being enough to, the miR-19a in forebrain and miR-19b expression level is exerted far reaching influence.
Behavior/medicine excites
ADRb1, the ADCY1 of mouse and the expression level of other transcripts and gene product that in forebrain, lack the mouse of miR-17～92 bunch or wherein operation especially (cross and express or lower (KD)) miR-19 in specific brain regions district will be checked.Also by anxiety-like behavior, locomotor activity and the memory performance of these animals of test.In addition, in WT mouse, carrying out with NRI Reboxetine after acute and chronic whole body therapeutic, in different target areas (E.G, hippocampus, amygdala and forebrain), checking the expression level of miR-19a and miR-19b.
Result
MiR-19a/b level in the prefrontal cortex (PFC) of the mouse of or chronic injection acute by assessment NRI (NRI) Reboxetine, the physiological association (Figure 12 A-Figure 12 D) between research miRNA-19 and Adrb1.As shown in Figure 12 A-Figure 12 D, acute give Reboxetine after miR-19a/b level lowered (Figure 12 A, Figure 12 B) chronic give Reboxetine after by raise (Figure 12 C, Figure 12 D).
Then, stress after, assess the level (Figure 13 A-Figure 13 D) of miR-19 by measuring the level of miR-19a in PFC and the amygdala of mouse that stand social failed scheme and miR-19b.As shown in Figure 13 A-Figure 13 D, after chronic stress, in PFC and amygdala, the level of miR-19a and miR-19b all raises.These presentation of results, miR-19 participates in the adjusting of central stress reaction.
Embodiment 3B
MiRNA-19 and Cannabined receptor 1(CB1)
Material and experimental arrangement
Animal and dwelling
As be described in above embodiment 3A.
The slow virus that in brain, generation operates for miRNA-19b that grows up
As be described in above embodiment 3A.
Result
CB1 is the GPCR of abundant expression a kind of and be enriched in especially cortex, amygdala, hippocampus, basal ganglion and cerebellum (Figure 15 A-B) [Herkenham M.et al., TheJournal of neuroscience:the official journal of the Society forNeuroscience (1991) 11:563-583 in brain; Mackie, K.Handbook of experimentalpharmacology (2005) 299-325].CB1 acceptor by highly express in aixs cylinder and axon ends, wherein they by fine location with regulate neurotransmission.Contriver finds that CB1 comprises 2 the seed sites compatible with miRNA-19.
Determine the interactional character between miRNA-19 and CB1-3'UTR with luciferase analysis.In the time that miRNA-19b in HT22 cell (together with the 3`UTR of CB1) is crossed expression, in the time comparing with the GFP being expressed by mistake by means of identical 3`UTR, luciferase level is (50%) lower (Figure 14) significantly, and it supports the effect that miR-19 may bring into play in adjusting CB1 level.Carry out other mutating experiment to confirm the effect (as above for Adrb1 described) of miR-19 Seed Sequences to the adjusting observing of prediction.
What is interesting is, previous research shows fixed [Roozendaal, B.et al.Neurobiology of learning andmemory (2006) 86:249-255] that promote to detest memory by the communication meeting between glucocorticosteroid, norepinephrine energy and cannaboid signal in the Basolateral Nucleus of amygdala (BLA) convincingly.The model [Hill M.N.andMcEwen B.S.Proc of the Nat Acad of Sci of the USA (2009) 106:4579-4580] being proposed by Hill and McEwen illustrates in BLA for remembering the possible mechanism of action (Figure 16) of consolidation.
As illustrated in current result, MiRNA-19 seems to regulate Adrb1 and CB1 externally.Performance at the learning and memory example small mouse test of (as having and not being exposed to the fear conditioning (fear conditioning) being full of the exciting of pressure) is expressed and knock out and checked to the mistake that uses the slow virus (it can change the level of Adrb1 and CB1 there) that is for example delivered to especially BLA to carry out miR-19.
Embodiment 3C
Identify the miRNA of differential expression in the mouse of standing chronic stress
Material and experimental arrangement
The immunoprecipitation of Ago2 albumen
Being supplemented with in the NP40 damping fluid of RNA enzyme inhibitors, proteinase inhibitor and phosphatase inhibitors (phosphates inhibitor), homogenizing is from the pond of 3 amygdala of 3 animals, and wherein above-mentioned animal is from phase (" susceptible ", " resilience " or contrast) on the same group.Continuous stirred sample 2 hours at 4 DEG C.Then in microcentrifuge at 12,000rpm and 4 DEG C centrifugal sample 20 minutes, supernatant be placed in the fresh-keeping tube remaining on ice and discard throw out.Under rotation and room temperature, hatch magnetic Protein G pearl (Dynabeads, Invitrogen) 10 minutes by Ago2 monoclonal antibody (WAKO).Repeatedly washing after sample is added Ago2 apply Protein G pearl and 4 DEG C and stir under overnight incubation.Next day, with PBS washing pearl 3 times.For RNA purifying, homogenizing pearl in RLT damping fluid (RNeasy test kit, miRNA additional project).For western blot analysis, in sample buffer, boil pearl to discharge protein from pearl.
RNA purifying and microarray
Use RNeasy plus test kit (Qiagen), according to Qiagen additional project 1: total RNA that purifying comprises miRNA, by Ago2 immunoprecipitation sample separation RNA.Use the miniature test kit of miRNeasy (Qiagen) also to separate the RNA for every other object according to manufacturer's recommendation from freezing brain stripping and slicing, and evaluate RNA integrity with Agilent2100 biological analyser.After Ago2 immunoprecipitation, further analyze the RNA that is derived from tissue that stress mouse with Affymetrix miRNA2.0 array (being rich in RNA scheme) and Affymetrix mouse gene 1.0ST array.
Result
In order to determine that separating oneself with research stands chronic stress example and/or the miRNA with the differential expression of the amygdala of the mouse of " resilience " or " susceptible " behavior phenotypic correlation, has used social failed scheme (referring to method part).
In order to identify real connection between miRNA and the 3`UTR of their target gene (according to social activity failure example), carry out the immunoprecipitation (IP) of Ago2 mixture and analyze the colony of miRNA and the mRNA of co-precipitation.In the time that ripe miRNA forms, it is incorporated to RISC complex body.In RISC complex body time, Ago2 can promote interaction between specific miRNA and its said target mrna 3`UTR [Meister G.et al., Molecular cell(2004) 15:185-197] (Figure 17 A).
Can, with the RNA deposit A go2 mixture of its combination, carry out IP to the amygdala of young mice in order to verify really.With carrying out IP with the Protein G magnetic bead of mono-clonal Ago2 antibody response.As shown in Figure 17 B, be settled out specific Ago2 band from the extract (Figure 17 B, swimming lane 1) of NIH3T3 cell or the extract (Figure 17 B, swimming lane 2) of amygdala tissue.
In order to show the specificity of IP, full brain sample is divided into two parts, wherein precipitate a part with anti-Ago2, and precipitate another part with contrasting IgG1 non-specific antibody.Specific Ago2 band exists only in (Figure 17 B, swimming lane 3,4) in Ago2 throw out.
Therefore,, by (pulling down) Ago2 mixture miRNA and the mRNA colony of analysis in sedimentable matter of leaving behind, there is more opportunity discovery exact connect ion between given miRNA and the mRNA3`UTR of its target in specific brain regions district.
separate the relevant RNA of Ago2 from standing the mouse amygdala of social failed example
Then,, based on the concrete outcome of Ago2IP experiment, implement same strategy to be disclosed in the potential difference in miRNA and their said target mrna in the brain of the mouse of standing social failed scheme.
After 10 days, mouse is divided into 3 groups: contrast, " susceptible " and " resilience " at social activity failure example.When mouse runs into show social the avoidance during from attacking his new mouse in identical strain social failed example, mouse is characterized as being " susceptible ".If mouse does not escape new attack mouse and is in contact with one another with it, mouse is characterized as being " resilience ".Mostly stand social failed mouse and conventionally show social avoidance, thereby should be classified as " susceptible ".In experiment, approximately only the mouse of 10-20% estimates it is " resilience ".Below illustrate it is the example of carried out social avoidance test.
As shown in Figure 18 A, mouse is placed on separately in social labyrinth to 3 minutes so that adapt to.Camera is followed the tracks of the movement of mouse in whole labyrinth.In Figure 18 C, same mouse is exposed to the new ICR mouse of placing separatedly.Camera is followed the tracks of the mouse in the angle farthest in the place of the position away from new mouse.This reaction is considered to social and avoids, and therefore this mouse is classified as " susceptible ".By contrast, in Figure 18 B and Figure 18 D, mouse does not show social the avoidance, is therefore classified as " resilience ".
40 mouse social failed example of experience and 40 mouse are in contrast.After social avoidance test, 9 " resilience " mouse, 9 " susceptible " mouse and 12 control mice are selected for brain micro-dissection.Within 8 days after social avoidance test, gather brain sample and trunk blood from amygdala, BNST, PFC, nucleus raphes dorsalis and hippocampus.
Merge the pond available from 3 amygdala strippings and slicings of 3 different mouse, and carry out immunoprecipitation by means of anti-Ago2.After IP, autoprecipitation material extracts RNA.After 3 amygdala of every group of pull-out, exist from 3 RNA samples of " resilience " mouse, from 3 RNA samples of " susceptible " mouse with from 4 RNA samples of control mice, amount to 10 RNA samples.Test each sample with mouse ST microarray and with miRNA array (all from Affymetrix).Checked gene and miRNA, with respect to control group, in every group of 2 groups " susceptibles " or " resilience ", it is upward or downward.If interacted between certain miRNA and target gene, contriver estimates the contrary dependency aspect their aggregate level.But, the mRNA expection existing in RISC complex body (by anti-Ago2 precipitation) has high level, this is because they are not yet by fragmentation, therefore in the time checking array data, contriver also checks with respect to control sample and raises or the miRNA of downward and potential mRNA target, because this indicates them to interact in RISC complex body.
microarray results
Table 3, hereinafter, illustrates the preliminary array result that uses conventional filtration device to analyze.
Table 3A-table 3B: the list of raising (table 3A) or lowering the amygdala miRNA of (table 3B) after carrying out IP with Ago2.
