CN104804100A - Fusion protein and preparation method thereof - Google Patents
Fusion protein and preparation method thereof Download PDFInfo
- Publication number
- CN104804100A CN104804100A CN201510251264.9A CN201510251264A CN104804100A CN 104804100 A CN104804100 A CN 104804100A CN 201510251264 A CN201510251264 A CN 201510251264A CN 104804100 A CN104804100 A CN 104804100A
- Authority
- CN
- China
- Prior art keywords
- fusion rotein
- gfp
- dlbt
- green fluorescent
- fluorescent protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to fusion protein which comprises super positive charge green fluorescent protein and lanthanide ion combining peptide, wherein the super positive charge green fluorescent protein is used as an optical imaging die body, and the lanthanide ion combining peptide combined with gadolinium ions is used as a paramagnetic probe. No chemical modification is needed in a preparation process, the prepared fusion protein has the advantages of strong biocompatibility, stable property and strong radiography effect and is a multifunctional intracellular imaging reagent which integrates fluorescence imaging, magnetic resonance imaging, cell penetrating and passive tumor targeting, tumor tissues of living animals can be passively targeted, tumors can be specifically imaged, any targeting die body does not need to be modified, and the fusion protein can be used as the intracellular imaging reagent, so as to realize fluorescence and magnetic resonance dual-imaging on tumor cells. The fusion protein has the advantages of simple preparation method and low cost and is suitable for industrial production.
Description
Technical field
The invention belongs to biomedicine technical field, be specifically related to a kind of fusion rotein and preparation method thereof, especially a kind of may be used for biological cells and tissues fluorescence and the fusion rotein and preparation method thereof of the two imaging of mr.
Background technology
The development of modern science, makes people revert to just rapidly cell and ubcellular aspect to the essence research of vital movement.Molecular imaging techniques is that the spike realizing various micromolecular detection and pathways metabolism in cell provides strong instrument.Imaging technique, comprise optical imagery (OI), nuclear magnetic resonance (MRI), positron emission computerized tomography (PET) and computed tomography (CI) etc., the AT three-dimensional imaging of Real-time and Dynamic of biological organism physiology and pathological change can be realized on a molecular scale, for research specific organism grow, disease development and drug effectiveness etc. provide effective analysis means.But due in current various molecular imaging patterns, going back neither one can provide be necessary information to meet clinical needs, therefore, the fusion of multiple image mode becomes the trend of current medical science and imaging technique development.The multi-modality imaging of same probe can provide faster accurate, high-resolution structure and function information, thus improves image quality, and will promote the development of biomedicine field greatly.
Fluorescence imaging (FI) mainly comprises noclilucence and fluorescence two kinds of imaging techniques.This technology has very high sensitivity and real time imagery ability, high to the detectivity of tumour micro metastasis.And due to its safety simple to operate, the advantages such as acquired results is directly perceived have been widely used in the middle of the research of biomedicine and drug development.
Nuclear magnetic resonance (MRI) is according to nuclear magnetic resonance principle, utilizes the hydrogen nuclei in tissue excited in additional gradient magnetic and generate electromagnetic waves, thus draws the structural images of a certain aspect of inside of human body.The image that this technology obtains is very clear meticulous, can to the multi-angle imaging of partes corporis humani position, and its resolving power is high, can better positioning and qualitative to focus, especially has very large value to the diagnosis of infantile tumour.Wherein, cell imaging has important application prospect in the excision conceptual design of the transfer detection of tumour cell, cancerous tissue.But current used MRI contrast agent can only be distributed in cytoplsma matrix because nature cannot enter cell, because which limit its application in cell in imaging.Existing scientist attempts cell transmembrane peptide to be connected on contrast medium to improve the efficiency that it enters cell at present, but still there are some problems, such as contrast medium is from the cancellation of seepage escape and relaxation rate in cell, and the chemosynthesis of complexity also limit the application of this method.
Although fluorescence imaging has very high sensitivity, due to the penetration power that it is more weak, make it can only be applied to surface or closely surface.And MRI has better spatial resolution, thus the details of dissection and high-quality soft-tissue image can be provided, but its remolding sensitivity fluorescence imaging is low.Due to advantage and the complementation of limitation height of FI and MRI, therefore, FI and MRI two kinds of imaging techniques are combined in a probe, prepare the Double-mode imaging agent of fluorescence and nuclear magnetic resonance, effectively can overcome now methodical deficiency.
At present, two kinds of imaging die bodys are mainly coupled together by the way of chemical reaction by the common method preparing the Double-mode imaging agent of fluorescence and nuclear magnetic resonance.Such as chemically paramagnetic ion and quantum dot are combined, or with silicon shell coated magnetic core and fluorophor.But the usual more complicated difficulty of the method for these chemosynthesis, will design specific reaction process for each different imaging die body, thus limit it and apply widely.And the bio-compatibility of the probe to be prepared by chemical process is difficult to prediction, some has high toxicity and potential pollution hazard, which limits the application of this method in biological and medical science.In addition, quantum dot or the easy photobleaching of fluorescence dye and lose fluorescence, less stable.
Summary of the invention
In view of this, the object of the present invention is to provide a kind of may be used for biological cells and tissues fluorescence and the fusion rotein and preparation method thereof of the two imaging of mr.
For realizing object of the present invention, the present invention adopts following technical scheme:
A kind of fusion rotein, comprises super positive charge green fluorescent protein and lanthanide ion binding peptide.
In some embodiments, described super positive charge green fluorescent protein is
(1) surface is with the green fluorescent protein (GFP of 36 positive charges
36+);
(2) surface is with the green fluorescent protein (GFP of 48 positive charges
48+);
Or (3) with the green fluorescent protein of 36 positive charges or surface with the aminoacid sequence of the green fluorescent protein of 48 positive charges in replace, lack and/or add one or several amino acid and obtain the aminoacid sequence with same function.
In some embodiments, N the series connection that described group of the lanthanides binding peptide is the aminoacid sequence shown in SEQ ID NO:3, N is the integer of >=1.
In some embodiments, described super positive charge green fluorescent protein is connected by connexon with described lanthanide ion binding peptide, and the sequence of described connexon is (GGS)
n, wherein n is the integer of>=3.
Further, in some preferred embodiments, described fusion rotein has the aminoacid sequence as shown in SEQ ID NO:4-6 or in the aminoacid sequence shown in SEQ ID NO:4-6, replaces, lacks and/or add the aminoacid sequence with same function of one or several amino acid acquisition.
In some embodiments, described fusion rotein through modifying, described in be modified on described fusion rotein, add targeting peptides, PEG wraps up described fusion rotein or coupling drug on described fusion rotein.
