CN104774937A - Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance - Google Patents
Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance Download PDFInfo
- Publication number
- CN104774937A CN104774937A CN201510158187.2A CN201510158187A CN104774937A CN 104774937 A CN104774937 A CN 104774937A CN 201510158187 A CN201510158187 A CN 201510158187A CN 104774937 A CN104774937 A CN 104774937A
- Authority
- CN
- China
- Prior art keywords
- cyst nematode
- heterodera glycines
- soybean cyst
- soybean
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention discloses a method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance. A primer pair for detecting the resistance of the heterodera glycines to be tested is provided and is composed of a single-stranded DNA molecule shown in sequence 1 in a sequence table and a single-stranded DNA shown in sequence 2 in the sequence table. The experiment provided by the invention shows that the primers designed by the invention can be used for specifically identifying the race 3 physiological race soybean of the heterodera glycines with high sensitivity and high accuracy, the selecting efficiency of the material in the breeding process can be greatly increased and the breeding material can be screened.
Description
Technical field
The present invention relates to biological technical field, particularly relate to a kind of method and primer special of auxiliary detection soybean cyst nematode resistance.
Background technology
Soybean cyst nematode (soybean cyst nematode, SCN) be the important disease that harm world soybean (Glycine maxL.Merr) is produced, belong to the complicated quantitative character of controlled by multiple genes, plantation disease-resistant variety, the non-host crop of efficent rotation are the cost-effective measures of current control soybean cyst nematode.Due to the complicacy of SCN resistant gene in heredity and diversity (the Riggs and Schmidt 1988 of Soybean Cyst Nematode; Caviness1992), the kind utilizing traditional breeding way to cultivate anti-soybean cyst nematode not only needs to spend long time, and be difficult to successfully, the development of current anti-line breeding can not be met, be badly in need of a kind of method identifying SCN more accurately and efficiently.Along with exploitation and the use of molecule marker, molecular marker assisted selection (Molecular marker-assistedselection, MAS) becomes the effective ways (Cregan et al.1999) can saved human and material resources and accelerate breeding process.The great advantage of MAS is when not needs assessment phenotypic characteristic, by being confirmed whether to identify resistant plant with target gene.
Rhg1 and Rhg4 is two major genes controlling soybean cyst nematode resistance.Liu etc. (2012, Nature) map based cloning method is utilized to clone Rhg4 site GmSHMT gene, this genes encoding a kind of serine hydroxymethylase (SHMT), regulation and control Serine and glycine transform mutually, with transgene complementation test etc., Analysis of Mutants, gene silencing all prove that this gene is relevant to resistance.Liu etc. (2012, Nature) pass through 28 parts of representative soybean resource GmSHMT gene sequencing discoveries, and 1 nonsynonymous mutation SNP site Rhg4-389 (G/C) may be relevant to soybean cyst nematode resistance.It is a kind ofly utilize specific primer PCR to combine with restriction enzyme digestion and a kind of DNA marker detecting SNP site of producing that enzyme cuts amplification polymorphism sequence (Cleaved Amplified Polymorphic Sequence, CAPS) mark.There is the features such as codominance, locus specificity, simple to operate and cost be low, be widely used in the Molecular Identification of crop, the assignment of genes gene mapping, map based cloning and assistant breeding etc.
Summary of the invention
An object of the present invention is to provide the primer pair detecting soybean cyst nematode resistance to be measured.
Primer pair provided by the invention, is made up of the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1 and sequence table.
In above-mentioned primer pair, in described sequence table, in the single strand dna shown in sequence 1 and described sequence table, the mol ratio of the single strand dna shown in sequence 2 is 1:1, and independent packaging;
Described soybean cyst nematode Heterodera glycines is soybean cyst nematode Heterodera glycines No. 3 physiological strains.
PCR reagent containing above-mentioned primer pair is also the scope of protection of the invention.
In above-mentioned PCR reagent, the final concentration of each bar primer in described PCR reagent of above-mentioned primer pair is 2 μm of olL
-1;
Described soybean cyst nematode Heterodera glycines is soybean cyst nematode Heterodera glycines No. 3 physiological strains.