Raise Multiple changes Multiple changes
? Susceptible Resilience
mmu-miR-301a_st 1.96 2.11
mmu-miR-15a_st 1.66 1.87
mmu-miR-29a_st 1.42 1.82
mmu-miR-19b_st 1.97 2.34
mmu-miR-146b_st 1.55 1.94
mmu-miR-181d_st 1.54 1.64
mmu-miR-146a_st 1.41 1.60
mmu-miR-27b_st 1.45 1.91
mmu-miR-20a_st 1.57 1.52
mmu-miR-30a_st 1.34 1.65
mmu-miR-100_st 1.41 1.55
mmu-miR-153_st 1.44 1.92
mmu-miR-194_st 1.57 1.78
mmu-miR-30c_st 1.40 1.66
mmu-miR-23a_st 1.51 1.70
mmu-miR-106a_st 1.62 1.61
mmu-miR-30b_st 1.43 1.70
mmu-miR-195_st 1.59 1.98
mmu-miR-30e_st 1.36 1.56
mmu-miR-126-3p_st 1.58 1.76
mmu-let-7i_st 1.49 1.57
mmu-miR-434-5p_st 1.30 1.55
mmu-miR-376b_st 1.64 1.99
mmu-miR-495_st 1.45 1.82
mmu-miR-369-5p_st 1.60 1.77
mmu-miR-421_st 1.71 1.53
mmu-miR-543_st 1.52 1.69
mmu-miR-410_st 1.44 1.76
mmu-miR-34b-5p_st 2.18 1.53
(table 3A)
(table 3B)
* for table 3A-table 3B, data are represented as for " susceptible " or " resilience " mouse multiple compared with the control and change.Runic numerical value is significantly changed.
Some miRNA, are significantly raised in its " susceptible " mouse and " resilience " group, have been selected and have been shown in hotspot graph (referring to Figure 19 A-Figure 19 B).
Gene expression arrays (mRNA)
Table 4: in the list of the amygdala mRNA that carries out raising after IP with Ago2.
* data are represented as, and " susceptible " or " resilience " mouse multiple compared with the control changes.Runic numerical value is significantly changed.
Table 5: at IP(by means of Ago2) after the list of amygdala mRNA of lowering.
Some potential miRNA and their supposition target in brain are analyzed.
Embodiment 4A
MiR-15a and miR-15b are as the regulon of stress reaction
Material and experimental arrangement
Total RNA extracts
Within 90 minutes after acute stress program, cut amygdala tissue.Use miRNeasy test kit (Qiagen) to separate total RNA to preserve miRNA.Freezing brain stripping and slicing is transferred to lysis buffer homogenizing immediately.In hole (in-well) support thing or N2a cell culture in cracking culture of primary neurons on ice.Further process according to manufacturer's recommendation.RNA extract is stored at-80 DEG C until use.
MiRNA array
By Agilent(Agilent, Santa Clara, CA, USA) or Affymetrix(Affymetrix, Santa Clara, CA, USA) miRNA microarray measure miRNA differential expression according to the specification sheets of manufacturers.In order to assess miRNA differential expression with Agilent array, according to the specification sheets of manufacturers, mark and the hybridization total RNA/ sample of 100ng (3 control samples and two acute stress samples) separately.Carry out scanning array by Agilent microarray scanner.Extracting data with AgilentFeature Extraction software v9 also uses genomics Suite(Partek Inc., St.Louis, Missouri, USA) analyzed.Data from GeneView.txt file are carried out to logarithmic transformation and fractile normalization method.For assessing miRNA differential expression with Affymetrix array, according to the specification sheets of manufacturers, mark and the hybridization total RNA/ sample of 1 μ g (two control samples and two acute stress samples) respectively.Carry out scanning array by Affymetrix microarray scanner.Extract data and use the default parameters normalization method (background adjustment, fractile normalization method, logarithmic transformation and threshold value determine) of Affymetrix miRNAQCtool software with Affymetrix scanner software.By the normalization data input PartekGenomics software from 4 files.Filter out the gene not being present in any microarray.Due to the difference that miRNA distributes, institute thinks that each array selects different logarithmic ratio cut-off (for each array, corresponding to extremely approximately 1 standard error): for Agilent, and 0.2, and for Affymetrix, 0.4.Between array, relatively logarithmic ratio is greater than the miRNA of cut-off and reports common miRNA.
3'UTR clone is entered to Psicheck2 luciferase expression plasmid
From the 3'UTR sequence of mouse gene group DNA pcr amplification CRFR1.According to the guidance of manufacturers, 3'UTR PCR fragment is connected to pGEM-T easy carrier (Promega), and is further subcloned into single NotI site at the 3' end place of the luciferase in Psicheck2 reporter plasmid (Promega).Cut and confirm clone's orientation by order-checking by diagnosis.
Transfection and luciferase analysis
With 48 hole forms, the HEK293T cell of growing on poly-L-Lysine converges to 70-85%, and use the following plasmid transfection of polymine: Psicheck2-3'UTR plasmid, in pEGFP plasmid before-mmu-miR-15 crosses and expresses or pEGFP plasmid (clontech) separately.After transfection 24 hours, lysing cell was also measured luciferase reporter gene activity (as described earlier) [Chen A.et al.Mol Endocrinol(2005) 19:441-58].Renilla luciferase value is normalized to contrast Photinus pyralis LUC level (transcribe from same vehicle, but the impact of the 3'UTR not tested) and 6 holes under every kind of condition repeated in addition average.
Result
After acute restraint stress 90 minutes, miR-15a and miR-15b became (Fig. 7 A-B) of rise.The equal target CRFR1-3'UTR(of Bioinformatics Prediction miR-15a and miR-15b Fig. 7 C).In HEK293T cell, external mistake is expressed the remarkable level (Fig. 7 D) that reduces the luciferase expression that is controlled by CRFR1-3'UTR of miR-15b.
Embodiment 4B
The impact of miR15 on FKBP5
Material and experimental arrangement
As be illustrated in embodiment 4A above.
Result
According to array result, with respect to control group, in " susceptible " and " resilience " mouse, miR-15a and FKBPL 5(are also called as FKBP5) all raised (Figure 20 A-B), this points out their rises in RISC complex body is the result of chronic stress.
The effect of FKBP5 in posttraumatic stress disorder, depression and anxiety determined in gene studies.For example, find that single nucleotide polymorphism (SNP) in FKBP5 and children abuse interact, to predict the seriousness [Binder, E.B.et al., Nature genetics(2004) 36:1319-1325] of adult posttraumatic stress disorder (PTSD).These discoveries show that (abused as) children individuality of being maltreated with these SNP compares the more susceptible PTSD that grows up.It has also been found that the less expression of FKBP5 [Yehuda, R.et al., Biological psychiatry(2009) 66:708-711] in the individuality of suffering from present PTSD.FKBP5 gene be found to have multiple polyadenylations site and statistics upper relevant to the dysthymia disorders of higher rate [Binder et al, above].
The 3`UTR that further analyzes FKBP5 discloses it and has the seed matching sequence conservative with respect to of miR-15 (Figure 20 C).
If miR-15a regulates FKBP5mRNA really, although expection miR-15a and FKBP5 in Ago-2 throw out will all be raised (as shown in microarray results, Figure 20 B), in amygdala sample, the aggregate level of the protein of mRNA or FKBP5 will reduce.
Whether to interact between miR-15a and FKBP5 in order checking in amygdala, total RNA sample of the amygdala available from " susceptible " and control mice to be carried out to PCR in real time analysis.As shown in Figure 21 A-Figure 21 B, raise available from miR-15a level in total RNA extract of susceptible mouse, and FKBP5 level reduces.These results show, after chronic stress condition, miR-15a is suppressed at the FKBP5 level in amygdala.
Whether the FKBP5 of the complete and sudden change 3`UTR form that clone analyzes for luciferase assay find between miR-15a and FKBP5 external generation direct interaction.
Except FKBP5, miR-15 can regulate potentially and participate in some genes of stress reaction, comprises Stx1a(cynapse chemotactic element 1a(Syntaxin1a)), Sgk1(serum/glucocorticosteroid regulates kinases) and Adrb2(Figure 22).
Embodiment 4C
MiR-181 regulates glutamate receptor
Material and experimental arrangement
3'UTR clone is entered to Psicheck2 luciferase expression plasmid
From the 3'UTR sequence of mouse gene group DNA pcr amplification Grm1, Grik3, Grm5, Grik2 and Grm7.According to the guidance of manufacturers, 3'UTR PCR fragment is connected to pGEM-Teasy carrier (Promega) or pJET1.2 carrier (Fermentas), and is further subcloned into single NotI or the XhoI site at the 3' end place of the luciferase in Psicheck2 reporter plasmid (Promega).Cut and confirm clone's orientation by order-checking by diagnosis.
Chronic social failure
Make mouse stand social failed scheme (as described earlier) [Krishnan V.et al.Cell(2007) 131:391-404].Briefly, mouse is put into the rearging cage of aggressive ICR mouse and there their healths interact 5 minutes.During this period, ICR mouse attack invasion mouse and effractor show obedience attitude.Then the transparent synthetic glass separator of perforation is placed between animal and mouse is remained on in identical cage 24 hours and contact with permission sensation.Then in ensuing 10 days, with strange ICR mouse repetition said procedure.
Result
In the mouse that suffers chronic stress, miR-181d level significantly improves (Figure 23).In order to find the interaction between miR-181 and potential mRNA target, contriver finds that miR-181 can regulate potentially and is permitted eurypalynous glutamate receptor.In general, glutamate receptor can be divided into two groups: ionic glutamate receptor (iGluR), and in the time that L-glutamic acid is incorporated into acceptor, it forms the ionic channel hole of activating; And metabotropic glutamate receptor (mGluR), amplify the ionic channel of its indirect activation on membrane plasmapheresis by the signal cascade that relates to G albumen.
In the many specific hypotype of glutamate receptor, be often referred to by the Main Subtype of chemistry (by a chemical), it is more optionally incorporated into it than L-glutamic acid.Although this research well afoot, because determined hypotype and measured chemical affinity.Some compounds are conventional for glutamate receptor research relevant to receptor subtype.
Table 6: the glutamate receptor that is divided into subgroup
As shown in Figure 24 and Figure 25, in all conservative prediction target of miR-181, there are 6 kinds of glutamate receptors (Grm1, Grik3, Grm5, Gria2, Grik2 and Grm7).
Previously showed, in hippocampal neuron, miR-181a regulation and control Gria2 surface expressions [Saba.R.et al., Molecular and Cellular Biology (2012) 32 (3): 619-32].Just carrying out luciferase analysis interacts to confirm miRNA-mRNA.In addition, thus condition miR-181KO mouse species and specific cre incross are obtained to the disappearance of miR-181 in specific brain regions nucleus (brain nuclei).
Embodiment 5A
MiR-182a, the fine setting thing of normal neurons activity and spiritual pathology behavior
Material and experimental arrangement