Present invention also offers the DNA molecular of fusion rotein of the present invention of encoding.
Present invention also offers a kind of recombinant DNA carrier, containing DNA molecular of the present invention.
Present invention also offers a kind of host cell, containing recombinant DNA carrier of the present invention.
Present invention also offers the preparation method of fusion rotein of the present invention, comprising:
Step 1: the DNA molecular obtaining the super positive charge green fluorescent protein of coding, obtains the DNA molecular of coding connexon and lanthanide ion binding peptide;
Step 2: the DNA molecular of the super positive charge green fluorescent protein of coding is connected with the DNA molecular of encode connexon and lanthanide ion binding peptide and merges with expression vector, build recombinant expression vector;
Step 3: recombinant expression vector transformed host cell, induction contains the host cell expression fusion rotein of recombinant expression vector, the fusion rotein that separation, purifying are expressed.
Further, present invention also offers the application of described fusion rotein in the double mode preparation preparing fluorescence and mr.
Fusion rotein of the present invention comprises super positive charge green fluorescent protein and lanthanide ion binding peptide, and fusion rotein of the present invention utilizes safer protein as carrier, and preparation process is without any need for chemically modified, and bio-compatibility is stronger.Fusion rotein of the present invention effectively saves the character of super positive charge green fluorescent protein and lanthanide ion binding peptide two imaging die bodys, neither affect fluorescence imaging and the cell transduction function of super positive charge fluorescin, the character of the nuclear magnetic resonance of lanthanide ion binding peptide is not affected, stable in properties yet.Compared with small molecules magnetic resonance contrast agent, the larger contrast enhancing effects of fusion protein molecule amount of the present invention.
Fusion rotein of the present invention is prepared by Protein reconstitution expression technology, and preparation method is simple, does not need complicated mark and any chemical modification step, with low cost, is applicable to suitability for industrialized production.When operating without the need to lucifuge, there is not the pollution factors such as radiation yet, simple and convenient.
Fusion rotein of the present invention be integrate fluorescence imaging, nuclear magnetic resonance, cell-penetrating and passive cancer target multi-functional cell in imaging agents, can the tumor tissues of passive target living animal, specific imaging is carried out to tumour, and do not need to modify any target die body, as intracellular imaging agents, fluorescence and the two imaging of mr can be realized to tumour cell.
Accompanying drawing explanation
In order to be illustrated more clearly in the embodiment of the present invention or technical scheme of the prior art, be briefly described to the accompanying drawing used required in embodiment or description of the prior art below.
Fig. 1 shows embodiment 1pET21a-GFP
36+-9L-dLBT carrier schematic diagram, wherein, 9L represents expression (GGS)
9gene order, dLBT represents the gene order of the lanthanide ion binding peptide of expression two tandem sequence repeats;
Fig. 2 shows the GFP after embodiment 7 purifying
36+-9L-dLBT fusion rotein is in conjunction with the protein (Gd-GFP36 after gadolinium ion
+-9L-dLBT) SDS-PAGE gel electrophoresis figure; Wherein, swimming lane 1 is protein markers, and swimming lane 2 is GFP36
+-9L-dLBT fusion rotein, swimming lane 3 is Gd-GFP
36+-9L-dLBT fusion rotein;
Fig. 3 shows that embodiment 7 inductivity coupled plasma mass spectrometry (ICP-MS) measures Gd-DTPA and Gd-GFP
36+gd in-9L-dLBT fusion rotein
3+content; Wherein,
represent Gd-DTPA,
represent Gd-GFP
36+-9L-dLBT fusion rotein;
Fig. 4 shows that embodiment 7 fluorescence spectrum detects GFP
36+albumen and GFP
36+-9L-dLBT fusion rotein and in conjunction with the Gd-GFP after gadolinium ion
36+-9L-dLBT fusion rotein fluorogram; Wherein .... represent GFP
36+albumen,----represent GFP36
+-9L-dLBT fusion rotein,---represent Gd-GFP
36+-9L-dLBT fusion rotein;
Fig. 5 shows embodiment 8Gd-GFP
36+-9L-dLBT fusion rotein is at the intracellular fluorescence co-focusing figure of HepG2; Wherein, figure a is PBS control group, and figure b is Gd-GFP
36+-9L-dLBT fusion rotein experimental group;
Fig. 6 shows embodiment 9Gd-GFP
36+the nuclear magnetic resonance figure of-9L-dLBT fusion rotein in cancer cells; With Gd-DTPA and Gd-GFP from top to bottom respectively
36+the cancer cells that-9L-dLBT fusion rotein is hatched;
Fig. 7 shows embodiment 10Gd-GFP
36+-9L-dLBT fusion rotein is at the fluorescence imaging figure of lotus people hepatic carcinoma nude mice model; Wherein, scheming a is injection Gd-GFP
36+the fluorescence imaging figure of 0 minute after-9L-dLBT fusion rotein, figure b is injection Gd-GFP
36+after-9L-dLBT fusion rotein; Figure a represented by dashed circles tumor locus, the instruction of figure b arrow has obvious Fluorescence Increasing signal at tumor section;
Fig. 8 shows embodiment 11Gd-GFP
36+-9L-dLBT fusion rotein is at the nuclear magnetic resonance figure of lotus people hepatic carcinoma nude mice model; Wherein, scheming a and figure b is injection Gd-GFP
36+nuclear magnetic resonance figure before-9L-dLBT fusion rotein, figure b is that the part of figure a tumor region is amplified; Figure c and figure d is injection Gd-GFP
36+the nuclear magnetic resonance figure of 360 minutes after-9L-dLBT fusion rotein, figure d is that the part of figure c tumor region is amplified; Dashed circle instruction tumor locus, the instruction of figure d arrow has obvious mr enhancing signal at tumor section;
Fig. 9 shows embodiment 12Gd-GFP
36+-9L-dLBT fusion rotein is at each organ fluorescence distribution figure of lotus people hepatic carcinoma nude mice model; Wherein a is classified as injection Gd-GFP
36+before-9L-dLBT fusion rotein, each organ fluorescence distribution figure, b are classified as injection Gd-GFP
36+each organ fluorescence distribution figure of 360 minutes after-9L-dLBT fusion rotein; Each organ of brain, the heart, lung, liver, spleen, kidney and tumour from top to bottom respectively; Arrow instruction has obvious Fluorescence Increasing signal at kidney and tumor locus.