Test kit containing above-mentioned primer pair or above-mentioned PCR reagent is also the scope of protection of the invention.
In mentioned reagent box, described soybean cyst nematode Heterodera glycines is soybean cyst nematode Heterodera glycines No. 3 physiological strains.
Above-mentioned primer pair or above-mentioned PCR reagent or above-mentioned test kit are also the scope of protection of the invention detecting the application in soybean cyst nematode resistance to be measured;
Or the application that above-mentioned primer pair or above-mentioned PCR reagent or above-mentioned test kit detect in soybean cyst nematode resistance product to be measured in preparation is also the scope of protection of the invention;
Described soybean cyst nematode Heterodera glycines is specially soybean cyst nematode Heterodera glycines No. 3 physiological strains.
Another object of the present invention is to provide a kind of method of detection or auxiliary detection soybean cyst nematode resistance to be measured.
Method provided by the invention, comprises the steps:
1) with above-mentioned primer pair, pcr amplification is carried out to soybean to be measured, obtain pcr amplification product;
2) BsrBI enzyme cuts described pcr amplification product, obtains digestion products;
Detect digestion products,
If there is the fragment of 237bp and 132bp size in described digestion products, then described Soybean Resistance to be measured or the anti-soybean cyst nematode Heterodera glycines of candidate, if do not have the fragment of 237bp and 132bp size in described digestion products, then described soybean to be measured does not resist or the not anti-soybean cyst nematode Heterodera glycines of candidate.
In aforesaid method, described soybean cyst nematode Heterodera glycines is soybean cyst nematode Heterodera glycines No. 3 physiological strains.
In aforesaid method, the template of described pcr amplification is the genomic dna of soybean to be measured.
Experiment of the present invention proves, the present invention devises primer can the anti-soybean cyst nematode Heterodera glycines of unique identification No. 3 physiological strain soybean, and highly sensitive, accuracy rate is high, can greatly improve the efficiency of selection of material in breeding process, screen breeding material.
Accompanying drawing explanation
Fig. 1 is the schematic diagram of the digestion products agarose gel electrophoresis of primer pair 1 amplified production.
Fig. 2 is the schematic diagram of the digestion products PAGE electrophoresis of primer pair 2 amplified production.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
The design of embodiment 1, primer
GmSHMT gene order (GenBank accession number: JQ714083 is downloaded from GenBank (http://www.ncbi.nlm.nih.gov/nuccore/JQ714083), from Resistant gerplasm Forrest), utilize Primer5.0 software design PCR primer: primer pair 1; The PCR primer estimated length of primer pair 1 is 369bp, can obtain 237bp and 132bp two fragments after BsrBI enzyme enzyme is cut in theory.
Primer pair 1:
F:CCTCCAAGCCTTCCACCTCG (sequence 1);
R:CCGCACTTATCAGCGACTTCC (sequence 2).
Embodiment 2, primer are detecting the application in soybean cyst nematode resistance
1, genomic dna is extracted
Extract 9 parts of known types (Peking, PI90763, Forrest, PI437654, PI209332, PI548316 (Cloud), PI88788, Essex, Willianms) and 4 parts of unknown gene types (first alms bowl black soya bean, red do not flow black soya bean, No. 1, anti-line and Taixing black soya bean) totally 13 parts of Soybean genomic DNAs to be measured.
2, pcr amplification
With each Soybean genomic DNA to be measured for template, carry out pcr amplification with the primer pair 1 of embodiment 1 respectively, obtain pcr amplification product;
The reaction system 20 μ L (PCR reagent containing primer pair) of above-mentioned pcr amplification, comprises 10ng μ L
-1genomic dna 5 μ L, 10 × PCR damping fluid (Quan Shijin Bioisystech Co., Ltd) 2 μ L, 2.5mmolL
-1dNTPs1.5 μ L, 2 μm of olL
-1the each 1.5 μ L of primer and 1U Taq polysaccharase 0.2 μ L, sterilized water 8.7 μ L and water.
Above-mentioned response procedures is: 95 DEG C of denaturation 3min, 94 DEG C of sex change 30s, 56 DEG C of annealing 40s, and 72 DEG C extend 50s, 38 circulations, and last 72 DEG C extend 8min, in 4 DEG C of preservations.