3'UTR clone is entered to Psicheck2 luciferase expression plasmid
From the 3'UTR sequence of mouse gene group DNA pcr amplification Htr1a.According to the guidance of manufacturers, 3'UTR PCR fragment is connected to pGEM-T easy carrier (Promega), and is further subcloned into single NotI site at the 3' end place of the luciferase in Psicheck2 reporter plasmid (Promega).Cut and confirm clone's orientation by order-checking by diagnosis.
Transfection and luciferase analysis
With 48 hole forms, on poly-L-Lysine, grow HEK293T cell to 70-85% converge and use polymine with below plasmid transfection: Psicheck2-3'UTR plasmid, in pEGFP plasmid before-mmu-miR-182 crosses expression plasmid or independent pEGFP plasmid (clontech).After transfection 24 hours, lysing cell was also measured luciferase reporter gene activity (as described earlier) [Chen A.et al.Mol Endocrinol (2005) 19:441-58].Renilla luciferase value is normalized to contrast Photinus pyralis LUC level (transcribe from same vehicle, but the impact of the 3'UTR not tested) and 6 holes under every kind of condition repeated in addition average.
Chronic social failure
Mouse is stood social failed scheme (as described earlier) [Krishnan V.et al.Cell (2007) 131:391-404].Briefly, mouse being put into the rearging cage of aggressive ICR mouse and their healths interacts 5 minutes.During this period, ICR mouse attack invasion mouse and effractor show obedience attitude.Then the transparent synthetic glass separator of perforation is placed between animal and mouse is remained on in identical cage 24 hours and contact with permission sensation.Then in ensuing 10 days, with strange ICR mouse repetition said procedure.
Micro-dissection nuclei of median raphe and sampled plasma
Remove brain and it is placed on vinylformic acid brain matrix (acryl brain matrix) (Stoelting) upper after, obtain brain sample from mouse nuclei of median raphe (RN).Use standard insert (GEM) and obtain section based on appointment anatomic landmark thing.Flush end 14G syringe is used for extracting RN district since the 3mm section that matrix is removed.
MicroRNA purifying and quantitative RT-PCR expression analysis
Use the miniature test kit of miRNeasy (Qiagen) (according to manufacturer specification) to comprise microRNA from neurone, freezing brain stripping and slicing and the separating plasma mRNA(of classification), and use miScriptReverse transcript reagent box to process miRNA to produce cDNA.Then, use greenPCR test kit (Qiagen) is analyzed cDNA sample in AB7500 thermo cycler (AppliedBiosystems) according to the guidance of manufacturers.Use the Auele Specific Primer for every kind of miR together with commercial universal primer, U6snRNA is used as to internal reference simultaneously.
Clone miR182 crosses expressing viral vector
By PCR before mouse genome DNA cloning-miR-182, wherein primer add restriction enzyme AgeI site, then by interior Slc6a4ization (inSlc6a4ed) arrive pGEM-T Easy carrier (Promega, Madison, WI).At order-checking pGEM-T Easy and digestion pGEM-T Easy and pEGFP carrier (Clontech laboratories Inc., Mountain View, CA), after, immature miR-182 sequence is connected to pEGFP carrier with construction expression plasmid pEGFP-miR-182 with AgeI.Then, cut pEGFP-miR-182 by BamHI and BsrGI, it is parallel to and cuts pCSC-E/Syn-eGFP plasmid by same enzyme, then miR-182-eGFP sequence is connected to pCSC-E/Syn with build before pCSC-eSNY--miR-182-eGFP plasmid, it is confirmed by restriction endonuclease analysis and DNA sequencing.
Produce lentiviral vectors
Produce recombinant slow virus (as described earlier) [Naldini L et al., Proc Natl Acad Sci U S A(1996) 93:11382-8] by the transient transfection in HEK293T cell.Briefly, within 48 and 72 hours after transfection, gather in the crops infectious slow virus, filter by 0.45 μ m hole cellulose ethanoate strainer, and concentrated by ultracentrifugation.
Result
Up to the present, mainly in cancer correlative study as human lung adenocarcinoma cell, glioma, breast cancer, bladder cancer, melanoma and DNA have reported miR-182 in repairing.In addition, find that miR-182 relates to growth course, as inner ear and retinal development, and relate to immunity system, relate to the lymphocytic activation of T, and relate to lupus.In neural system, mi-R182 relates to sensory organ specificity rat dorsal root ganglion, and as physiological clock conditioning agent, in major depression patient, find the dependency [Saus E et al., Hum MolGenet. (2010) 19 (20): 4017-25] between the heritable variation of front-miR-182 simultaneously.In addition, in the helpless behavior male rat prefrontal cortex that recoils to acquistion, except 12 kinds of miR, also listing miR-182 is [SmalheiserNR et al., Int J Neuropsychopharmacol. (2011) 1-11] lowering.
The bioinformatic analysis hint miR-182 of the Htr1a3'UTR carrying out as a part for 5HT miR microarray analysis may this gene of target.Thereby, to analyze contriver by means of luciferase and carry out vitro test, it shows the strong inhibition (Fig. 8) of miR-182 to Ht1a3'UTR.Two kinds of conservative seed matching sequences for miR-182 appear at Htr1a mouse 3'UTR.
Regulating study shows, compared with the control, the strong tendency (Fig. 9) that the decline of miR-182 expression level regulates in the RN that is exposed to the bull mouse that chronic social activity is failed, this prompting miR-182 participates in the molecules in response to known environmental stimulus of leading behavior depression.
The further bioinformatic analysis that produces target prediction for miR-182 in two databases has disclosed the long list of potential target, is included in normally and gene (Figure 10) relevant to neuronal activity under pathological state.
Interact for further vitro test miR-182 is used for identifying specific miR target, and in order to be disclosed in the body of normal and pathology behavior the role of miR-182 in adjusting, developed plasmid and slow virus system for operating miR-182.Prepare that neuronal specificity is crossed expression slow virus (Figure 11 A) and be vitro test in N2a at neuronal cell.These results show, compared with the control, and crossing the miR-182 level (Figure 11 B) raising in the cell of expressing slow virus infection with miR-182.Buy for miR-182 special knock out plasmid sequence, be called miArrest(Genecopoeia, Rockville, MD, USA, Figure 11 C) and be subcloned into virus formulation body (Figure 11 C).In cell culture and by position specific injection, test these systems to adult mice brain.
Develop the nude mice effect at retinal development with research miR for miR-182.Recently, it is right that contriver obtains the cultivation of this strain, and generating after colony, on behavior and physiology phenotype analytical miR-182KO and their WT littermate.
Embodiment 5B
Adjust miR182 expression level by acute stress
Material and experimental arrangement
As be described in embodiment 5A above.
Result
Check the impact of acute stress on miR182 level.As shown in figure 26, stress be latter 24 hours in induction, the acute fixing miR182 expression level (P<0.01) that stress cause reduction in mouse nuclei of median raphe (RN).MiR182 is presented at the expression level reducing in nuclei of median raphe after acute and chronic stress, and this points out it for the effect stress with Molecular regulator reaction in nuclei of median raphe, may be by affect its target gene Ht1a of adjusting 5-HT level in cynapse.
the miR-target of miR182 prediction target gene is interacted and measured
Use luciferase is analyzed, and has checked the 11 kinds of prediction target genes (Figure 27 A) based on the selected miR182 of bioinformation widely.As measured by the activity that connects reporter gene luciferase, the 3'UTR of vitro test target gene is to check whether miR182 has retarding effect.In the gene of 11 kinds of tests, three kinds of genes: Dscam(Down's syndrome cell adhesion molecule), L1cam(cell adhesion molecule L1) X protein relevant with Tsnax(Translin) shown the retarding effect by miR182, as in luciferase is analyzed (Figure 27 A).In the time testing the 3'UTR of target gene of above listed miR182, in Tsnax, L1cam and Dscam, all observe the conservative seed matching sequence for miR182, point out this miR-target to interact and there is function affect (data are not shown).
Then, verified the direct retarding effect of miR182 to above-mentioned three kinds of genes.Therefore, 3'UTR is suddenlyd change to remove miR182 seed matching sequence, then analyzes by luciferase, by routine 3 ' UTR and the external comparison of sudden change 3 ' UTR.In the time of its seed matching sequence of sudden change, eliminate the retarding effect (Figure 27 B) of miR182 to L1cam3'UTR, and similarly, in sudden change 3'UTR, eliminated the impact (Figure 27 C) of miR182 on Tsnax, show this gene of the direct target of miR182.Dscam and Htr1a to the 3'UTR with sudden change have carried out similar checking.
The mouse model that lacks miR182 is used for studying the interaction between miR182 and its target gene in body.Contriver is just checking the behavior phenotype of miR182KO mouse in the test of Social behaviors, learning and memory and Schizophreniform behavior.
Embodiment 6
In the blood plasma of adult mice and brain, adjust miR135 level
Material and experimental arrangement
Clone miR135 crosses expressing viral vector and miR135KD virus vector
MiR135b KD plasmid pEZX-H1-miR135KD-CMV-mCherry and contrast pEZX-H1-contrast KD-CMV-mCherry are purchased from GeneCopeia(USA).By the primer with side joint NheI site increase H1 promotor and KD sequence, and be connected to pGEM-TEasy.There is NheI site at check order pGEM-T Easy and digestion pGEM-T Easy and p156-pRRL-CMV-GFP() after, H1-KD miR and band otch p156 are connected to produce p156-pRRL-H1-miR135bKD-CMV-GFP and p156-pRRL-H1-contrast KD-CMV-GFP.
Behavior evaluation
After 2 hours, before each test, during the dark stage, carry out all behavior evaluations in adequacy test chamber.
Illumination/dark transferring test
Illumination/dark transferring test instrument and experiment condition are as described earlier.Briefly, above-mentioned instrument comprises 2 chambers: the dark chamber covering, in the time that test starts, mouse is put into wherein; And the bright chamber of illumination, can freely transfer to wherein 5 minutes test period mouse.By means of video frequency following system (VideoMot2; TSE Systems, Bad Hamburg, Germany) quantize the time spending, the number of times of mobile distance, the waiting time of accessing bright chamber and light and shade conversion in illumination in illumination chamber.
Spacious experiment