Embodiment
Below in conjunction with the embodiment of the present invention, be clearly and completely described the technical scheme in the embodiment of the present invention, obviously, described embodiment is only the present invention's part embodiment, instead of whole embodiments.Based on the embodiment in the present invention, those of ordinary skill in the art, not making the every other embodiment obtained under creative work prerequisite, belong to the scope of protection of the invention.
Protein is considered to desirable imaging support with its security.But simple protein test in vivo in transfection efficiency extremely low, thus limit its application.
Super positive charge green fluorescent protein is that the protein engineering that utilizes be in the news in recent years modifies the green fluorescent protein varient of the novelty that renovation technique produces.Wherein surface is proved to be both to remain its fluorescence with the GFP of multiple positive charge, turn improves protein stability varient.The more important thing is that this proteinoid has higher cell transduction efficiency, even exogenous nucleic acid can be carried and into cell, foreign gene be expressed.
Green fluorescent protein and other target proteins are merged is a kind of technology with widespread use that has been developed, but still there are some shortcomings that cannot overcome: this GFP protein fusion technology may affect on the one hand by the intrinsic folding situation of fusion rotein, causes it to lose corresponding function; On the other hand when GFP and the albumen that folding onto itself state is incompatible merges, also can affect the protein folding of GFP itself, thus cause the weakening of fluorescence.Therefore GFP is not applicable to and all protein fusion expressions.
The invention provides a kind of fusion rotein, comprise super positive charge green fluorescent protein and lanthanide ion binding peptide.
Wherein, term used herein " green fluorescent protein " (green fluorescent protein, GFP) is a kind of labelled protein, its be subject to ultraviolet and blue-light excited be can the apparent green glow of efficient transmission, and light not easily cancellation.
Term used herein " super positive charge green fluorescent protein " suddenlys change to its surface amino groups acid on the basis of " green fluorescent protein ", when not affecting fluorescence, partial amino-acid being mutated into basic aminoacids, making the albumen of multiple positive charge on its surface band.Such as surface is with the super positive charge green fluorescent protein (GFP of 36 electric charges
36+), surface is with the super positive charge green fluorescent protein (GFP of 48 electric charges
48+).Super positive charge green fluorescent protein has very high cell-permeant ability and transduction potential, even exogenous nucleic acid can be carried and into cell, foreign gene be expressed.Therefore, super positive charge green fluorescent protein both as fluorescent probe, can bring fusion rotein into cell again in fusion rotein system, carried out imaging in cell.It will be appreciated by those skilled in the art that any applicable green fluorescent protein or other albumen that can be used in fluorescence imaging all can be used for preparing fusion rotein of the present invention.
In some specific embodiments, described super positive charge green fluorescent protein is the green fluorescent protein (GFP of surface with 36 positive charges
36+), its aminoacid sequence is as shown in SEQ ID NO:1.
In some specific embodiments, described super positive charge green fluorescent protein is the green fluorescent protein (GFP of surface with 48 positive charges
48+), its aminoacid sequence is as shown in SEQ ID NO:2.
In other specific embodiments, described super positive charge green fluorescent protein be with the green fluorescent protein of 36 positive charges or surface with the aminoacid sequence of the green fluorescent protein of 48 positive charges in replace, lack and/or add one or several amino acid and obtain the aminoacid sequence with same function.
Lanthanide series metal binding peptide, be a peptide species also known as group of the lanthanides combination tag (LBT, lanthanide-binding tag), can stablize, specific in conjunction with lanthanide metal ion, after combining paramagnetic metal ion Gd, can be used in nuclear magnetic resonance.It will be appreciated by those skilled in the art that any applicable lanthanide series metal binding peptide that can carry out nuclear magnetic resonance all can be used for preparing the fusion rotein of invention.
" lanthanide series metal binding peptide " involved in the present invention can be together in series for several sections of lanthanide series metal binding peptides, and such fusion rotein just in conjunction with multiple gadolinium ion, thus effectively can improve relaxivity altogether.Lanthanide series metal binding peptide (dLBT) as having two sections of tumor-necrosis factor glycoproteinss is in the news and can improves relaxivity, thus can be used in nuclear magnetic resonance.
In some embodiments, N the series connection that group of the lanthanides binding peptide described in fusion rotein of the present invention is the aminoacid sequence shown in SEQ IDNO:3, N is the integer of >=1.
In some preferred embodiments, N is the integer of 1-6.As 1,2 or 3.
In some embodiments, described in fusion rotein of the present invention, super positive charge green fluorescent protein is connected by connexon with described lanthanide ion binding peptide, and the sequence of described connexon is (GGS)
n, wherein n is the integer of>=3.Super positive charge green fluorescent protein and group of the lanthanides binding peptide are linked by connexon, greatly can improve purification efficiency and the stability of fusion rotein.
In some preferred embodiments, n is the integer of 3-12.As 3,9 or 12.
Certainly, under the prerequisite not affecting fusion rotein function, fusion rotein of the present invention may be, but is not limited at its aminoterminal or carboxyl terminal with purification tag.Such as GST label or His label.Protein amino-terminus or carboxyl terminal can tag, and every one end can add plural label.
In some preferred embodiments, fusion rotein of the present invention is at the His label of fusion rotein carboxyl terminal with 6 Histidines.
In a specific embodiment, fusion rotein of the present invention is GFP
36+-9L-dLBT, has aminoacid sequence as shown in SEQ ID NO:4.
In a specific embodiment, fusion rotein of the present invention is GFP
48+-12L-dLBT, has aminoacid sequence as shown in SEQ ID NO:5.
In a specific embodiment, fusion rotein of the present invention is GFP
36+-3L-dLBT, has aminoacid sequence as shown in SEQ ID NO:6.
Certainly; under the prerequisite not affecting fusion rotein function; the aminoacid sequence of those skilled in the art according to above-mentioned SEQ IDNO:4-6 carries out various replacement, interpolation and/or one or several amino acid and obtains the aminoacid sequence with same function, and they are all deemed to be included in the scope of protection of the invention.
Obviously, utilizing some biological chemistry means fusion rotein of the present invention can be carried out the modification of multi-form means of different, as added some targeting peptides, its objective is the targeting improving this fusion rotein; Or be carry out PEG parcel, its objective is and can reduce immunogenicity; Also the various medicine that can be used for oncotherapy can be carried.No matter why, as long as the fusion rotein of the fluorescence of those forms and nuclear magnetic resonance also exists, and two imaging functions of fusion rotein in practice after this modification are actually utilized, and include the covering scope at fusion rotein of the present invention.
Present invention also offers the DNA molecular of fusion rotein of the present invention of encoding.Due to the degeneracy of codon, the DNA molecular of a variety of fusion rotein of the present invention of can encoding can be there is.