Above-mentioned PCR reaction is increased on the pcr amplification thermal cycler of ABI (Applied Biosystems, the U.S.) company.
The PCR primer of above-mentioned primer pair 1 correspondence adopts 1.5% agarose gel electrophoresis to detect, the DNA of the soybean varieties of 9 parts of known types (Peking, PI90763, Forrest, PI437654, PI209332, PI548316 (Cloud), PI88788, Essex, Willianms) and 4 parts of unknown gene types (first alms bowl black soya bean, red do not flow black soya bean, No. 1, anti-line and Taixing black soya bean) carries out pcr amplification, and all 13 parts of materials all obtain the single PCR primer close with target fragment length scale of 369bp.
3, enzyme is cut
The PCR primer BsrBI endonuclease digestion that primer pair 1 obtains.
Above-mentioned endonuclease reaction system 10 μ l, PCR primer 5 μ l, 3U restriction endonuclease, 1.5 μ L NEB buffer.
Endonuclease reaction system puts into 37 DEG C of insulation cans or water-bath, and enzyme takes out after cutting 30min, obtains digestion products.
1.5% agarose gel electrophoresis is adopted by BsrBI digestion products to detect, if there is the fragment (order-checking detected magnitude) of 237bp and 132bp size in digestion products, then Soybean Resistance to be measured or the anti-soybean cyst nematode Heterodera glycines of candidate, if do not have the fragment (order-checking detected magnitude) of 237bp and 132bp size in digestion products, then above-mentioned soybean to be measured does not resist or the not anti-soybean cyst nematode Heterodera glycines of candidate.
9 parts expert evidence with the result of primer pair 1 as shown in Figure 1,
Forrest digestion products is 237bp and 132bp, then its anti-soybean cyst nematode Heterodera glycines;
PI437654 digestion products is 237bp and 132bp, then its anti-soybean cyst nematode Heterodera glycines;
PI209332 digestion products is 237bp and 132bp, then its anti-soybean cyst nematode Heterodera glycines;
PI548316 (Cloud) digestion products is 237bp and 132bp, then its anti-soybean cyst nematode Heterodera glycines;
PI88788 digestion products is 237bp and 132bp, then its anti-soybean cyst nematode Heterodera glycines;
Essex digestion products is 369bp (not having 237bp and 132bp), then its not anti-soybean cyst nematode Heterodera glycines;
Willianms digestion products is 369bp (not having 237bp and 132bp), then its not anti-soybean cyst nematode Heterodera glycines.
Unit's alms bowl black soya bean digestion products is 237bp and 132bp, then its anti-soybean cyst nematode Heterodera glycines;
The red black soya bean digestion products that do not flow is 237bp and 132bp, then its anti-soybean cyst nematode Heterodera glycines;
Anti-line No. 1 digestion products is 237bp and 132bp, then its anti-soybean cyst nematode Heterodera glycines;
Taixing black soya bean digestion products is 369bp (not having 237bp and 132bp), then its not anti-soybean cyst nematode Heterodera glycines.
4, resistance checking
Above-mentioned 13 parts of material soybean varieties are all inoculated soybean cyst nematode Heterodera glycines No. 3 physiological strains under sick garden, field and two kinds, greenhouse envrionment conditions.Completely random district group test design scheme is adopted, in triplicate in field.Field planting line width 0.65 meter, long 1.5 meters of row, strain spacing 0.05 meter.Greenhouse adopts potted plant qualification, and each kind plants 3 basins, and 5 strains planted by every basin.After emerging 30 days, identify with identical 10 strains of every part of material equal Stochastic choice growing way in greenhouse field, the every strain cyst number of number, calculates the average cyst number of each identification of species.In order to detect cyst index (FemaleIndex, FI) difference, every 40 row with middle product 03-5373 (Zhang Shanshan etc., Acta Agronomica Sinica, 2013,39 (10): 1746-1753) as disease-resistant contrast, middle yellow 13 (ZDD23876) are as susceptible contrast.With the resistance of each kind of disease-resistant level evaluation divided based on cyst index.The calculation formula of cyst index is FI=(the average cyst number of the every strain of identification of species average cyst number/susceptible check variety) X 100%, and every part of material is yellow 13 being susceptible check variety in nearest from it.Anti-sense grade scale is as follows, and FI=0-9 is disease-resistant (Resistant, R); FI=10-29 resists (moderately resistant, MR) in being; FI=30-59 is middle sense (moderately susceptible, MS); FI=60+ is susceptible (susceptible, S), and result is as shown in table 1.