In the white box of the 50x50x22cm with 120 lux illumination, carry out spacious experiment, mouse is put into wherein to carry out test in 10 minutes.Use video frequency following system (VideoMot2; TSE Systems, Bad Hamburg, Germany) quantize in the time of center cost, the number of times at access center, the waiting time at access center, number of times and mobile total distance of rearing.
Rising adds labyrinth test
Testing tool there is plus sign shape and comprise 2 barriers and 2 very low light open arm according to (6 lux).At 5 minutes test periods, use video frequency following system (VideoMot2; TSESystems, Bad Hamburg, Germany) come number of times that automatic scoring enters, mobile distance and opening the time spending in arm.
Result
Be subject to from the serotonin serotonergic neuron innervation of RN and participate in, in brain position, amygdala (AMY) and the prefrontal cortex (PFC) of mood regulation, having tested antidepressive and having given the impact on miR135 level known.In AMY, give serotonin reuptake inhibitors (SSRI) and NRI (NRI) but not by chronic these medicines that gives by acute, two kinds of miR135 varients are all raised (for SSRI, P=0.0001, for the NRI for miR135a, p=0.003, Figure 28 A; For SSRI, p=0.0001, and for the NRI for miR-135b, p=0.003, Figure 28 B).
At PFC place, by acute SSRI and NRI, miR135b level raised (for SSRI, P=0.0183, and for NRI, 0.0013, Figure 28 is c) but miR135a level does not significantly change (Figure 28 D).In addition, in PFC, chronic SSRI causes the miR135a and the miR135b level (for miR135a, P=0.0241, Figure 28 C, and for miR135b, P=0.0067, Figure 28 D) that reduce.
In addition, after social activity failure example, tested the miR135 level in circulation.As recorded by PCR in real time, compared with control mice, being exposed in the blood plasma of the mouse that chronic social activity is failed, miR135a(P=0.0089; Figure 29 A) and miR135b(P=0.0033; Figure 29 B) level rising.Therefore, current presentation of results is after chronic stress (the known behavior depression of inducing in mouse), and the miR135 in blood plasma is raised, and gives significantly to reduce by antidepressive.These find prompting, and the miR135 level in blood plasma is as the biomarker for the relevant depressive state of serotonergic.
Embodiment 7
Build miR135 and knock out system; Clone, slow virus generate and in vitro and in vivo is confirmed
Material and experimental arrangement
Clone miR135KD virus vector
MiR135b KD plasmid pEZX-H1-miR135KD-CMV-mCherry and contrast pEZX-H1-contrast KD-CMV-mCherry are purchased from GeneCopeia(USA).By the primer with side joint NheI site increase H1 promotor and KD sequence, be then connected to pGEM-TEasy.There is NheI site at check order pGEM-T Easy and digestion pGEM-T Easy and p156-pRRL-CMV-GFP(), H1-KD miR and band otch p156 are connected to produce p156-pRRL-H1-miR135bKD-CMV-GFP and p156-pRRL-H1-contrast KD-CMV-GFP.
Result
For the impact on mouse 5-HT related behavior of the miR135 level that is evaluated at the reduction in RN, adopt the miR135b inhibitor based on plasmid, and the efficiency of testing it by luciferase analysis.In this measures, carry out cotransfection HEK293T cell with miR135OE, miR135KD and 3'UTR plasmid, and test miR135bKD plasmid and block the ability of the retarding effect of miR135 to Slc6a4 and Htr1a3'UTR.Block the miR135b retarding effect (Figure 30 A) of Htr1a3'UTR by miR135KD plasmid.Similarly, block the impact (Figure 30 B) of miR135b on Slac6a43'UTR by miR135KD.These results show, miR135KD plasmid is blocked the biological activity of miR135 really.
MiR135KD sequence and control sequence are subcloned into virus vector (Figure 30 C) and produce the slow virus of expressing different knocking out (KD) sequence.In order to test the ability of slow virus infection cerebral tissue, with any slow virus infection mouse RN.Really, infect and cause that the expression (Figure 30 D-E) of GFP shows the ability of miR135bKD slow virus infection cerebral tissue.
Embodiment 8
The behavior effect that miR135 knocks out in adult mice RN
Material and experimental arrangement
Behavior evaluation
Use for the test (as being described in above embodiment 6) of anxiety and behavior depression and carry out to characterize in behavior mouse.
Result
Verify in vitro and in vivo after miR135KD slow virus, they are used for operating miR135 level in RN and are used for testing their impacts on mouse behavior.MiR135KD slow virus or KD contrast slow virus is expelled to the RN of adult mice, and after decubation test anxiety and behavior depression.Because miR135 suppresses negative regulator of 5-HT, so applicant expects that miR135KD can cause reducing 5-HT level in cynapse, thus and increase anxiety and behavior depression.
In spacious experiment, between group, do not observe difference (Figure 31 A), but in the test of rising pulse labyrinth, miR135KD mouse shows higher anxiety-like behavior: in arm, spend the less time (P=0.0644) and opening the tendency of accessing less time (P=0.0572, Figure 31 B) in arm by being presented at out.In addition, miR135KD mouse open in arm, walk remarkable less distance (P=0.0433) and have opening arm in the tendency (P=0.0124, Figure 31 B) of long access.Similarly, in the half-light test of carrying out under basic stressed condition, compared with the control, miR135KD mouse shows the anxiety-like behavior significantly increasing: in illumination, spend less time (P=0.0454, Figure 31 C), in bright chamber, access less time (P=0.0107, Figure 31 D) and the small distance of walking in bright chamber (P=0.0402s, Figure 31 E).Presentation of results, after acute stress 40 minutes or 24 hours, miR135 level reduces (Figure 30 A-B), therefore, current theory is, in the time testing after acute stress, aspect anxiety-like behavior, stress miR135KD mouse can be same as their contrast, this is because control mice also will have the miR135 level (due to stress) of reduction.In fact,, in the time retesting, in the time within 40 minutes or 24 hours after acute stress, testing, aspect any parameter, between group, there is no difference (Figure 31 C-Figure 31 E) in the dark conversion testing of light.
The behavior depression of test miR135KD under basic condition and after pharmacology operation.Because after SSRI gives, miR135 level shows raising (Figure 31 E) in RN, conjecture is that the reduction of miR135 level can cause the response of the reduction to SSRI.In the outstanding tail experiment of carrying out in basal level and after SSRI gives, aspect the stationary state time, between miR135bKD mouse and contrast KD mouse, there is no difference (Figure 31 F), and observe the expection minimizing (P<0.0008) due to the stationary state time of SSRI treatment.But, in forced swimming test, except the major effect (P<0.0001) of SSRI injection, compare with contrasting KD mouse, in last 2 minutes of test, it is more static (P=0.0141 that injection has the miR135KD mouse of SSRI, 5 minutes, P=0.0404,6 minutes; Figure 31 G), the decay of prompting SSRI antidepressant effects (by being reduced in the miR135 level in RN).This result means, miR135 is a part for endogenous sub, and it causes the behavior being caused by SSRI to change.
Embodiment 9
In 5-HT neurone, miR135 crosses expression
Material and experimental arrangement
Aspect the expression level and behavior of miR135 and its target gene, the mouse of excessively expressing miR135a in 5-HT neurone is contrasted and compared with three littermates.
Result
In the 5-HT neurone of the RN having tested particularly mouse, operate the impact of miR135 level on anxiety and behavior depression.For this purpose, a kind of genic system that used Cre-loxP system development.Particularly, use the ePet Cre mouse of expressing Cre recombinase (particularly in 5-HT RN positive neuron) to obtain 5-HT specificity, and carry out miR135 by the transgenic mice incross that makes 5-HT-specific C re strain (ePet Cre) and the condition with miR135a cross expression and cross expression (Figure 32).
By test (particularly in 5-HT neurone) miR135 expression level (miR135OE) in the RN that crosses the mouse of expressing miR135 for the PCR in real time of miR135, then compared with control mice: cross expression allelotrope for miR135 condition positive, but negative for ePetCRE.MiR135OE mouse shows, approaches 2 times cross and express (Figure 33 A compared with control mice; P<0.05).The expression level of crossing of miR135 is similar to the level of measuring in the RN of mouse after SSRI gives, and pointing out this mouse species is the good model for studying miR135 antidepressive feature.In addition, compared with the control, in the RN of miR135OE mouse, miR135 target gene mRNA, Slc6a4(Figure 33 B; And Htr1a(Figure 33 C P<0.05); P<0.1) lowered, shown that miR135 is to suppressing in the body of its target gene.
Cross expression (particularly in 5-HT neurone) in order to test miR135, miR135OE mouse and the contrast of their littermate are exposed to the failed example of chronic social activity (a kind of program, known can induction depression and anxiety-like behavior), and test anxiety and behavior depression subsequently.
Compare with contrasting littermate, after social activity failure, miR135OE mouse shows the anxiety-like behavior increasing.In spacious, the number of times at the time based at center and access center observes the tendency (P<0.1, Figure 34 A) of the anxiety of increase in miR135OE mouse.And in the dark conversion testing of light, miR135OE mouse spends the more time (P<0.05, Figure 34 B) and in bright chamber, spend the less time (P<0.01, Figure 34 B) in illumination.In rising pulse labyrinth, observe similar result (P<0.05, Figure 34 B), miR135OE mouse is opening in arm (the P<0.05 that spends the more time, Figure 34 C) and opening in arm mobile larger distance (P<0.05, Figure 34 C).
After social activity failure, the behavior depression of miR135OE mouse is lower than contrast littermate.Compared with the control, in outstanding tail experiment, observe the tendency (P<0.1, Figure 34 D) of the stationary state time of the minimizing of miR135OE mouse, and in forced swimming test, the stationary state time (P<0.05, Figure 34 E) significantly reducing.
Although described the present invention together with its embodiment, it is evident that, many substitute, improve and change will be apparent to those skilled in the art.Therefore, it is intended to comprise all such substituting, improve and change, and it belongs to spirit and the broad range of claims.
The full content of all publications, patent and the patent application of mentioning is in this manual incorporated into herein with way of reference.In addition, the quoting or identify and should not be interpreted as admitting that such reference can be used as formerly technology of the present invention of any reference in this application.In the scope of use chapter title, they should not be interpreted as must be restrictive.