In some embodiments, the invention provides the DNA molecular that coding has the aminoacid sequence shown in SEQ ID NO:4, its nucleotide sequence is as SEQ ID NO.7.
In some embodiments, the invention provides the DNA molecular that coding has the aminoacid sequence shown in SEQ ID NO:5, its nucleotide sequence is as SEQ ID NO.8.
In some embodiments, the invention provides the DNA molecular that coding has the aminoacid sequence shown in SEQ ID NO:6, its nucleotide sequence is as SEQ ID NO.9.
Further, those skilled in the art can by the cloned dna molecule of coding fusion rotein of the present invention in carrier, and then transformed host cell.
Therefore, present invention also offers a kind of recombinant DNA carrier, it contains the DNA molecular of fusion rotein of the present invention of encoding.
Preferably, described recombinant DNA carrier is a kind of expression vector, and those skilled in the art are by the cloned dna molecule of described fusion rotein in expression vector, and transformed host cell, obtains fusion rotein by abduction delivering.It is serial that described expression vector comprises pGEX series, pET series, pQ E series and pMAL.
In some embodiments, described expression vector is the pET21a in pET series.
Present invention also offers a kind of host cell, it contains recombinant DNA carrier of the present invention.Host cell of the present invention can be prokaryotic host cell, eukaryotic host cell or phage for it.
Wherein, described prokaryotic host cell can be intestinal bacteria, Bacillus subtilus, streptomycete or proteus mirabilis etc.Described eukaryotic host cell, can be as pichia pastoris phaff, yeast saccharomyces cerevisiae, fission yeast, the wood fungi such as mould, as insect cells such as meadow mythimna separatas, as vegetable cells such as tobaccos, as mammalian cells such as bhk cell, Chinese hamster ovary celI, COS cell, myeloma cells.
In some embodiments, host cell of the present invention is preferably E. coli expression strains, can for comprising Rosetta series and BL21 series bacterial strain.
In some preferred embodiments, host cell of the present invention is BL21 series bacterial strain, as BL21 (DE3) bacterial strain.
Present invention provides the preparation method of fusion rotein of the present invention, comprising:
Step 1: the DNA molecular obtaining the super positive charge green fluorescent protein of coding, obtains the DNA molecular of coding connexon and lanthanide ion binding peptide;
Step 2: the DNA molecular of the super positive charge green fluorescent protein of coding is connected with the DNA molecular of encode connexon and lanthanide ion binding peptide and merges with expression vector, build recombinant expression vector;
Step 3: recombinant expression vector transformed host cell, induction contains the host cell expression fusion rotein of recombinant expression vector, the fusion rotein that separation, purifying are expressed.
Utilizing genetic engineering technique to obtain the method for DNA molecular at present has a variety of, comprise utilize digestion with restriction enzyme have the DNA molecular of encoding said proteins or polypeptide carrier or with the cDNA of the DNA molecular with encoding said proteins or polypeptide for template PCR amplifications.
In some embodiments, coding of the present invention surpasses the DNA molecular of positive charge green fluorescent protein is obtain for template primer amplification with the plasmid with super positive charge green fluorescent protein.
In some embodiments, the DNA molecular of coding connexon of the present invention and lanthanide ion binding peptide is that the encode DNA sequence dna of 27 amino acid whose connexons and metal ion binding peptide obtains for template primer amplification.
Fusion rotein of the present invention is the purified product that recombinant host cell is cultivated, and one is albumen independently, with other albumen, polypeptide or molecule without chemically crosslinked.
In some embodiments, the present invention adopts the methods combining Gd of dialysis
3+and determine the specificity of fusion rotein of the present invention in conjunction with gadolinium ion.Result shows fusion rotein of the present invention can to gadolinium ion stable bond; In conjunction with Gd
3+after, albumen state is single, stable in properties, and protein fluorescence character is constant.
In some embodiments, the present invention adopts fluorescence co-focusing to detect the fluorescence imaging of fusion rotein of the present invention in cancer cells, is dispersed with a lot of fusion rotein of the present invention in the tenuigenin of the cancer cells that result display adopts fusion rotein of the present invention to hatch.Show that fusion rotein of the present invention effectively can enter cell and can ensure the photoluminescent property of GFP.
In some embodiments, the present invention adopts magnetic resonance imaging to detect the nuclear magnetic resonance of fusion rotein of the present invention in cancer cells, is dispersed with a lot of fusion rotein of the present invention in the tenuigenin of the cancer cells that result display adopts fusion rotein of the present invention to hatch.Show that fusion rotein of the present invention effectively can enter cell and can carry out nuclear magnetic resonance to cell.Compared with Gd-DTPA, the Cell magnetic resonance effect of fusion rotein of the present invention significantly improves.
In some embodiments, the present invention adopts fluorescence co-focusing to detect the fluorescence imaging of fusion rotein of the present invention at lotus people knurl nude mice model, and the fluorescent signal of result display injection fusion rotein of the present invention tumor locus after 60,120 and 360 minutes obviously strengthens.
In some embodiments, the present invention adopts magnetic resonance imaging to detect the nuclear magnetic resonance of fusion rotein of the present invention at lotus people knurl nude mice model, and the magnetic resonance signal of result display injection fusion rotein of the present invention tumor locus after 60,120 and 360 minutes obviously strengthens.
In some embodiments, the present invention adopts fluorescence co-focusing to detect the fluorescence imaging of fusion rotein of the present invention at each organ of lotus people knurl nude mice model, the fluorescent signal of result display injection fusion rotein of the present invention mouse kidney and tumour after 60,120 and 360 minutes obviously strengthens, and shows that fusion rotein has obvious enrichment in mouse kidney and tumour.
From the above results, fusion rotein of the present invention effectively can carry out specific tumor imaging to living animal.Therefore present invention also offers the application of described fusion rotein in the double mode preparation preparing fluorescence and mr.
Fusion rotein of the present invention comprises super positive charge green fluorescent protein and lanthanide ion binding peptide, and using super positive charge green fluorescent protein as optical imagery die body, the lanthanide ion binding peptide combining gadolinium ion has paramagnetic contribution.Fusion rotein of the present invention utilizes safer protein as carrier, and preparation process is without any need for chemically modified, and bio-compatibility is stronger.Fusion rotein of the present invention effectively saves the character of super positive charge green fluorescent protein and lanthanide ion binding peptide two imaging die bodys, neither affect fluorescence imaging and the cell transduction function of super positive charge fluorescin, the character of the nuclear magnetic resonance of lanthanide ion binding peptide is not affected, stable in properties yet.Compared with small molecules magnetic resonance contrast agent, fusion protein molecule amount of the present invention makes more greatly magnetic resonance radiography effect strengthen.
Fusion rotein of the present invention is prepared by Protein reconstitution expression technology, and preparation method is simple, does not need complicated mark and any chemical modification step, with low cost, is applicable to suitability for industrialized production.When operating without the need to lucifuge, there is not the pollution factors such as radiation yet, simple and convenient.
Fusion rotein of the present invention be integrate fluorescence imaging, nuclear magnetic resonance, cell-penetrating and passive cancer target multi-functional cell in imaging agents, can the tumor tissues of passive target living animal, specific imaging is carried out to tumour, and do not need to modify any target die body, as intracellular imaging agents, fluorescence and the two imaging of mr can be realized to tumour cell.
In order to understand the present invention further, below in conjunction with specific embodiment, the present invention will be described in detail.
Embodiment 1:pET21a-GFP
36+the structure of-9L-dLBT expression vector
(1) encode GFP
36+dNA (SEQ ID NO:10) sequence purchased from raw work synthesis center.Then as template, increase GFP to utilize primer GFP36N (SEQ ID NO:11) and GFP36C (SEQ ID NO:12)
36+sequence, then cuts with HindIII enzyme, obtains GFP
36+.Wherein, primer sequence is as follows:
GFP36N(SEQ ID NO:11)：
5’-GAACATATGGCTTCTAAAGGTGAACGCCTGTTC-3’；
GFP36C(SEQ ID NO:12)：
5’-GAAAAGCTTTTTGTAACGTTCGTCGCGGCC-3’。
(2) DNA sequence dna (SEQ IDNO:13) of coding 27 amino acid whose connexons and metal ion binding peptide is purchased from raw work synthesis center.Then as template, increase 9L-dLBT sequence to utilize primer dLBTN (SEQ IDNO:14) and dLBTC (SEQ ID NO:15), then cuts with HindIII enzyme, obtains 9L-dLBT.Wherein, sequence is as follows:
SEQ ID NO:13：
ATGGGTGGCTCTGGTGGCTCTGGCGGTAGCGGCGGCTCTGGTGGTAGCGGTGGTTCCGGTGGTTCTGGCGGTTCCGGCGGCTCCTATATCGATACTAATAACGATGGCTGGATTGAAGGCGATGAGCTGTACATCGACACCAACAACGACGGTTGGATCGAAGGTGACGAACTGCTGGCG；
dLBTN(SEQ ID NO:14)：
5’-GAAAAGCTTGGTGGCTCTGGTGGCTCTGGC-3’；
dLBTC(SEQ ID NO:15)：
5’-GAACTCGAGTCAGTGATGGTGGTGGTGGTGCGCCAGCAGTTCGTCACCTTC-3’；
(3) GFP after enzyme being cut
36+be connected with 9L-dLBT T4 ligase enzyme, afterwards again as template, increase GFP to utilize primer GFPN (SEQ ID NO:11) and dLBTC (SEQ ID NO:15)
36+-9L-dLBT sequence, then cuts with NdeI and XhoI enzyme, then inserts the pET21a carrier framework of NdeI/XhoI double digestion.
(4) through order-checking qualification, obtain and insert GFP
36+the carrier of-9L-dLBT sequence, called after pET21a-GFP
36+-9L-dLBT carrier.Fig. 1 is shown in by the carrier schematic diagram obtained.The expression vector pET21a-GFP built
36+-9L-dLBT is for expressing GFP
36+-9L-dLBT albumen.
Embodiment 2:pET21a-GFP
48+the structure of-12L-dLBT expression vector
Coding GFP
48+dNA (SEQ ID NO:16) sequence purchased from raw work synthesis center.Then as template, increase GFP to use primer GFP48N (SEQ ID NO:17) and GFP48C (SEQ ID NO:18)
48+fragment, other are identical with embodiment 1.Constructed expression vector pET21a-GFP
48+-12L-dLBT is for expressing GFP
48+-12L-dLBT albumen, the sequence of its connexon is (GGS)
12.Wherein, primer sequence is as follows:
GFP48N(SEQ ID NO:17)：
5’-GAACAT ATGGCCAGCA AAGGCAAACG-3’；
GFP48C(SEQ ID NO:18)：
5’-GAAAAGCCTTTTCGCCGCTTCCGCCC-3’。
Embodiment 3:pET21a-GFP
36+the structure of-3L-dLBT expression vector
Increase 3L-dLBT sequence to use primer 3LN (SEQ ID NO:19) and dLBTC (SEQ ID NO:15), and other are identical with embodiment 1, constructed expression vector pET21a-GFP36
+-3L-dLBT is for expressing GFP
36+-3L-dLBT albumen, the sequence of its connexon is (GGS)
3.
3LN(SEQ ID NO:19)：
5’-GAAAAGCTTGGTGGTTCTGGCGGTTCCGGCG-3’
Embodiment 4:GFP
36+the Expression and purification of-9L-dLBT fusion rotein
(1) embodiment 1 is prepared and the pET21a-GFP identified
36+-9L-dLBT vector enters in Host Strains e. coli bl21 (DE3) competent cell, is placed on the dull and stereotyped upper 37 DEG C of incubated overnight of LB containing ammonia benzyl resistance.
(2) next day, picking list colony inoculation is in the 4mLLB liquid nutrient medium containing ammonia benzyl resistance, and 37 DEG C of shaking culture are spent the night.
(3) next day, above-mentioned bacterium liquid is diluted in 1L containing in the LB liquid nutrient medium of ammonia benzyl resistance, continues 37 DEG C of shaking culture to OD
600=0.6-0.8.Add 0.4mM IPTG to induce, 16 DEG C of inducing culture 20 hours.
(4) above-mentioned bacterium liquid is collected, centrifugal 20 minutes of 4000rpm, collect thalline.
(5) with lysis buffer Buffer A (50mM PO
4 3-, 2M NaCl, 5mM imidazoles pH 7.5) and resuspended bacterial sediment.
(6) bacterium liquid carries out ultrasonication in ice bath, ultrasonic 2s, interval 2s, total ultrasonic time 8 minutes.
(7) by above-mentioned cytoclasis liquid in 4 DEG C centrifugal (16000 × g, 30 minutes), obtain broken cleer and peaceful fragmentation precipitation.
(8) broken supernatant crosses the film of 0.45 μm and 0.22 μm respectively, the cell debris in removing supernatant.
(9) ni-sepharose purification: first nickel post uses Buffer A pre-equilibration 20 minutes.
(10) then the supernatant after filtration is added in nickel post, at 4 DEG C of shaking tables in conjunction with about 40 minutes.Nickel post albumen lavation buffer solution Buffer B (50mM PO
4 3-, 2M NaCl, 25mM imidazoles pH7.5) and wash away foreign protein twice.Nickel post albumen elution buffer Buffer C (50mM PO
4 3-, 2MNaCl, 500mM imidazoles pH 7.5) and wash-out target protein.
(11) the target protein liquid obtained to wash-out adds the EDTA of 10mM, to remove a small amount of nickel ion may introduced in ni-sepharose purification step.
(12) be that 3000 daltonian membrane ultrafiltration are concentrated to about 20mL by the target protein molecular weight cut-off that this wash-out obtains.
(13) albumen dilution buffer Buffer D (the 50mM PO upper step obtained
4 3-, pH 7.5) and dilute 4 times to about 80mL.A small amount of precipitation may be there is at this step albumen.Therefore centrifugal 30 minutes (4 DEG C, 16000 × g, 3 minutes).
(14) supernatant after centrifugal is continued ultrafiltration and concentration to about 10mL.
(15) cation exchange purification (HiTrap Q XL): first cationic exchange coloum uses mobile phase A (50mM HEPES, 500mM NaCl, the pH 7.5) pre-equilibration of deionized water and 5 times of column volumes.After sample introduction, cross post by the mobile phase A of 5 times of column volumes.Use (50mMHEPES, 1M NaCl, pH 7.5) gradient elution target protein from mobile phase A to Mobile phase B.The albumen dialysis obtained by cationic exchange coloum wash-out, extracellular fluid dialysis is Buffer D (50mM HEPES, 100mM NaCl, pH 7.5), obtains the protein being dissolved in buffer B uffer D.
(16) ultraviolet-visible spectrum measures protein concentration.
Expressed albumen has SEQ ID NO:4 sequence.
Embodiment 5:GFP
48+-12L-dLBT protein expression
Expression plasmid uses pET21a-GFP prepared by embodiment 2 instead
48+-12L-dLBT, other method is identical with embodiment 4.Expressed albumen has SEQ ID:NO.5 sequence.
Embodiment 6:GFP
36+-3L-dLBT protein expression
Expression plasmid uses pET21a-GFP prepared by embodiment 3 instead
36+3L-dLBT, other method is identical with embodiment 4.Expressed albumen has SEQ ID:NO.6 sequence.
Embodiment 7:GFP
36+-9L-dLBT fusion rotein specific binding gadolinium ion
By the method for dialysing by Gd
3+be attached to GFP
36+in-9L-dLBT.Extracellular fluid dialysis Buffer E:(50mM HEPES, 100mM NaCl, pH 7.5, Gd
3+concentration is GFP
36+four times of-9L-dLBT concentration).Dialysis twice, each 2h.And then dialyse twice to remove the free Gd do not combined up with dialysis buffer liquid Buffer D
3+, by the Gd-GFP finally obtained
36+-9L-dLBT fusion rotein carries out electroresis appraisal, and electrophoresis result is as Fig. 2.
Concentration is respectively the Gd-GFP36 of 0.5mM and 1mM
+-9L-dLBT fusion rotein, and the Gd-DTPA of same concentrations is dissolved in concentrated nitric acid, heating evaporate to dryness.3mL is settled to deionized water.Utilize Gd in ICP-MS working sample
3+content, the results are shown in Figure 3.
From Fig. 2 result, the Gd in stable bond
3+afterwards, fusion rotein state is single, stable in properties.And the ICP-MS result display of Fig. 3, each protein molecule can in conjunction with two gadolinium ions, and these experimental results show GFP36
+-9L-dLBT can be stable with the mol ratio of 1:2 in conjunction with Gd
3+.
In addition, fluorescence spectrum detects GFP
36+albumen and GFP
36+-9L-dLBT fusion rotein and in conjunction with the Gd-GFP after gadolinium ion
36+-9L-dLBT fusion rotein fluorogram, result display GFP36
+-9L-dLBT fusion rotein, in conjunction with the Gd-GFP after gadolinium ion
36+-9L-dLBT fusion rotein and with simple GFP36
+the fluorogram of protein is identical (Fig. 4).These experimental results show GFP
36+do not affect group of the lanthanides binding peptide dLBT in conjunction with Gd
3+, and dLBT and gadolinium ion combine the character also not affecting fluorescin, thus this fusion rotein is likely as nuclear magnetic resonance reagent.
Use GFP prepared by embodiment 2 respectively instead
48+gFP prepared by-12L-dLBT fusion rotein and embodiment 3
36+-3L-dLBT fusion rotein in conjunction with gadolinium ion, by the Gd-GFP finally obtained
48+-12L-dLBT fusion rotein and Gd-GFP
36+-3L-dLBT fusion rotein carries out electroresis appraisal, result and Gd-GFP
36+-9L-dLBT fusion rotein is similar.
Embodiment 8:Gd-GFP
36+the fluorescence imaging of-9L-dLBT fusion rotein in cancer cells
By HepG2 cell at 37 DEG C with containing 5% concentration C O
2logarithmic phase is cultured under moist air environment; Wash three times with PBS after discarding nutrient solution, be divided into two groups.Control group adds PBS, and experimental group adds 1 μM of Gd-GFP
36+-9L-dLBT fusion rotein, hatches 4 hours in 37 DEG C of incubators.Unnecessary Gd-GFP is washed off with PBS damping fluid
36+-9L-dLBT fusion rotein.With DAPI dyestuff, nucleus is dyeed afterwards, and respectively fluorescence co-focusing imaging analysis is carried out to experimental group and cellular control unit.The results are shown in Figure 5.
From Fig. 5 result, through experimental group Gd-GFP
36+a lot of Gd-GFP is dispersed with in the tenuigenin of the cancer cells that-9L-dLBT fusion rotein is hatched
36+-9L-dLBT fusion rotein, shows Gd-GFP
36+-9L-dLBT effectively can enter cell and can ensure the photoluminescent property of GFP.
Use Gd-GFP instead respectively
48+-12L-dLBT fusion rotein and Gd-GFP
36+-3L-dLBT fusion rotein hatches HepG2 cell, result and Gd-Gd-GFP
36+-9L-dLBT fusion rotein is similar, Gd-GFP
48+a lot of Gd-GFP is dispersed with in the tenuigenin of the cancer cells that-12L-dLBT fusion rotein is hatched
48+-12L-dLBT fusion rotein, Gd-GFP
36+a lot of Gd-GFP is dispersed with in the tenuigenin of the cancer cells that-3L-dLBT fusion rotein is hatched
36+-3L-dLBT fusion rotein.
Embodiment 9:Gd-GFP
36+the nuclear magnetic resonance of-9L-dLBT fusion rotein in cancer cells
By HepG2 cell at 37 DEG C with containing 5% concentration C O
2logarithmic phase is cultured under moist air environment; Wash three times with PBS after discarding nutrient solution, then add the Gd-GFP that protein concentration is 0.0075mM, 0.015mM, 0.03mM, 0.06mM, 0.12mM respectively
36+the fresh medium of-9L-dLBT.Control group adds the small molecules Gd-DTPA as above-mentioned concentration gradient.All cells is at 37 DEG C with containing 5% concentration C O
2cultivate 4h in damp atmosphere incubator, sucking-off nutrient solution, centrifugally use 0.25% trysinization afterwards, blow and beat into cell suspension, centrifugal 5 minutes (rotating speed is between 300-1000g/ minute), washes three times with cold PBS after supernatant discarded, and adjustment cell concn is 2 × 10
6individual/mL, carries out magnetic resonance imaging.The results are shown in Figure 6.
From Fig. 6 result, along with Gd-GFP
36+increasing of-9L-dLBT concentration, magnetic resonance signal strengthens successively.Show Gd-GFP
36+-9L-dLBT fusion rotein effectively can enter cell and can carry out nuclear magnetic resonance to cell.And compared with Gd-DTPA, Gd-GFP
36+the Cell magnetic resonance effect of-9L-dLBT fusion rotein significantly improves.
Above-mentioned concentration gradient Gd-GFP respectively
48+-12L-dLBT fusion rotein and Gd-GFP
36+-3L-dLBT fusion rotein, result and Gd-Gd-GFP
36+-9L-dLBT fusion rotein is similar, Gd-GFP
48+-12L-dLBT fusion rotein and Gd-GFP
36+-3L-dLBT fusion rotein all effectively can enter cell and can carry out nuclear magnetic resonance to cell, compared with Gd-DTPA, and Gd-GFP
48+-12L-dLBT fusion rotein and Gd-GFP
36+the Cell magnetic resonance effect of-3L-dLBT fusion rotein all significantly improves.
Embodiment 10:Gd-GFP
36+-9L-dLBT fusion rotein is at the fluorescence imaging of lotus people knurl nude mice model
With HepG2 cell lines inoculation nude mice by subcutaneous (10
7cell/only), preparation lotus people knurl nude mice model 6.When tumour grows to 1cm-1.5cm size, fluorescent scanning is carried out to mouse.And then according to nude mice 7.5mg/kg body weight ratio tail vein injection Gd-GFP
36+-9L-dLBT fusion rotein, carried out fluorescent scanning to mouse respectively after 60,120,240 and 360 minutes.Result shows, and fluorescence intensity increased the time, and scanning result when 360 minutes is shown in Fig. 7.
From Fig. 7 result, injection Gd-GFP
36+the fluorescent signal of-9L-dLBT fusion rotein tumor locus after 360 minutes obviously strengthens.
Change injection Gd-GFP respectively into
48+-12L-dLBT fusion rotein and Gd-GFP
36+-3L-dLBT fusion rotein, result and Gd-Gd-GFP
36+-9L-dLBT fusion rotein is similar, injection Gd-GFP
48+-12L-dLBT fusion rotein and Gd-GFP
36+the fluorescent signal of-3L-dLBT fusion rotein tumor locus after 360 minutes all obviously strengthens.
Embodiment 11:Gd-GFP
36+-9L-dLBT fusion rotein is in the nuclear magnetic resonance of lotus people knurl nude mice model
With HepG2 cell lines inoculation nude mice by subcutaneous (10
7cell/only), preparation lotus people knurl nude mice model 6.When tumour grows to 1cm-1.5cm size, fluorescent scanning is carried out to mouse.And then according to nude mice 7.5mg/kg body weight ratio tail vein injection Gd-GFP
36+-9L-dLBT fusion rotein, carried out magnetic resonance imaging to mouse respectively after 60,120,240 and 360 minutes.Result display nuclear magnetic resonance effect strengthens in time, and the scanning result after 360 minutes is shown in Fig. 8.
From Fig. 8 result, injection Gd-GFP
36+the magnetic resonance signal of-9L-dLBT fusion rotein tumor locus after 360 minutes obviously strengthens.
Change injection Gd-GFP respectively into
48+-12L-dLBT fusion rotein and Gd-GFP
36+-3L-dLBT fusion rotein, result and Gd-Gd-GFP
36+-9L-dLBT fusion rotein is similar, injection Gd-GFP
48+-12L-dLBT fusion rotein and Gd-GFP
36+the magnetic resonance signal of-3L-dLBT fusion rotein tumor locus after 360 minutes all obviously strengthens.
Embodiment 12:Gd-GFP
36+-9L-dLBT fusion rotein is at the fluorescence imaging of each organ of lotus people knurl nude mice model
With HepG2 cell lines inoculation nude mice by subcutaneous (10
7cell/only), preparation lotus people knurl nude mice model 6.When tumour grows to 1-1.5cm size, fluorescent scanning is carried out to mouse.And then according to nude mice 7.5mg/kg body weight ratio tail vein injection Gd-GFP
36+-9L-dLBT fusion rotein, put to death mouse after 360 minutes.Fluorescent scanning is carried out respectively, to determine Gd-GFP after peeling off brain, the heart, liver, spleen, lung, kidney and each organ of tumour
36+the distribution of-9L-dLBT fusion rotein in Mice Body.Scanning result is shown in Fig. 9.
From Fig. 9 result, injection Gd-GFP
36+-9L-dLBT fusion rotein is after 360 minutes, and the fluorescent signal of mouse kidney and tumour obviously strengthens, and shows Gd-GFP in mouse kidney and tumour
36+-9L-dLBT fusion rotein has obvious enrichment.
Change injection Gd-GFP respectively into
48+-12L-dLBT fusion rotein and Gd-GFP
36+-3L-dLBT fusion rotein, result and Gd-GFP
36+-9L-dLBT fusion rotein is similar, injection Gd-GFP
48+-12L-dLBT fusion rotein and Gd-GFP
36+-3L-dLBT fusion rotein is after 360 minutes, and the fluorescent signal of mouse kidney and tumour all obviously strengthens.
Claims (10)
1. a fusion rotein, comprises super positive charge green fluorescent protein and lanthanide ion binding peptide.
2. fusion rotein according to claim 1, described super positive charge green fluorescent protein is
(1) surface is with the green fluorescent protein of 36 positive charges;
(2) surface is with the green fluorescent protein of 48 positive charges;
Or (3) with the green fluorescent protein of 36 positive charges or surface with the aminoacid sequence of the green fluorescent protein of 48 positive charges in replace, lack and/or add one or several amino acid and obtain the aminoacid sequence with same function.
3. fusion rotein according to claim 1 and 2, N the series connection that described group of the lanthanides binding peptide is the aminoacid sequence shown in SEQ ID NO:3, N is the integer of >=1.
4. the fusion rotein according to claim 1-3 any one, described super positive charge green fluorescent protein is connected by connexon with described lanthanide ion binding peptide, and the sequence of described connexon is (GGS)
n, wherein n is the integer of>=3.
5. the fusion rotein according to claim 1-4 any one, described fusion rotein has the aminoacid sequence as shown in SEQID NO:4-6 or in the aminoacid sequence shown in SEQ ID NO:4-6, replaces, lacks and/or add the aminoacid sequence with same function of one or several amino acid acquisition.
6. the DNA molecular of fusion rotein described in coding claim 1-5 any one.
7. a recombinant DNA carrier, containing DNA molecular described in claim 6.
8. a host cell, containing recombinant DNA carrier described in claim 7.
9. the preparation method of fusion rotein described in claim 1, comprising:
Step 1: the DNA molecular obtaining the super positive charge green fluorescent protein of coding, obtains the DNA molecular of coding connexon and lanthanide ion binding peptide;
Step 2: the DNA molecular of the super positive charge green fluorescent protein of coding is connected with the DNA molecular of encode connexon and lanthanide ion binding peptide and merges with expression vector, build recombinant expression vector;
Step 3: recombinant expression vector transformed host cell, induction contains the host cell expression fusion rotein of recombinant expression vector, the fusion rotein that separation, purifying are expressed.
10. the application of fusion rotein described in claim 1-5 any one in the double mode preparation preparing fluorescence and mr.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510251264.9A CN104804100A (en) | 2015-05-15 | 2015-05-15 | Fusion protein and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510251264.9A CN104804100A (en) | 2015-05-15 | 2015-05-15 | Fusion protein and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104804100A true CN104804100A (en) | 2015-07-29 |
Family
ID=53689319
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510251264.9A Pending CN104804100A (en) | 2015-05-15 | 2015-05-15 | Fusion protein and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104804100A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010129023A2 (en) * | 2009-04-28 | 2010-11-11 | President And Fellows Of Harvard College | Supercharged proteins for cell penetration |
| CN102827252A (en) * | 2012-09-14 | 2012-12-19 | 中国科学技术大学 | One kind of magnetic resonance imaging developers and two-photon imaging developers and preparation method thereof |
| CN104356230A (en) * | 2006-06-02 | 2015-02-18 | 哈佛大学校长及研究员协会 | Protein surface remodeling |
-
2015
- 2015-05-15 CN CN201510251264.9A patent/CN104804100A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104356230A (en) * | 2006-06-02 | 2015-02-18 | 哈佛大学校长及研究员协会 | Protein surface remodeling |
| WO2010129023A2 (en) * | 2009-04-28 | 2010-11-11 | President And Fellows Of Harvard College | Supercharged proteins for cell penetration |
| CN102827252A (en) * | 2012-09-14 | 2012-12-19 | 中国科学技术大学 | One kind of magnetic resonance imaging developers and two-photon imaging developers and preparation method thereof |
Non-Patent Citations (2)
| Title |
|---|
| JIE LIU,ET AL.: "Single molecular hyperbranched nanoprobes for fluorescence and magnetic resonance dual modal imaging", 《POLYM. CHEM.》 * |
| KELLY D. DAUGHTRY，ET AL.: "Tailoring Encodable Lanthanide-Binding Tags as MRI Contrast Agents", 《CHEMBIOCHEM》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Pathological‐condition‐driven construction of supramolecular nanoassemblies for bacterial infection detection | |
| CN105175526B (en) | Penetratin hPP8 and application thereof | |
| CN105112383B (en) | Penetratin hPP5 and application thereof | |
| CN109529046B (en) | Preparation and application of mitochondrion-targeted self-assembled protein nanoparticles | |
| CN102827254B (en) | Cell penetrating peptide hPP10 and use thereof | |
| DK2687539T3 (en) | ANNEXIN V VARIANT AND ITS MANUFACTURING AND USING THEREOF | |
| EP2749568B1 (en) | Cell dna synthesis prevention and cell proliferation inhibition polypeptide and use thereof | |
| CN109678966B (en) | Brain tumor targeting peptide and application thereof | |
| CN103705465A (en) | Slightly acidic environment targeted polypeptide modified tumor targeted nano drug delivery system, and preparation method thereof | |
| CN103304637A (en) | Cell permeable peptide hPP3 and usage thereof | |
| CN113186109A (en) | Saccharomyces cerevisiae expression long-acting recombinant fibronectin and application thereof in cosmetics | |
| CN101381405B (en) | Genetic engineering tumor targeting KCT-W1 polypeptides and preparation method and application | |
| CN103172701A (en) | Novel penetrating peptide and application thereof | |
| CN104017089A (en) | Ferritin heavy-chain subunit nanoparticles, and preparation method and application thereof | |
| Chen et al. | Multimodal nanoprobe based on upconversion nanoparticles for monitoring implanted stem cells in bone defect of big animal | |
| CN108267435A (en) | Novel cell fibril framework labeling method based on bimolecular fluorescence complementary | |
| CN102174110B (en) | Rabies virus glycoprotein-derived peptide and application thereof | |
| CN104804100A (en) | Fusion protein and preparation method thereof | |
| CN108697802A (en) | Use the drug delivery system targeting shell of carbon silane dendrimer, dendritic polymer | |
| CN101851294B (en) | Cell-penetrating peptide (Arg) 9 and lidamycin fusion protein (Arg) 9-LDP | |
| CN105820219A (en) | Polypeptide with binding affinity for HPV18 E7 protein and application thereof | |
| CN112457370B (en) | Gene recombination cell-penetrating peptide RTP and preparation method and application thereof | |
| CN111789961B (en) | Nano probe for nucleolin cross-linking induction of tumor cell apoptosis and preparation method and application thereof | |
| CN101899118B (en) | Fusion protein HABP-mKate and preparation method and application thereof | |
| CN112592386B (en) | Red light mediated nucleic acid anchoring type fluorescent probe and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150729 |
|
| WD01 | Invention patent application deemed withdrawn after publication |