Table 1 is soybean varieties SNP site genotype
The kind that above-mentioned table 1 relates to all is documented in as in Publication about Document: kingdom's merit. Chinese soybean variety source catalogue. and Beijing: Chinese agriculture press, 1982; Chang Ru town, Sun Jianying. Chinese soybean variety source catalogue: sequel. Beijing: agriculture press, 1991; Chang Ru town, Sun Jianying, Qiu Lijuan, an old dance. Chinese soybean variety source catalogue: sequel two. Beijing: Chinese agriculture press, 1996; Zhang Shanshan, Li Yinghui, Li Jinying, Qiu Lijuan. in excellent strain, the heredity of product 03-5373 pedigree is resolved and the qualification of anti-soybean cyst nematode mark of correlation. Acta Agronomica Sinica, 2013,39 (10): 1746-1753.Chen, Y., D.Wang, P.Arelli, M.Ebrahimi and R.L.Nelson.2006.Molecular marker diversity of SCN-resistant sources in soybean.Genome 49:938-949
As can be seen from Table 1, for 13 parts of materials, primer 1 of the present invention and method identify that accuracy rate is 100%.
Therefore, can carry out soybean cyst nematode resistance detection by primer of the present invention and method to soybean to be measured, concrete grammar is as follows: increase to Soybean genomic DNA to be measured with primer pair 1 of the present invention, obtain pcr amplification product; Again pcr amplification product BsrBI enzyme is cut, detect digestion products size: if there is the fragment of 237bp and 132bp size in digestion products, then Soybean Resistance to be measured or the anti-soybean cyst nematode Heterodera glycines of candidate No. 3 physiological strains, if do not have the fragment of 237bp and 132bp size in digestion products, then above-mentioned soybean to be measured does not resist or the not anti-soybean cyst nematode Heterodera glycines of candidate No. 3 physiological strains.
Test kit containing above-mentioned primer pair or PCR reagent all can carry out above-mentioned qualification.
Embodiment 3, primer are detecting the application in soybean cyst nematode resistance
Adopt the kind of primer pair 1 his-and-hers watches 1 of embodiment 2 step 1-3 to test respectively, enzyme cuts result as table 1.
Adopt the kind of embodiment 2 step 4 his-and-hers watches 1 to test respectively, resistance result is as table 1.
Result shows further, can carry out soybean cyst nematode resistance detection with primer pair 1 of the present invention and method to soybean to be measured, and qualification accurately.
Comparative example:
One, primer is designed
GmSHMT gene order (GenBank accession number: JQ714083 is downloaded from GenBank (http://www.ncbi.nlm.nih.gov/nuccore/JQ714083), from Resistant gerplasm Forrest), utilize Primer5.0 software design PCR primer:
Primer pair 2 (contrast), cut through PsiI enzyme enzyme:
F:TTCGTTGTGTGATTGTTTTGCAGGT (sequence 3)
R:CTAAGTTCTGCGATGATAAA (sequence 4).
Two, primer functional verification
Anti-soybean cyst nematode Heterodera glycines No. 3 physiological strain soybean varieties (through resistance checking) PI 398680, PI 339868B, PI 209332, PI 200495, PI 87631-1, PI 84751, PI548389, Essex, Williams 82, Forrest and PI 90763 (are documented in as in Publication about Document: Chen, Y., D.Wang, P.Arelli, M.Ebrahimiand R.L.Nelson.2006.Molecular marker diversity of SCN-resistant sources insoybean.Genome 49:938-949) extract genomic dna respectively;
Using the genomic dna of above-mentioned each kind as template, pcr amplification is carried out with primer pair 2, the PCR primer obtained is carried out PsiI enzyme enzyme and is cut, PAGE electrophoresis result as shown in Figure 2, can find out, the bands of a spectrum of resistant material PI398680, PI339868B, PI 209332, PI 200495, PI 87631-1, PI 84751, Forrest and PI 90763 are all inconsistent, therefore, cannot carry out soybean cyst nematode Heterodera glycines No. 3 physiological strain Resistance Identifications with primer pair 2.
Therefore, can find out, and the primer pair of not all can carry out soybean cyst nematode Heterodera glycines No. 3 physiological strain Resistance Identifications, primer pair 1 is through to be groped to optimize the best soybean cyst nematode Heterodera glycines No. 3 physiological strain Resistance Identification primers obtained.
Claims (10)
1. detect the primer pair of soybean cyst nematode resistance to be measured, be made up of the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1 and sequence table.
2. primer pair according to claim 1, is characterized in that: in described sequence table, in the single strand dna shown in sequence 1 and described sequence table, the mol ratio of the single strand dna shown in sequence 2 is 1:1;
Described soybean cyst nematode Heterodera glycines is soybean cyst nematode Heterodera glycines No. 3 physiological strains.
3. the PCR reagent containing primer pair described in claim 1 or 2.
4. PCR reagent according to claim 3, is characterized in that: the final concentration of each bar primer in described PCR reagent of primer pair described in claim 1 or 2 is 2 μm of olL
-1;
Described soybean cyst nematode Heterodera glycines is soybean cyst nematode Heterodera glycines No. 3 physiological strains.
5. the test kit containing PCR reagent described in primer pair described in claim 1 or 2 or claim 3 or 4.
6. test kit according to claim 5, is characterized in that: described soybean cyst nematode Heterodera glycines is soybean cyst nematode Heterodera glycines No. 3 physiological strains.
7. PCR reagent described in primer pair described in claim 1 or 2 or claim 3 or 4 or the test kit described in claim 5 or 6 are detecting the application in soybean cyst nematode resistance to be measured;
Or PCR reagent described in primer pair described in claim 1 or 2 or claim 3 or 4 or the test kit described in claim 5 or 6 detect the application in soybean cyst nematode resistance product to be measured in preparation;
Described soybean cyst nematode Heterodera glycines is specially soybean cyst nematode Heterodera glycines No. 3 physiological strains.
8. a method for detection or auxiliary detection soybean cyst nematode resistance to be measured, comprises the steps:
1) with primer pair described in claim 1 or 2, pcr amplification is carried out to soybean to be measured, obtain pcr amplification product;
2) BsrBI enzyme cuts described pcr amplification product, obtains digestion products;
Detect digestion products,
If there is the fragment of 237bp and 132bp size in described digestion products, then described Soybean Resistance to be measured or the anti-soybean cyst nematode Heterodera glycines of candidate, if do not have the fragment of 237bp and 132bp size in described digestion products, then described soybean to be measured does not resist or the not anti-soybean cyst nematode Heterodera glycines of candidate.
9. method according to claim 8, is characterized in that: described soybean cyst nematode Heterodera glycines is soybean cyst nematode Heterodera glycines No. 3 physiological strains.