Claims (81)

1. a raising that is used for the treatment of wherein serotonin level in its experimenter of needs is the method for illness useful in treatment, described method comprises and gives the exogenous polynucleotide that described experimenter encodes at least one microRNA or its precursor, or at the encode exogenous polynucleotide of at least one microRNA or its precursor of described experimenter's cells, thereby treat described illness, wherein, described microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
2. the exogenous polynucleotide of coding at least one microRNA or its precursor are manufacturing the application that is identified for treating in the medicine that the wherein raising of serotonin level is illness useful in treatment, wherein, described microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
3. one kind is improved the method for serotonin level in its experimenter's synaptic cleft of needs, described method comprises and gives described experimenter the encode exogenous polynucleotide of at least one microRNA or its precursor or express the exogenous polynucleotide of coding at least one microRNA or its precursor in described experimenter's serotonin serotonergic neuron, thereby improve the described serotonin level in described synaptic cleft, wherein, described microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
4. the neurogliocyte of a separation, be included in transcribing of cis acting controlling element and control lower nucleic acid construct of expressing at least one microRNA or its precursor, wherein, described microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
5. polynucleotide for separation, encode at least one microRNA or its precursor, being used for the treatment of the wherein raising of serotonin level is the upper useful illness for the treatment of, wherein, described microRNA selects the group of free miR-135, miR-335, miR-26 and miR-182 composition.
6. method according to claim 1, wherein, described cell is neurogliocyte.
7. the neurogliocyte of separation according to claim 4 or method according to claim 6, wherein, described neurogliocyte is serotonin serotonergic neuron.
8. according to the method described in claim 1 or 3, or application according to claim 2, or the neurogliocyte of separation according to claim 4, or polynucleotide according to claim 5, wherein, described miR-135 is set forth in SEQ ID NO:58-SEQID NO:62.
9. according to the method described in claim 1 or 3, or application according to claim 2, or the neurogliocyte of separation according to claim 4, or polynucleotide according to claim 5, wherein, described miR-335 is set forth in SEQ ID NO:63-SEQID NO:64.
10. according to the method described in claim 1 or 3, or application according to claim 2, or the neurogliocyte of separation according to claim 4, or polynucleotide according to claim 5, wherein, described miR-26 is set forth in SEQ ID NO:65-SEQ IDNO:69.
11. according to the method described in claim 1 or 3, or application according to claim 2, or the neurogliocyte of separation according to claim 4, or polynucleotide according to claim 5, wherein, described miR-182 is set forth in SEQ ID NO:70-SEQID NO:71.
12. methods according to claim 1, or application according to claim 2, or polynucleotide according to claim 5, wherein, the choosing of described illness freely depression, anxiety, stress, the group that forms of fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia, somnopathy, food associated disorders, retardation of growth and dysgenesia.
13. methods according to claim 1, wherein, in the time that described microRNA is miR-135, described illness is depression or anxiety.
14. 1 kinds are used for the treatment of wherein the method that in its experimenter of needs low suprarenin or noradrenaline levels are illnesss useful in treatment, described method comprises and gives described experimenter or cells coding miR-19 or its precursor and exogenous polynucleotide described experimenter by coding miR-19 or its precursor and exogenous polynucleotide, thereby treats described illness.
The exogenous polynucleotide of 15. coding miR-19 or its precursors are identified for treatment in manufacture, and wherein low suprarenin or noradrenaline levels are the application in the medicine of illness useful in treatment.
The cell of 16. 1 kinds of separation, is included in transcribing of cis acting controlling element and controls the nucleic acid construct of expressing down miR-19 or its precursor.
The polynucleotide of the separation of 17. 1 kinds of encode miR-19 or its precursors, being used for the treatment of wherein low suprarenin or noradrenaline levels is the upper useful illness for the treatment of.
18. the cell of method according to claim 14 or separation according to claim 16, wherein, described cell is neurogliocyte or myocardial cell.
19. methods according to claim 14, or application according to claim 15, or the cell of separation according to claim 16 or polynucleotide according to claim 17, wherein, described miR-19 is set forth in SEQ ID NO:72-SEQ ID NO:76.
20. methods according to claim 14, or application according to claim 15, or polynucleotide according to claim 17, wherein, the choosing of described illness freely stress, the group of anxiety, memory impairment and heart trouble composition.
21. 1 kinds are used for the treatment of wherein the method that in its experimenter of needs low corticotropin releasing hormone (CRH) level is the upper useful illness for the treatment of, described method comprises and gives described experimenter by the exogenous polynucleotide of coding miR-15 or its precursor or at described experimenter's cells coding miR-15 or the exogenous polynucleotide of its precursor, thereby treats described illness.
It is the application for the treatment of in the medicine of going up useful illness that the exogenous polynucleotide of 22. coding miR-15 or its precursor are identified for treating wherein low corticotropin releasing hormone (CRH) level in manufacture.
The cell of 23. 1 kinds of separation, is included in transcribing of cis acting controlling element and controls the nucleic acid construct of expressing down miR-15 or its precursor.
The polynucleotide of the separation of 24. 1 kinds of encode miR-15 or its precursors, being used for the treatment of wherein low corticotropin releasing hormone (CRH) level is the upper useful illness for the treatment of.
25. the cell of method according to claim 21 or separation according to claim 23, wherein, described cell is neurogliocyte.
26. methods according to claim 21, or application according to claim 22, or the cell of separation according to claim 23 or polynucleotide according to claim 24, wherein, described miR-15 is set forth in SEQ ID NO:77-SEQ ID NO:80.
27. methods according to claim 21, or application according to claim 22 or polynucleotide according to claim 24, wherein, the choosing of described illness freely depression, anxiety, stress, the group that forms of fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia, somnopathy, food associated disorders, retardation of growth and dysgenesia.
28. according to the polynucleotide described in claim 5,17 or 24, in neurogliocyte, are active transcribing under control of cis acting controlling element.
29. polynucleotide according to claim 17 are active transcribing under control of cis acting controlling element in myocardial cell.
30. 1 kinds of treatments wherein in its experimenter of needs low L-glutamic acid receptor level be the method for illness useful in treatment, described method comprises and gives described experimenter by the exogenous polynucleotide of coding miR-181 or its precursor or at described experimenter's cells coding miR-181 or the exogenous polynucleotide of its precursor, thereby treats described illness.
The exogenous polynucleotide of 31. coding miR-181 or its precursors manufacture be identified for treatment wherein low L-glutamic acid receptor level be the application in the medicine of illness useful in treatment.
The cell of 32. 1 kinds of separation, is included in transcribing of cis acting controlling element and controls the nucleic acid construct of expressing down miR-181 or its precursor.
The polynucleotide of the separation of 33. 1 kinds of encode miR-181 or its precursors, being used for the treatment of wherein low L-glutamic acid receptor level is the upper useful illness for the treatment of.
34. the cell of method according to claim 30 or separation according to claim 32, wherein, described cell is neurogliocyte.
35. methods according to claim 30, or application according to claim 31, or the cell of separation according to claim 32 or polynucleotide according to claim 33, wherein, described miR-181 is set forth in SEQ ID NO:85-SEQ ID NO:94.
36. methods according to claim 30, or application according to claim 31, or polynucleotide according to claim 33, wherein, described illness is selected the group of free epileptic seizures, Huntington Chorea, schizophrenia, fragile X mental retardation, generalized anxiety disorder and cancer composition.
37. 1 kinds of nucleic acid constructs, the nucleotide sequence that comprises coding microRNA or its precursor, wherein, described microRNA or its precursor select the group of free miR-135, miR-335, miR-26, miR-27, miR-181, miR-182, miR-19 and miR-15 composition, and described nucleotide sequence is transcribing under control at cis acting controlling element.
38. according to the nucleic acid construct described in claim 37, and wherein, described cis acting controlling element is active in neurogliocyte or myocardial cell.
39. 1 kinds of pharmaceutical compositions, comprise according to the nucleic acid construct described in claim 37 or 38 and pharmaceutical carrier or thinner.
40. according to the method described in claim 1,3,14,21 or 30, and wherein, described experimenter is people experimenter.
41. one kind regulates tryptophan hydroxylase 2(Tph2 in neurogliocyte) method of the expression of gene, in described neurogliocyte, adjust the active of microRNA or its precursor or express the expression that regulates described Tph2 gene thereby described method is included in, wherein said microRNA selects the group of free miR-181 and miR27 composition.
42. according to the method described in claim 41, and wherein, in the time that described adjusting comprises the expression of raising described Tph2 gene, described adjustment is included in and in described neurogliocyte, lowers described miR-181 and/or described miR-27.
43. according to the method described in claim 42, is further included in the expression of measuring afterwards described Tph2 gene in described neurogliocyte in the described downward of described miR-181 and/or described miR-27.
The polynucleotide of 44. 1 kinds of separation, the nucleotide sequence that comprises the expression for lowering miR-181, miR-27 or its precursor.
45. 1 kinds of nucleic acid constructs, the nucleotide sequence that comprises the expression for lowering microRNA or its precursor, wherein said microRNA or its precursor select the group of free miR-181 and described miR-27 composition, and described nucleotide sequence is transcribing under control at cis acting controlling element.
46. 1 kinds for regulate the method for the expression of glutamate receptor gene at neurogliocyte, and described method is included in to be adjusted the active of miR-181 or its precursor or expresses in described neurogliocyte, thereby regulate the expression of described glutamate receptor gene.
47. according to the method described in claim 46, wherein, described glutamate receptor gene selects free metabotropic glutamate receptor 1(Grm1), glutamate receptor ionic kainic acid 3(Grik3), metabotropic glutamate receptor 5 (Grm5), glutamate receptor ionic kainic acid 2(Grik2) and metabotropic glutamate receptor 7(Grm7) group of composition.
48. one kind regulates the method for the expression of serotonin translocator (Slc6a4) gene in neurogliocyte, in described neurogliocyte, adjust the active of microRNA or its precursor or express the expression that regulates described Slc6a4 gene thereby described method is included in, wherein said microRNA selects the group of free miR-135 and miR-335 composition.
49. according to the method described in claim 48, and wherein, in the time that described adjusting comprises the expression of lowering described Slc6a4 gene, described adjustment is included in and in described neurogliocyte, raises described miR-135 and/or miR-335.
50. according to the method described in claim 49, is further included in the expression of measuring described Slc6a4 gene in described neurogliocyte after the described miR-135 of described rise and/or miR-335.
51. one kind regulates serotonin inhibition acceptor 1a(Htr1a in neurogliocyte) method of the expression of gene, in described neurogliocyte, adjust the active of microRNA or its precursor or express the expression that regulates described Htr1a gene thereby described method is included in, wherein said microRNA selects the group of free miR-135, miR-335, miR-181, miR-182 and miR-26 composition.
52. according to the method described in claim 51, wherein, in the time that described adjusting comprises the expression of lowering described Htr1a gene, described adjustment is included in and in described neurogliocyte, raises described miR-135, miR-335, miR-181, miR-182 and/or miR-26.
53. according to the method described in claim 52, is further included in and described in described neurogliocyte, raises the expression of measuring described Htr1a gene after described miR-135, miR-335, miR-181, miR-182 and/or miR-26.
54. one kind regulates the method for the expression of Down's syndrome cell adhesion molecule (Dscam) gene in neurogliocyte, described method is included in the active or expression of adjusting miR-182 or its precursor in described neurogliocyte, thereby regulates the expression of described Dscam gene.
55. one kind regulates cell adhesion molecule L1(L1cam in neurogliocyte) method of the expression of gene, described method is included in the active or expression of adjusting miR-182 or its precursor in described neurogliocyte, thereby regulates the expression of described L1cam gene.
56. 1 kinds regulate the be correlated with method of expression of X protein (Tsnax) gene of Translin in neurogliocyte, described method is included in the active or expression of adjusting miR-182 or its precursor in described neurogliocyte, thereby regulates the expression of described Tsnax gene.
57. 1 kinds regulate the method for the expression of monoamine hydroxylase (MaoA) gene in neurogliocyte, and described method comprises to be adjusted the active of miR-27 or expresses, thereby regulate the expression of described MaoA gene.
58. according to the method described in claim 57, and wherein, in the time that described adjusting comprises the expression of lowering described MaoA gene, described adjustment is included in and in described neurogliocyte, raises described miR-27.
59. according to the method described in claim 58, is further included in the expression of measuring described MaoA gene in described neurogliocyte after the described miR-27 of described rise.
60. 1 kinds regulate Beta-3 adrenergic receptor 1(Adrb1 in neurogliocyte or myocardial cell) method of the expression of gene, described method comprises to be adjusted the active of miR-19 or expresses, thereby regulates the expression of described Adrb1 gene.
61. according to the method described in claim 60, and wherein, in the time that described adjusting comprises the expression of lowering described Adrb1 gene, described adjustment is included in described neurogliocyte or described myocardial cell and raises described miR-19.
62. according to the method described in claim 61, is further included in the expression of measuring described Adrb1 gene in described neurogliocyte or described myocardial cell after the described miR-19 of described rise.
63. regulate Cannabined receptor 1(CB1 in neurogliocyte) method of the expression of gene, described method is included in to be adjusted the active of miR-19 or its precursor or expresses in described neurogliocyte, thereby regulates the expression of described CB1 gene.
64. according to the method described in claim 63, and wherein, in the time that described adjusting comprises the expression of lowering described CB1 gene, described adjustment is included in and in described neurogliocyte, raises described miR-19.
65. according to the method described in claim 64, is further included in the expression of measuring described CB1 gene in described neurogliocyte after the described CB1 of described rise.
66. 1 kinds regulate the method for the expression of CRH1 receptor gene in neurogliocyte, and described method comprises to be adjusted the active of miR-15 or expresses, thereby regulate the expression of described CRH1 receptor gene.
67. according to the method described in claim 66, and wherein, in the time that described adjusting comprises the expression of lowering described CRH1 receptor gene, described adjustment is included in and in described neurogliocyte, raises described miR-15.
68. according to the method described in claim 67, is further included in the expression of measuring described CRH1 receptor gene in described neurogliocyte after the described miR-15 of described rise.
69. regulate FKBPL 5(FKBP5 in neurogliocyte) method of the expression of gene, described method is included in to be adjusted the active of miR-15 or its precursor or expresses in described neurogliocyte, thereby regulates the expression of described FKBP5 gene.
70. according to the method described in claim 69, and wherein, in the time that described adjusting comprises the expression of lowering described FKBP5 gene, described adjustment is included in and in described neurogliocyte, raises described miR-15.
71. according to the method described in claim 70, is further included in the expression of measuring described FKBP5 gene in described neurogliocyte after the described miR-15 of described rise.
72. 1 kinds regulate cynapse chemotactic element 1a(Stx1a in neurogliocyte) method of the expression of gene, described method is included in to be adjusted the active of miR-15 or its precursor or expresses in described neurogliocyte, thereby regulates the expression of described Stx1a gene.
73. 1 kinds of methods that regulate serum/glucocorticosteroid to regulate the expression of kinases (Sgk1) gene in neurogliocyte, described method is included in the active or expression of adjusting miR-15 or its precursor in described neurogliocyte, thereby regulates the expression of described Sgk1 gene.
74. 1 kinds regulate the method for the expression of beta 2-adrenergic receptor (Adrb2) gene in neurogliocyte, described method is included in the active or expression of adjusting miR-15 or its precursor in described neurogliocyte, thereby regulates the expression of described Adrb2 gene.
Monitor the method for the treatment of thymoleptic for 75. 1 kinds, described method comprises:
(a) need its experimenter by anti-depressant therapy; And
(b) before described treatment and after described treatment, measure the expression level of miR-135 in described experimenter's blood, wherein, compared with the described expression level of described miR-135 before described treatment by described thymoleptic, after the described treatment by described thymoleptic, the lower expression level of described miR-135 represents effective treatment.
76. according to the method described in claim 75, is further included in described treatment and obtains blood sample from described experimenter before.
77. according to the method described in claim 75, and wherein, described thymoleptic select the group of free selectivity serotonin reuptake inhibitors (SSRI), tricyclic antidepressant and NRI (NRI) composition.
In its experimenter of needs, diagnose the method for serotonin associated conditions for 78. 1 kinds, described method is included in the expression level of measuring miR-135 in described experimenter's blood, wherein, compared with the expression level of the miR-135 in health volunteer's blood sample, the high expression level of described miR-135 represents described serotonin associated conditions.
79. according to the method described in claim 78, wherein, described serotonin associated conditions is mental illness.
80. according to the method described in claim 79, wherein, the choosing of described mental illness freely depression, anxiety, stress, the group that forms of fatigue, cognitive impairment, panic attack, compulsive behavior, habituation, social phobia, somnopathy and food associated disorders.
81. according to the method described in claim 75 or 78, and wherein, described miR-135 comprises miR-135a or miR-135b.
CN201280048952.XA 2011-08-04 2012-08-02 Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions Active CN104039960B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201710223993.2A CN107115352B (en) 2011-08-04 2012-08-02 micro-RNAs and compositions comprising micro-RNAs
CN202011042171.2A CN112426538A (en) 2011-08-04 2012-08-02 micro-RNAs and compositions comprising micro-RNAs