10. method according to claim 8 or claim 9, is characterized in that: the template of described pcr amplification is the genomic dna of soybean to be measured.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510158187.2A CN104774937A (en) | 2015-04-03 | 2015-04-03 | Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510158187.2A CN104774937A (en) | 2015-04-03 | 2015-04-03 | Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104774937A true CN104774937A (en) | 2015-07-15 |
Family
ID=53616701
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510158187.2A Pending CN104774937A (en) | 2015-04-03 | 2015-04-03 | Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104774937A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107299146A (en) * | 2017-08-21 | 2017-10-27 | 中国农业科学院作物科学研究所 | Anti- soybean cyst nematode Heterodera glycines correlation CAPS mark detection methods and primer |
| CN109022607A (en) * | 2018-08-02 | 2018-12-18 | 中国农业科学院作物科学研究所 | A kind of breeding method of how anti-gene pyramiding soybean and the application of how anti-gene pyramiding soybean |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293806A (en) * | 2014-08-28 | 2015-01-21 | 吉林省农业科学院 | Soybean SHMT novel allele and typing method thereof |
-
2015
- 2015-04-03 CN CN201510158187.2A patent/CN104774937A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293806A (en) * | 2014-08-28 | 2015-01-21 | 吉林省农业科学院 | Soybean SHMT novel allele and typing method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 束永俊等: "基于基因重测序信息的大豆基因靶向CAPS标记开发", 《作物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107299146A (en) * | 2017-08-21 | 2017-10-27 | 中国农业科学院作物科学研究所 | Anti- soybean cyst nematode Heterodera glycines correlation CAPS mark detection methods and primer |
| CN107299146B (en) * | 2017-08-21 | 2020-07-14 | 中国农业科学院作物科学研究所 | Soybean cyst nematode-resistant related CAPS (cleaved amplified polymorphic sequence) marker detection method and primers |
| CN109022607A (en) * | 2018-08-02 | 2018-12-18 | 中国农业科学院作物科学研究所 | A kind of breeding method of how anti-gene pyramiding soybean and the application of how anti-gene pyramiding soybean |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Couch et al. | Origins of host-specific populations of the blast pathogen Magnaporthe oryzae in crop domestication with subsequent expansion of pandemic clones on rice and weeds of rice | |
| Alves-Santos et al. | A DNA-based procedure for in planta detection of Fusarium oxysporum f. sp. phaseoli | |
| CN104313021B (en) | Molecular marker of wheat powdery mildew disease-resistant genes Pm51 and application of molecular marker | |
| CN104726450B (en) | With the capsicum root-rot epidemic disease closely linked molecule marker of specific resistance gene and application thereof | |
| CN104073487A (en) | Molecular marker of rice-blast-resistant gene Pi2 and application of molecular marker | |
| CN103146695A (en) | Functional molecular marker for rice anti-blast gene Pi9 and application thereof | |
| CN105543391A (en) | InDel molecular marker for identifying clubroot-resistant QTL (quantitative trait locus) located on Chinese cabbage A03 chromosome and application thereof | |
| CN103642803B (en) | The specific Function molecule marker of rice blast resistance gene Pi64 and method thereof and application | |
| Gürcan et al. | Evaluation of Turkish apricot germplasm using SSR markers: Genetic diversity assessment and search for Plum pox virus resistance alleles | |
| CN104450932B (en) | Rice blast resistance gene Pi2 gene specific molecular labelings Pi2SSR and its preparation method and application | |
| CN102899400B (en) | Molecule marking method for rice anti-rice blast gene Pigm | |
| CN105219858B (en) | Grain Weight in Common Wheat gene TaGS5 3A single nucleotide polymorphisms and its application | |
| CN103773864B (en) | A kind of SNP marker method of pear fruit transverse diameter main effect QTL site and application thereof | |
| CN104561348A (en) | Specific PCR molecular markers for detecting rice high-grain weight alleles | |
| Li et al. | Mapping of wheat stripe rust resistance gene Yr041133 by BSR-Seq analysis | |
| CN104774937A (en) | Method for aided detection of heterodera glycines resistance and special primers for detection of heterodera glycines resistance | |
| US11382290B2 (en) | Soy gene cluster regions and methods of use | |
| CN104789648A (en) | Molecular markers for haplotype identification of paddy rice CMS restoring gene Rf-1 segment and applications thereof | |
| CN104232764B (en) | The SNP marker of the low-phosphorous responsive genes ZmARF31 of corn and application thereof | |
| CN102766691B (en) | Molecular markers for avirulence gene Avr-Pit of Pyricularia grisea | |
| Orabi et al. | Genetic diversity and population structure of wild and cultivated barley from West Asia and North Africa | |
| CN106701749A (en) | Rice blast resistance gene Piz-t functional specific molecular marker and detection method and application thereof | |
| CN102925437B (en) | Specific molecular marker of deletion mutation of base at site of eIF(iso) 4E.c of Chinese cabbage and application thereof | |
| CN105176994A (en) | Functional specificity molecule mark Pi9FNP of blast resistance gene Pi9 as well as detection method and application thereof | |
| Zubrzycki et al. | Biparental QTL and association mapping for Sclerotinia head rot resistance in cultivated sunflower |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150715 |
|
| RJ01 | Rejection of invention patent application after publication |