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201161514954P 2011-08-04 2011-08-04
US61/514,954 2011-08-04
PCT/IB2012/053971 WO2013018060A2 (en) 2011-08-04 2012-08-02 Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions

Related Child Applications (2)

Application Number Title Priority Date Filing Date
CN202011042171.2A Division CN112426538A (en) 2011-08-04 2012-08-02 micro-RNAs and compositions comprising micro-RNAs
CN201710223993.2A Division CN107115352B (en) 2011-08-04 2012-08-02 micro-RNAs and compositions comprising micro-RNAs

Publications (2)

Publication Number Publication Date
CN104039960A true CN104039960A (en) 2014-09-10
CN104039960B CN104039960B (en) 2017-05-10

Family

ID=46875925

Family Applications (3)

Application Number Title Priority Date Filing Date
CN201710223993.2A Active CN107115352B (en) 2011-08-04 2012-08-02 micro-RNAs and compositions comprising micro-RNAs
CN201280048952.XA Active CN104039960B (en) 2011-08-04 2012-08-02 Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions
CN202011042171.2A Pending CN112426538A (en) 2011-08-04 2012-08-02 micro-RNAs and compositions comprising micro-RNAs

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN201710223993.2A Active CN107115352B (en) 2011-08-04 2012-08-02 micro-RNAs and compositions comprising micro-RNAs

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN202011042171.2A Pending CN112426538A (en) 2011-08-04 2012-08-02 micro-RNAs and compositions comprising micro-RNAs

Country Status (10)

Country Link
US (5) US9150858B2 (en)
EP (3) EP2739736B1 (en)
JP (2) JP6309450B2 (en)
CN (3) CN107115352B (en)
BR (1) BR112014002737B1 (en)
CA (2) CA2844012C (en)
ES (2) ES2632212T3 (en)
HU (2) HUE044154T2 (en)
IL (1) IL230814A (en)
WO (1) WO2013018060A2 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104826131A (en) * 2015-04-15 2015-08-12 王嘉胤 Use of miR-17-92 gene cluster in preparation of medicines for treating mental diseases
CN105349643A (en) * 2015-11-05 2016-02-24 中国航天员科研训练中心 Method for predicting change in 5-hydroxytryptamine after sleep deprivation and microRNAs markers
CN105709240A (en) * 2016-03-23 2016-06-29 中国人民解放军第四军医大学 MiR-26a inhibitor and application thereof
CN105748501A (en) * 2016-03-31 2016-07-13 成都仕康美生物科技有限公司 MiRNA-182 inhibitor and application thereof in preparation of drug for preventing and treating immunological rejection of heart transplantation

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6309450B2 (en) 2011-08-04 2018-04-11 イェダ リサーチ アンド デベロップメント カンパニー リミテッド MicroRNAs for the treatment and diagnosis of serotonin related medical conditions, adrenaline related medical conditions, noradrenaline related medical conditions, glutamate related medical conditions and corticotropin releasing hormone related medical conditions and the like Composition comprising microRNA
EP3074413B1 (en) * 2013-11-27 2020-01-22 Sigma Aldrich Co. LLC Micro rna isolation from biological fluid
WO2015118537A2 (en) * 2014-02-05 2015-08-13 Yeda Research And Development Co. Ltd. Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions
EP3134552B1 (en) * 2014-04-22 2020-11-18 The Henry M. Jackson Foundation for the Advancement of Military Medicine, Inc. Methods, processes, devices and kits for the measurement of post traumatic stress disorder microrna markers
CN107078202B (en) * 2014-10-09 2019-07-19 德尔塔蒂研究财团 A kind of integrated thermal electric generator
WO2017087726A1 (en) * 2015-11-18 2017-05-26 Dignity Health Methods of diagnosing epilepsy
CN111566212A (en) 2017-11-03 2020-08-21 因特尔纳技术有限公司 miRNA molecules, equivalents, antanemia or sources thereof for use in the treatment and/or diagnosis of disorders and/or diseases associated with neuronal defects or for use in neuronal generation and/or regeneration
JP2021519065A (en) 2018-03-23 2021-08-10 ユニバーシティ オブ マサチューセッツ Gene therapy to treat bone disorders
CA3019970A1 (en) * 2018-10-05 2020-04-05 Fang Liu Methods for diagnosing or treating post-traumatic stress disorder, and compositions therefor
CN112852961B (en) * 2021-01-08 2022-09-13 上海市胸科医院 The ferroptosis-sensitive marker ADCY10 in lung adenocarcinoma and its application
CN113897435B (en) * 2021-11-22 2024-08-06 山西农业大学 MiRNA for evaluating melanoma metastasis risk and application thereof
JPWO2023182507A1 (en) * 2022-03-24 2023-09-28
WO2024020376A1 (en) * 2022-07-22 2024-01-25 University Of Massachusetts Aav-mediated delivery of osteoblast/osteoclast-regulating mirnas for osteoporosis therapy

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101448958A (en) * 2006-03-20 2009-06-03 俄亥俄州立大学研究基金会 MicroRNA fingerprints during human megakaryocytopoiesis

Family Cites Families (104)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL154600B (en) 1971-02-10 1977-09-15 Organon Nv METHOD FOR THE DETERMINATION AND DETERMINATION OF SPECIFIC BINDING PROTEINS AND THEIR CORRESPONDING BINDABLE SUBSTANCES.
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
NL154598B (en) 1970-11-10 1977-09-15 Organon Nv PROCEDURE FOR DETERMINING AND DETERMINING LOW MOLECULAR COMPOUNDS AND PROTEINS THAT CAN SPECIFICALLY BIND THESE COMPOUNDS AND TEST PACKAGING.
NL154599B (en) 1970-12-28 1977-09-15 Organon Nv PROCEDURE FOR DETERMINING AND DETERMINING SPECIFIC BINDING PROTEINS AND THEIR CORRESPONDING BINDABLE SUBSTANCES, AND TEST PACKAGING.
US3901654A (en) 1971-06-21 1975-08-26 Biological Developments Receptor assays of biologically active compounds employing biologically specific receptors
US3853987A (en) 1971-09-01 1974-12-10 W Dreyer Immunological reagent and radioimmuno assay
US3867517A (en) 1971-12-21 1975-02-18 Abbott Lab Direct radioimmunoassay for antigens and their antibodies
NL171930C (en) 1972-05-11 1983-06-01 Akzo Nv METHOD FOR DETERMINING AND DETERMINING BITES AND TEST PACKAGING.
US3850578A (en) 1973-03-12 1974-11-26 H Mcconnell Process for assaying for biologically active molecules
US3935074A (en) 1973-12-17 1976-01-27 Syva Company Antibody steric hindrance immunoassay with two antibodies
US3996345A (en) 1974-08-12 1976-12-07 Syva Company Fluorescence quenching with immunological pairs in immunoassays
US4034074A (en) 1974-09-19 1977-07-05 The Board Of Trustees Of Leland Stanford Junior University Universal reagent 2-site immunoradiometric assay using labelled anti (IgG)
US3984533A (en) 1975-11-13 1976-10-05 General Electric Company Electrophoretic method of detecting antigen-antibody reaction
US4036945A (en) 1976-05-03 1977-07-19 The Massachusetts General Hospital Composition and method for determining the size and location of myocardial infarcts
US4098876A (en) 1976-10-26 1978-07-04 Corning Glass Works Reverse sandwich immunoassay
US4331647A (en) 1980-03-03 1982-05-25 Goldenberg Milton David Tumor localization and therapy with labeled antibody fragments specific to tumor-associated markers
US4879219A (en) 1980-09-19 1989-11-07 General Hospital Corporation Immunoassay utilizing monoclonal high affinity IgM antibodies
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
US5011771A (en) 1984-04-12 1991-04-30 The General Hospital Corporation Multiepitopic immunometric assay
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
US4666828A (en) 1984-08-15 1987-05-19 The General Hospital Corporation Test for Huntington's disease
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5405938A (en) 1989-12-20 1995-04-11 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5166315A (en) 1989-12-20 1992-11-24 Anti-Gene Development Group Sequence-specific binding polymers for duplex nucleic acids
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4801531A (en) 1985-04-17 1989-01-31 Biotechnology Research Partners, Ltd. Apo AI/CIII genomic polymorphisms predictive of atherosclerosis
US4946778A (en) 1987-09-21 1990-08-07 Genex Corporation Single polypeptide chain binding molecules
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
EP0406309A4 (en) 1988-03-25 1992-08-19 The University Of Virginia Alumni Patents Foundation Oligonucleotide n-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
GB8823869D0 (en) 1988-10-12 1988-11-16 Medical Res Council Production of antibodies
US5272057A (en) 1988-10-14 1993-12-21 Georgetown University Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase
US5192659A (en) 1989-08-25 1993-03-09 Genetype Ag Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
ATE131827T1 (en) 1990-08-03 1996-01-15 Sterling Winthrop Inc COMPOUNDS AND METHODS FOR SUPPRESSING GENE EXPRESSION
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5633425A (en) 1990-08-29 1997-05-27 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
WO1992003918A1 (en) 1990-08-29 1992-03-19 Genpharm International, Inc. Transgenic non-human animals capable of producing heterologous antibodies
US5625126A (en) 1990-08-29 1997-04-29 Genpharm International, Inc. Transgenic non-human animals for producing heterologous antibodies
US5545806A (en) 1990-08-29 1996-08-13 Genpharm International, Inc. Ransgenic non-human animals for producing heterologous antibodies
US5661016A (en) 1990-08-29 1997-08-26 Genpharm International Inc. Transgenic non-human animals capable of producing heterologous antibodies of various isotypes
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
EP0549686A4 (en) 1990-09-20 1995-01-18 Gilead Sciences Inc Modified internucleoside linkages
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5719262A (en) 1993-11-22 1998-02-17 Buchardt, Deceased; Ole Peptide nucleic acids having amino acid side chains
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
US5281521A (en) 1992-07-20 1994-01-25 The Trustees Of The University Of Pennsylvania Modified avidin-biotin technique
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
JPH08508491A (en) 1993-03-31 1996-09-10 スターリング ウインスロップ インコーポレイティド Oligonucleotides with phosphodiester bonds replaced by amide bonds
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US6303374B1 (en) 2000-01-18 2001-10-16 Isis Pharmaceuticals Inc. Antisense modulation of caspase 3 expression
US10517883B2 (en) 2003-06-27 2019-12-31 Zuli Holdings Ltd. Method of treating acute myocardial infarction
EP2281889B1 (en) 2004-11-12 2014-07-30 Asuragen, Inc. Methods and compositions involving miRNA and miRNA inhibitor molecules
CA2609142C (en) * 2005-05-27 2016-02-09 Fondazione Centro San Raffaele Del Monte Tabor Therapeutic gene vectors comprising mirna target sequences
US20070213292A1 (en) 2005-08-10 2007-09-13 The Rockefeller University Chemically modified oligonucleotides for use in modulating micro RNA and uses thereof
JP2009507918A (en) * 2005-09-12 2009-02-26 ジ・オハイオ・ステイト・ユニバーシティ・リサーチ・ファウンデイション Compositions and methods for diagnosis and therapy of BCL2-related cancers
US20090307788A1 (en) * 2006-06-19 2009-12-10 Kobenhavns Universitet Ribozyme mediated stabilization of polynucleotides
AU2007299748A1 (en) * 2006-09-19 2008-03-27 Asuragen, Inc. miR-15, miR-26, miR -31,miR -145, miR-147, miR-188, miR-215, miR-216 miR-331, mmu-miR-292-3p regulated genes and pathways as targets for therapeutic intervention
WO2008042231A2 (en) * 2006-09-29 2008-04-10 Children's Medical Center Corporation Compositions and methods for evaluating and treating heart failure
US20090092980A1 (en) * 2007-07-20 2009-04-09 Christoph Arenz miRNA PROCESSING INHIBITOR EFFICACY ASSAYS AND SUBSTANCES
US9328345B2 (en) 2007-08-27 2016-05-03 1 Globe Health Institute Llc Compositions of asymmetric interfering RNA and uses thereof
US7993831B2 (en) * 2007-09-14 2011-08-09 Asuragen, Inc. Methods of normalization in microRNA detection assays
AU2008340943A1 (en) 2007-12-20 2009-07-02 Angiochem Inc. Polypeptide-nucleic acid conjugates and uses thereof
WO2009148137A1 (en) * 2008-06-04 2009-12-10 協和発酵キリン株式会社 Nucleic acid capable of controlling degranulation of mast cell
EP2350317A4 (en) 2008-10-20 2012-06-27 Univ Colorado Regents BIOLOGICAL MARKERS PREDICTIVE OF AN ANTICANCER RESPONSE TO INSULIN GROWTH FACTOR 1 RECEPTOR KINASE INHIBITORS
AU2009217433A1 (en) * 2009-03-05 2010-09-23 Newcastle Innovation Limited Diagnostic, prognostic and treatment methods
US20120093936A1 (en) * 2009-04-07 2012-04-19 Velin-Pharma A/S Method and device for treatment of conditions associated with inflammation or undesirable activation of the immune system
WO2010129023A2 (en) 2009-04-28 2010-11-11 President And Fellows Of Harvard College Supercharged proteins for cell penetration
CN101590243A (en) * 2009-06-23 2009-12-02 暨南大学 Application of microRNA in preparation of medicine for treating and/or preventing lymphoma
AU2011244321A1 (en) 2010-04-19 2012-11-15 Nlife Therapeutics, S.L. Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types
EP3075396A1 (en) 2010-10-17 2016-10-05 Yeda Research and Development Co. Ltd. Methods and compositions for the treatment of insulin-associated medical conditions
JP6309450B2 (en) 2011-08-04 2018-04-11 イェダ リサーチ アンド デベロップメント カンパニー リミテッド MicroRNAs for the treatment and diagnosis of serotonin related medical conditions, adrenaline related medical conditions, noradrenaline related medical conditions, glutamate related medical conditions and corticotropin releasing hormone related medical conditions and the like Composition comprising microRNA
WO2013116589A1 (en) 2012-02-02 2013-08-08 St. Jude Children's Research Hospital Methods for diagnosing and treating learning or mental disorders
MX2015005352A (en) 2012-10-26 2015-10-29 Nlife Therapeutics S L Compositions and methods for the treatment of parkinson disease by the selective delivery of oligonucleotide molecules to specific neuron types.
JP2016503394A (en) 2012-10-26 2016-02-04 エヌライフ、セラピューティックス、ソシエダッド、リミターダＮｌｉｆｅ Ｔｈｅｒａｐｅｕｔｉｃｓ， Ｓ．Ｌ． Compositions and methods for selective delivery of oligonucleotide molecules to cell types
WO2015118537A2 (en) 2014-02-05 2015-08-13 Yeda Research And Development Co. Ltd. Micro-rnas and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions
CA3204415A1 (en) 2021-01-18 2022-07-21 Alon Chen Modified mir-135, conjugated form thereof, and uses of same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101448958A (en) * 2006-03-20 2009-06-03 俄亥俄州立大学研究基金会 MicroRNA fingerprints during human megakaryocytopoiesis

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
AMY HOLLEMAN ET AL: "miR-135a contributes to paclitaxel resistance in tumor cells both in vitro and in vivo", 《ONCOGENE》, 9 May 2011 (2011-05-09), pages 9 *
ANNE BAUDRY: "MiR-16 Targets the Serotonin Transporter: A New Facet for Adaptive Responses to Antidepressants", 《SCIENCE 》, 17 September 2010 (2010-09-17), pages 1537 - 1541, XP055045625, DOI: 10.1126/science.1193692 *
BROOKE H. MILLER ET AL.: "MicroRNA dysregulation in psychiatric disease", 《BRAIN RES》, 18 June 2010 (2010-06-18), pages 89 - 99, XP055045628, DOI: 10.1016/j.brainres.2010.03.035 *
VIRGINIE OLIVE ET AL.: "miR-19 is a key oncogenic component of mir-17-92", 《GENES & DEVELOPMENT》, 31 December 2009 (2009-12-31), pages 2839 - 2849, XP055038529, DOI: 10.1101/gad.1861409 *
YOGESH DWIVEDI: "Evidence demonstrating role of microRNAs in the etiopathology of major depression", 《J CHEM NEUROANAT》, 14 April 2011 (2011-04-14) *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104826131A (en) * 2015-04-15 2015-08-12 王嘉胤 Use of miR-17-92 gene cluster in preparation of medicines for treating mental diseases
CN104826131B (en) * 2015-04-15 2018-12-18 涛康生物科技（上海）有限公司 Purposes of the miR-17-92 gene cluster in preparation treatment mental disorder drug
CN105349643A (en) * 2015-11-05 2016-02-24 中国航天员科研训练中心 Method for predicting change in 5-hydroxytryptamine after sleep deprivation and microRNAs markers
CN105349643B (en) * 2015-11-05 2018-09-07 中国航天员科研训练中心 The method and microRNAs markers that serotonin changes after prediction sleep deprivation
CN105709240A (en) * 2016-03-23 2016-06-29 中国人民解放军第四军医大学 MiR-26a inhibitor and application thereof
CN105748501A (en) * 2016-03-31 2016-07-13 成都仕康美生物科技有限公司 MiRNA-182 inhibitor and application thereof in preparation of drug for preventing and treating immunological rejection of heart transplantation

Also Published As

Publication number Publication date
HUE044154T2 (en) 2019-09-30
CA3107434A1 (en) 2013-02-07
BR112014002737B1 (en) 2022-08-02
CN107115352A (en) 2017-09-01
JP2017095482A (en) 2017-06-01
US20140163089A1 (en) 2014-06-12
IL230814A (en) 2017-12-31
US20190167712A1 (en) 2019-06-06
ES2732427T3 (en) 2019-11-22
EP3208338A1 (en) 2017-08-23
US9901593B2 (en) 2018-02-27
JP6309450B2 (en) 2018-04-11
ES2632212T3 (en) 2017-09-11
HUE033746T2 (en) 2018-01-29
US20180147233A1 (en) 2018-05-31
WO2013018060A3 (en) 2013-04-11
US20220265696A1 (en) 2022-08-25
BR112014002737A2 (en) 2020-10-27
WO2013018060A2 (en) 2013-02-07
IL230814A0 (en) 2014-03-31
EP2739736B1 (en) 2017-04-19
CN112426538A (en) 2021-03-02
EP3524679B1 (en) 2021-10-06
EP3208338B1 (en) 2019-04-10
US12016876B2 (en) 2024-06-25
CA3107434C (en) 2023-06-06
JP2014530803A (en) 2014-11-20
CN107115352B (en) 2020-10-30
US9150858B2 (en) 2015-10-06
CN104039960B (en) 2017-05-10
EP3524679A1 (en) 2019-08-14
US10238681B2 (en) 2019-03-26
CA2844012C (en) 2021-03-16
US20160000821A1 (en) 2016-01-07
EP2739736A2 (en) 2014-06-11
CA2844012A1 (en) 2013-02-07

Similar Documents

Publication Publication Date Title
US12016876B2 (en) Micro-RNAs and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions
US11680263B2 (en) Micro-RNAS and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone- associated medical conditions
BR112016018145B1 (en) ARTICLE OF MANUFACTURING COMPRISING MICRORNAS FOR THE TREATMENT AND DIAGNOSIS OF MEDICAL CONDITIONS ASSOCIATED WITH SEROTONIN, ADRENALINE, NORADRENALINE, GLUTAMATE AND CORTICOTROPIN THAT RELEASE HORMONE

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant