CN103642803B - The specific Function molecule marker of rice blast resistance gene Pi64 and method thereof and application - Google Patents

Abstract

The invention discloses 2 couples of functional molecular marker YRT3 and YRT4 of rice blast resistance gene Pi64 and method thereof and application, by Pi64 allelotrope and upstream of coding region sequence thereof in comparison and the multiple rice varieties of analysis, obtain Pi64 specific Function site 2 place being different from susceptible allelotrope and other rice blast resistance genes; By design primer, obtain SEQ ID NO.1 and SEQ IDNO.2 respectively, and SEQ ID NO.3 and SEQ ID NO.4; Utilize this primer amplification rice total dna, obtain Pi64 specific Function molecule marker YRT3 and YRT4 respectively.The present invention can screen, identify this functional resistant gene in a large amount of Rice Germplasm Resources, and being applied in molecular marker assisted selection breeding, gene pyramiding breeding and transgenic breeding.

Description

The specific Function molecule marker of rice blast resistance gene Pi64 and method thereof and application

Technical field

The invention belongs to agricultural biological technical field, be specifically related to resistance gene of rice blast pi64(former numbering piym2) 2 pairs of functional molecular markers and method and application.

Background technology

Paddy rice is one of most important food crop in the world, and whole world population over half take rice as main food.Rice blast is one of topmost disease of paddy rice, and the paddy underproduction that the whole world is caused because of rice blast every year reaches 10% ~ 30%, and reach 30% ~ 50% time serious, even No kernels or seeds are gathered, as in a year of scarcity.At the long-term occurring area of China's rice blast at about 3,800,000 mu, cause the paddy of several hundred million kilograms to lose, directly threaten the grain security of country.

Cultivate and utilize disease-resistant variety to be acknowledged as most economical effective and eco-friendly rice blast prophylactico-therapeutic measures always.But because Population Structure of Magnaporthe grisea is complicated, its pathogenic being easy to is morphed in addition, some rapid breedings that are potential or the new pathogenic microspecies produced, a disease-resistant variety is often promoted and just susceptibleization is occurred in 3 ~ 5 years.Therefore, cultivating new variety that are lasting, wide spectrum blast resisting is important directions of paddy disease-resistant breeding research, and extensively excavates, identifies new rice blast resistance gene, carries out multiple gene polymerization breeding and is considered to obtain effective way that is lasting, broad-spectrum disease resistance kind.

Traditional paddy disease-resistant breeding depends on the qualification of resistant phenotype, and this not only requires that breeder has rich experience and sharp vision, and qualification result is very easily subject to the impact of envrionment conditions and human factor, thus reduces the efficiency of selection of target gene.In addition, due to by the restriction can differentiating heterogeneic discriminating fungus strain, merely rely on phenotypic evaluation and be difficult to the polymerization realizing multiple resistant gene.Along with the emergence and development of Molecular Marker Assisted Selection Technology, it is convenient, directly, advantage not affected by environment makes its using value and prospect more and more receive publicity.Develop and apply and the closely linked molecule marker of resistant gene, particularly the acid molecules mark of resistant gene own carries out assisted Selection, not only greatly can improve resistance screening, Resistance genes and breeding selection efficiency, and make to cultivate lasting, broad-spectrum disease resistance breeding by gene pyramiding means and become possibility.

So far, utilize molecular marking technique to identify both at home and abroad and locate more than 70 resistance gene of rice blast, Ke Longliao pia, pib, pita, pi1, pi9, pi2, piz-t, pi-d2, pi-d3, pi36, pi37, pik, pik-m, pik-p, pi5, pia, pit, pish, pi21, pb1with pi64deng 21 genes, and develop for pita, pib, pik, pikm, pikp, pi1, pit, pi5with pi25isogenic specific Function mark (Lei et al. 2013; Ma et al. 2013; Paddy rice Data centre of country: http://www.ricedata.cn/gene/).This is for, high effect culture quick by molecular breeding means is lasting, wide spectrum Varieties Resistant To Rice Blast has established certain basic substance.

Resistance gene of rice blast pi64this laboratory high leaf blast resistance of clone and gene (former name of panicle blast from Yunnan local japonica rice variety wool paddy (YMG) recently piym2, see patent No. ZL 201210073815.3, denomination of invention: rice blast resistance gene piym2and application).This gene is positioned at paddy rice the 1st chromosome long arm pi64/ pishgene cluster, a typical CC-NBS-LRR class resistance protein of encoding.It belongs to a relatively ancient gene on evolving, and is not yet applied to rice breeding practice.In order to accelerate pi64the application process of gene in breeding, reduces breeding cost, develops and can identify that the functional molecular marker of this gene seems particularly important accurately and effectively.

Summary of the invention

Primary and foremost purpose of the present invention is to provide qualification rice blast resistance gene pi64specific Function molecule marker YRT3 or YRT4.

Another object of the present invention is to provide and utilizes described rice blast resistance gene pi64functional molecular marker YRT3 or YRT4 differentiate or screening containing rice blast resistance gene pi64the method of rice varieties.

Another object of the present invention is to provide rice blast resistance gene pi64the application of functional molecular marker YRT3 and YRT4.

The object of the invention is achieved through the following technical solutions:

Functional molecular marker YRT3 is the nucleotide sequence increasing out with primer pair SEQ ID NO. 1 and SEQ ID NO. 2 from oryza sativa genomic dna, detect, with the rice blast resistance gene increasing out from specific rice varieties through specific restriction endonuclease digestion rear electrophoresis pi64present consistent banding pattern;

Functional molecular marker YRT4 directly amplifies nucleotide sequence with primer pair SEQ ID NO. 3 and SEQ ID NO. 4, through electrophoresis detection, with the rice blast resistance gene increasing out from specific rice varieties from oryza sativa genomic dna pi64present consistent banding pattern;

Wherein, described specific paddy rice is rice varieties is wool paddy (YMG).

The right nucleotide sequence of the primer is as follows:

SEQ ID NO.1：CCTGCATGGTCTGGCAGAGTCA

SEQ ID NO.2：AGTGAAGTAAGCCCACCAAGGCAA

SEQ ID NO.3：CGCGTGCCCTGCAATACAAACG

SEQ ID NO.4：CTCCATGGTCCCAAGGGCGGTA；

Described specific restriction restriction endonuclease is asei.

Described rice blast resistance gene pi64the screening method of functional molecular marker YRT3 or YRT4 be: by multiple resistance gene of rice blast pi64allelic sequences and the method that compares of SEQ ID NO. 5 sequence, analyze and obtain distinguishing its susceptible allelotrope and other rice blast resistance genes pi64specific Function site (amino acid sites N698 (SEQ ID NO. 7) and transposon insertion sequence SEQ ID NO.6), SEQ ID NO. 1 and SEQ ID NO. 2 and SEQ ID NO. 3 and SEQ ID NO. 4 primer is being obtained respectively by design, to rice total dna amplification, obtain respectively pi64functional molecular marker YRT3 and YRT4.

Described screening method comprises following concrete steps:

(1) multiple rice varieties is obtained by pcr amplification pi64allelic coding region DNA sequence dna;

(2) utilize Multiple Sequence Alignment Software tool, compare after the sequence that step (1) obtains is translated into protein sequence, obtain pi642 pleomorphism sites that type resistant gene is special, i.e. amino acid sites N698 and the upstream of coding region transposon insertion sequence as shown in SEQ ID NO. 6;

(3) 2 pleomorphism sites obtained according to step (2) design primer pair SEQ ID NO. 1 and SEQ ID NO. 2 and SEQ ID NO. 3 and SEQ ID NO. 4 respectively; And respectively pcr amplification reaction is carried out to the STb gene of different rice varieties with these 2 pairs of primers, obtain amplified production A and amplified production B; Then amplified production A is carried out to enzyme is cut, electrophoresis, direct electrophoresis is carried out to amplified production B, is obtained respectively and rice blast resistance gene by comparatively validate pi64nucleotide fragments YRT3 and YRT4 in specificity banding pattern;

(4) molecule marker that step (3) obtains is verified in different rice varieties, determine pi64specific Function molecule marker YRT3 and YRT4.

Above-mentioned screening method, the rice varieties described in step (1) is wool paddy (YMG), flush white paddy, 93-11(raise rice No. 6), Calusena lansium is glutinous, always make paddy, hemp twine, Fujisaka 5, Tsuyuake, K59, black rice, Nipponbare east agriculture 363 and Lijiang xintuanheigu (LTH);

Pcr amplification described in step (3), wherein the PCR reaction system of amplified production A is as follows: 2 × PCR Buffer for KOD FX 10 μ l, dNTPs (2mM each) 4 μ l, primer (10pmol, F+R) 1 μ l, KOD FX enzyme (1U/ μ l, TOYOBO) 0.4 μ l, DNA profiling (100ng/ μ l) 2 μ l, add ddH ₂o to 20 μ l, amplification reaction condition: 94 DEG C of 2 min; 98 DEG C of 10 s → 59 DEG C 1.5 min → 68 DEG C 5 min, 35 circulations; 68 DEG C of 5 min, 10 DEG C of preservations; The PCR reaction system of amplified production B is as follows: 2 × PCR Buffer for KOD FX 10 μ l, dNTPs (2mM each) 4 μ l, primer (10pmol, F+R) 1 μ l, KOD FX enzyme (1U/ μ l, TOYOBO) 0.4 μ l, DNA profiling (100ng/ μ l) 2 μ l, add ddH ₂o to 20 μ l, amplification reaction condition: 94 DEG C of 2 min; DEG C 40s → 68,98 DEG C of 10 s → 59 DEG C 5 min, 35 circulations; 68 DEG C of 5 min, 10 DEG C of preservations;

The size of the amplified production A described in step (3) is the 1554th to 3002 Nucleotide in 1449 bp(SEQ ID NO. 5), warp asei enzyme becomes 2 fragments (size be in 541 bp, SEQ ID NO. 5 in the 1554th to 2094 Nucleotide and 908 bp, SEQ ID NO. 5 the 2095th to 3002 Nucleotide) after cutting; The size of amplified production B is the 215th to 635 Nucleotide in 421 bp(SEQ ID NO. 6).The present invention also provides the rice blast resistance gene described in utilization pi64functional molecular marker YRT3 or YRT4 differentiate or screening containing rice blast resistance gene pi64the method of rice varieties:

With the STb gene of rice plant to be measured or kind for template, the primer pair of sequence as shown in SEQ ID NO.1 and 2 is adopted to carry out pcr amplification, if the amplified production size obtained is 1449 bp, and through specific enzymes asei enzyme becomes 2 fragments after cutting, size is 908 bp and 541bp, then rice plant to be measured or kind contain rice blast resistance gene pi64;

With the STb gene of rice plant to be measured or kind for template, adopt the primer pair of sequence as shown in SEQ ID NO.3 and 4 to carry out pcr amplification, if the amplified production size obtained is 421 bp, then rice plant to be measured or kind contain rice blast resistance gene pi64;

The present invention also provides described rice blast resistance gene pi64the application of functional molecular marker YRT3 or YRT4, comprise and utilize YRT3 or YRT4 to screen in a large amount of Rice Germplasm Resources, identify this function resistant gene, and the application in molecular mark, gene pyramiding breeding and transgenic breeding.

The present invention has following significantly beneficial effect:

pi64deriving from the Yunnan traditional rice variety wool paddy YMG to Pyricularia oryzae performance resistance of wide spectrum, is the new gene (patent No. ZL 201210073815.3) of China independently clone one leaf blast resistance and panicle blast simultaneously.This gene belongs to complete resistance gene, has the advantage of wide spectrum high resistance, and belongs to gene relatively ancient in evolution, not yet finds this gene at present in Cultivar.Therefore, pi64gene is with a wide range of applications in rice breeding.

The present invention passes through more different rice varieties pi64the transposon sequence of allele encodes district and upstream thereof, based on pi64two cover specific Function molecule markers (YRT3 and YRT4) are developed in the distinctive DNA of gene and aminoacid sequence site.Apply this two covers molecule marker, based on Standard PCR technology, be aided with digestion with restriction enzyme, accurately can not only distinguish different variety resources of rice pi64genotype, and effective and rapidly can screen the individuality carrying target gene from breeding population.To multiple colony (as the RIL of YMG/LTH, the BC of YMG/LTH ₅f ₂, YMG/CO39 F ₂colony) practice of carrying out molecular marker assisted selection confirms this two covers molecule marker inheritance stability, not by the impact of environmental factors, can absolutely identify pi64gene.

Application pi64gene function specific molecular marker backcrosses to target gene or conventional hybridization transformation, and is polymerized with other resistant genes, and its breeding selection is with clearly defined objective, can greatly save time and cost, and improves blast resisting breeding efficiency.Owing to being derived from the polymorphism in gene internal specific Function site, there is not the heredity burden problem of bad proterties in molecule marker of the present invention.In addition, mark of the present invention due to pi64gene is not yet employed in Cultivar, has suitability widely in cultivated rice.Therefore, molecule marker provided by the invention and application thereof, for acceleration resistance gene of rice blast pi64application in rice breeding is significant.

Accompanying drawing explanation

Fig. 1 is pi64and different varieties allelic partial amino-acid series comparison result.

Fig. 2 is the detected result of molecule marker YRT3 and YRT4 in different rice varieties.

Wherein, a is YRT3 detected result; B is YRT4 detected result; M. Maker; 1-17 is respectively YMG, LTH, 93-11, Fujisaka 5, Tsuyuake, K59, flush white paddy, black rice, Kinmaze, Aichi Asahi, CO39, Nanjing 11, Nipponbare, and Calusena lansium is glutinous, always makes paddy, hemp twine and Dong Nong 363.

Fig. 3 is the detected result of molecule marker YRT3 and YRT4 in recombinant inbred lines.

Wherein, a is YRT3 detected result; B is YRT4 detected result; M:Maker; 1:YMG; 2:LTH; 3-5 and 13-17: do not contain pi64the family of gene; 6-12: contain pi64the family of gene; R: disease-resistant; S: susceptible.

Fig. 4 is the BC of molecule marker YRT3 and YRT4 at YMG and LTH ₅f ₂detected result in individual plant.

Wherein, a is YRT3 detected result; B is YRT4 detected result; M:Maker; 1:YMG; 2:LTH; 3-5: contain pi64the individual plant that isozygotys of gene; 6-14: contain pi64the heterozygosis individual plant of gene; 15-17: do not contain pi64the individual plant of gene; +: contain pi64gene; –: do not contain pi64gene; R: disease-resistant; S: susceptible.

Fig. 5 is the F of molecule marker YRT3 and YRT4 at YMG and CO39 ₂detected result in individual plant.

Wherein, a is YRT3 detected result; B is YRT4 detected result; M:Maker; 1:YMG; 2:CO39; 3-6: contain pi64the individual plant that isozygotys of gene; 7-14: contain pi64the heterozygosis individual plant of gene; 15-17: do not contain pi64the individual plant of gene; +: contain pi64gene; –: do not contain pi64gene.

Embodiment

The experimental technique used in following embodiment if no special instructions, be ordinary method (such as: the rugged adopted people in mountain, high slope nur are write. rice blast and breeding for disease resistance (Ling Zhongzhuan, Sun Changqi translate). agriculture press, 1990; Ling Zhong monograph. rice blast research paper collection. Chinese agriculture press. 2005; Lu Tiegang etc. write. molecular genetics. and Higher Education Publishing House, 2008).Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

embodiment 1: pi64and the qualification in allelotrope amino acid alignment and Specific amino acid site

By pcr amplification, sequence measurement, raise rice No. 6 from wool paddy (YMG), flush white paddy, 93-11(), Calusena lansium is glutinous, always make paddy, hemp twine, Fujisaka 5, Tsuyuake, K59, black rice, eastern agriculture 363 and Lijiang xintuanheigu (LTH) genomic dna and obtain pi64allele encodes district DNA sequence dna, obtains 3 genes of Reference variety Nipponbare from Rice database lOC_Os01g57280, lOC_Os01g57310with pishcoding region DNA sequence dna.Utilize Software tool Primer Premier 5 that DNA sequence dna is translated into aminoacid sequence, then utilize Software tool that obtained aminoacid sequence is carried out Multiple Sequence Alignment analysis, identify pi644 amino acid sites N698, Y1003, A1031 and V1177(Fig. 1 specific to gene).

embodiment 2: pi64gene coding region upstream sequence is analyzed

Standard PCR means are utilized to increase pi64gene coding region upstream sequence, obtains 1597bp sequence through order-checking.By NCBI BLAST comparison (http://blast.ncbi.nlm.nih.gov/Blast.cgi PROGRAM=blastn & BLAST_ PROGRAMS=megaBlast & PAGE_TYPE=BlastSearch & SHOW_DEFAULTS=on & LINK_LOC=blasthome), find the transposon of the TIR type of a 715bp size at upstream of coding region, but do not find the homologous sequence that there is this transposon in paddy rice.

embodiment 3: pi64gene specific molecular markers development and detection

Utilization is present in pi64the Specific amino acid site N698(of gene pi64codon corresponding in albumen is AAT, all the other kinds are GAT), according to CAPS indicia designs principle, utilize online software dCAPS Finder 2.0(http: //helix.wustl.edu/dcaps/dcaps.html) and Primer-BLAST (http://www.ncbi.nlm.nih.gov/ tools/primer-blast/index.cgi LINK_LOC=BlastHome) design primer YRT3, the nucleotide sequence of this primer pair is as shown in SEQ ID NO.1 and SEQ ID NO.2.The pcr amplification reaction system of YRT3 is: 2 × PCR Buffer for KOD FX 10 μ l, dNTPs (2mM each) 4 μ l, primer (10pmol, F+R) 1 μ l, KOD FX enzyme (1U/ μ l, TOYOBO) 0.4 μ l, DNA profiling (100ng/ μ l) 2 μ l, add ddH ₂o to 20 μ l.Amplification reaction condition: 94 DEG C of 2 min; 98 DEG C of 10 s → 59 DEG C 1.5 min → 68 DEG C 5 min, 35 circulations; 68 DEG C of 5 min, 10 DEG C of preservations.Getting PCR primer after PCR reaction terminates, to carry out restriction be property endonuclease digestion, and reaction system is: 10 × FastDigest ^?green buffer 2 μ l, restriction enzyme asei 1 μ l, adds ddH ₂o to 25 μ l, in 37 DEG C of digestion 4 hours.Digestions product detects through 1.2% sepharose, the clip size that pcr amplification obtains is the 1554th to 3002 Nucleotide in 1449 bp(SEQ ID NO. 5), through restriction enzyme digestion after there are the 1554th to 2094 Nucleotide in 541 bp(SEQ ID NO. 5) and 908 bp(SEQ ID NO. 5 in the 2095th to 3002 Nucleotide) two bands, be pi64the detected result of the specific molecular marker YRT3 of gene.

According to InDel/Insert principle of design, based on pi64the transposon sequence design Auele Specific Primer YRT4 that upstream, gene coding region exists, the nucleotide sequence of this primer pair is as shown in SEQ ID NO.3 and SEQ ID NO.4.SEQ ID NO.3 sequence is positioned at transposon, and SEQ ID NO.4 is positioned at transposon downstream.The pcr amplification reaction system of YRT4 is: 2 × PCR Buffer for KOD FX 10 μ l, dNTPs (2mM each) 4 μ l, primer (10pmol, F+R) 1 μ l, KOD FX enzyme (1U/ μ l, TOYOBO) 0.4 μ l, DNA profiling (100ng/ μ l) 2 μ l, add ddH ₂o to 20 μ l.Amplification reaction condition: 94 DEG C of 2 min; 98 DEG C of 10 s → 59 DEG C 40s → 68 DEG C 5min, 35 circulations; 68 DEG C of 5 min, 10 DEG C of preservations.Pcr amplification reaction product detects through 1.2% sepharose, and it is the 215th to 635 Nucleotide in 421bp(SEQ ID NO. 6 that pcr amplification obtains size) fragment, be pi64the detected result of the specific molecular marker YRT4 of gene.

embodiment 4: pi64the detection of gene specific functional molecular marker in different rice varieties

Extract the genomic dna of 17 different rice varieties, as template, utilize the PCR amplification system and reaction conditions that describe in embodiment 3, utilize functional molecular marker YRT3 and YRT4 to increase respectively, the amplified production of YRT3 need through digestion with restriction enzyme.Detect through agargel electrophoresis, electrophoresis result as shown in Figure 2, only have by result display pi64donor YMG in contain pi64gene, not containing this gene in other kinds.Molecule marker YRT3 and YRT4 can identify specifically pi64gene.

embodiment 5: pi64the detection of gene in the recombinant inbred lines (RILs) of YMG/LTH

To 267 the RILs family (F coming from YMG (♂) and LTH (♀) ₁₂generation) carry out in embodiment 3 describe testing process.Detect in 267 familys, utilize mark YRT3 to be tested with the banding pattern that YMG appears in 127 familys; Utilize mark YRT4 to be tested with 127 familys equally and occur amplified band, consistent with the banding pattern of parent YMG.Detected result meets Mendelian inheritance than 1:1(127:140), partial detection is as shown in Figure 3.

embodiment 6: pi64gene is at the BC of YMG/LTH ₅ f ₂ detection in colony

To 47 BC coming from YMG (♂) and LTH (♀) ₅f ₂individual plant carries out the testing process described in embodiment 3.In detected 47 individual plants, mark YRT3 is utilized to detect pi64/Pi64genotype individual plant 12, pi64/Pi64mix and genotype individual plant 25, pi64/Pi64genotype individual plant 10; Utilize mark YRT4 to detect to contain pi64the individual plant of gene 25.Two pairs of Markers for Detection results are completely the same, and detected result meets Mendelian inheritance than 1:2:1 (12:25:10), and partial detection as shown in Figure 4.

embodiment 7: pi64gene is at the F of YMG/CO39 ₂ detection in colony

To 87 F coming from YMG (♂) and CO39 (♀) ₂individual plant carries out the testing process described in embodiment 3.In detected 87 individual plants, mark YRT3 is utilized to detect pi64/Pi64genotype individual plant 22, pi64/Pi64mix and genotype individual plant 52, pi64/Pi64genotype individual plant 13; Utilize mark YRT4 to detect to contain pi64the individual plant of gene 74.Two pairs of Markers for Detection results are completely corresponding, and detected result meets Mendelian inheritance than 1:2:1 (22:52:13), and partial detection as shown in Figure 5.

rILs and BC of embodiment 8:YMG/LTH ₅ f ₂ the blast resistance identification of colony

When paddy rice grew to for 3 one heart stage of leaf, utilize rice blast strain identification CH43 to 267 of YMG/LTH RILs familys and 47 BC ₅f ₂individual plant carries out the qualification of rice blast spray inoculation, compares with disease-resistant parent YMG and Susceptible parent LTH.Rice Resistance To Rice Blast measures by 0-5 level grade scale: 0-3 level is disease-resistant R, 4-5 is susceptible S.Found that, in 267 RILs familys, 127 contain pi64the family of gene all shows as disease resistance response, and all the other 140 do not contain pi64the family of gene all shows susceptible, and this is consistent with embodiment 5 Middle molecule marker detection result.47 BC ₅f ₂in individual plant, 37 performances are disease-resistant, and 10 show as susceptible, completely corresponding with embodiment 6 Middle molecule marker detection result, namely contain pi64the individual plant of gene shows as disease resistance response, does not contain pi64the individual plant performance of gene is susceptible, and partial resistance phenotypic results as shown in Figure 3 and Figure 4.Through the Resistance Identification of Pyricularia oryzae, molecule marker result and resistance result fit like a glove, and unique identification provided by the present invention is described pi64the functional molecular marker of gene can precise Identification pi64gene.

Above-described embodiment is the present invention's preferably embodiment; but embodiments of the present invention are not subject to the restriction of kind and colony in above-described embodiment; the change made under other any does not run counter to spirit of the present invention and principle, modification, substitute, combination, to simplify; all should be the substitute mode of equivalence, within the protection domain being included in this and invention.

<110> Institute of Crop Science, Chinese Academy of Agricultural Science

<120> rice blast resistance gene pi64functional molecular marker and method and application

<130> 1

<160> 4

<170> PatentIn version 3.3

 

<210> 1

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> 1

<400> 1

cctgcatggt ctggcagagt ca 22

 

<210> 2

<211> 24

<212> DNA

<213> artificial sequence

<220>

<223> 2

<400> 2

agtgaagtaa gcccaccaag gcaa 24

 

<210> 3

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> 3

<400> 3

cgcgtgccct gcaatacaaa cg 22

 

<210> 4

<211> 22

<212> DNA

<213> artificial sequence

<220>

<223> 4

<400> 4

ctccatggtc ccaagggcgg ta 22

 

<210> 5

<211> 3867

<212> DNA

<213> Oryza paddy rice ( oryza satival.)

 

<220>

<223> 5

<400> 5

atggcggagg tggtgctagc tggcttgcat ttggccgcaa ggccaatctt caagaagctc 60

cttgttgagg cttcaaccta ccttggtgtg gacatgatgt gtgagttcca tgaactggag 120

accaccatca tgccacagtt cgagctggtg attgaagaag ctgagaaggg caatcacaga 180

gccaagctgg acaaatggct caaggagctc aaagaagcct tctacaacgc tgaagacctg 240

ctggaggagc atgagtacaa catccttaag cacaaagcga agagcaatgg ttcccttggg 300

aaagattcca ctcaggcgca tgcctcttcc atcagcaata ttctgaagca gcctctgcat 360

gctgtgtcca gcaggctgtc caatctgcgc ccggagaaca gaaatctact tcgccagctg 420

aatgaactga agaccatcct tgcaaaagcc aaggagttcc gcgagctgct ttgcttacca 480

gctgttaata gtgttccgga ctccattgta ccaatacccg ttgttcctgt agccacatca 540

ctattgcccc cgagagtatt tggtcgcgat atggatcgtg atcgtataat acatcttctt 600

actgagccaa cggctgctgt ctctagctca gccggctact caggtttggc cattgttgca 660

catggaggag caggaaaatc cacattggca cagtatgttt acaatgacaa aagggtacaa 720

gaacattttg atgtcaggat gtgggtctgc atctcacgaa aacttgatgt ccgtcgtcat 780

acacgggaga ttatcgagtc agcaacaaat ggagagtgcc cttgtgtgga aaatcttgat 840

actctccagt gcagattgaa ggacatactg caaaaatctg agaaattact gcttgtgttg 900

gacgatgtct ggtttgacaa attcaacaat gaaacagaat gggaccagct acttgatcct 960

ctagtttctc tgaaagaagg gagcagagtt ctggtgactt ctagacaaga tgtacttcca 1020

gcagcacttc gctgcaagga tgtcgttcgt ttggaagaca tggaagacac tgagttcttg 1080

gctctcttca aacaccatgc gttttctgga acagaaatac aaaatccaca gctgcgtgga 1140

agactagaga agattgcaga gaagattgtt aaaaggcttg gacattctcc tttggcagca 1200

agaaccgtgg gttcccagtt gagcaggaag aaggatatca acgaatggaa aagtgctctg 1260

aatattgaaa cattaagcga gcccgtgaaa gctctattgt ggagttataa taagttagat 1320

tcacgtttgc agaggtgttt tctctactgc agcttatttc caaaaggtca taagtataaa 1380

atcaaagaga tggttgacct ttgggtagca gagggattaa ttgattcacg cagcccgggg 1440

gacaagagaa ttgaagatgt tggtagggat tacttcaatg agatggtgtc tggatctttc 1500

tttcaaccag tttctgaaag atatatgggt acatggtaca ttatgcatga tctcctgcat 1560

ggtctggcag agtcactgac taaagaagac tgcttcagat tagaagatga tggggtgaaa 1620

gagataccaa ccactgttcg acatctatct gttcgtgttg agagtatgaa attccataag 1680

caaagtatct gcaacctccg ttatttacgc acagttatct gcattgaccc actcacggat 1740

gatggagatg atgttttcaa tcagatactg aagcatctga agaagttgcg tgtactatat 1800

ttgtcatttt acaacagtag tcggttgcct gaatgtattg gtgagctgaa gcaccttcgg 1860

tatttgaata tcatcagaac attgatttct gaattgccaa gatcattatg tactctttac 1920

cacttgcagt tacttcagtt aaacaaaaag gtgaagtgtt tgcctgacaa gctgtgcaat 1980

ttaagcaagt tacgacgtct tgaagcattt gatgacagaa tagatgaatt gataaatgct 2040

gctctgcctc aaattccttt cataggaaag ctgactttgc tgcagcatat taatggattt 2100

ttcgtgcaaa agcagaaggg atatgagttg caacagctgg ggaacatgaa cgagctcggt 2160

ggtaatttgc gtgtgatgaa tcttgaaaat gttagtggaa aggatgaagc cacagagtcg 2220

aagttgcatc agaaagctcg tcttagaggt ttgcatctct cctggaatga tgtggatggc 2280

atggatgttc ctcatttgga gattctagaa ggcttgaggc cgccatctca attggatgat 2340

cttacaatcg aaggttacaa atctaccatg tacccaagct ggttacttga tggctcctat 2400

tttgagaatt tagaatcttt tatgcttgct aattgctgtg ggctaggaag cctaccaccc 2460

aataccgaga tctttaggca ctgtgtgaga cttaccctta agaatgtccc gaatatgaag 2520

acactatctt ttcttccaga aggtctcaca agcctatcaa ttgaggggtg cccactgctt 2580

gtgttcacta ctaataacga tgaactggaa caccatgatt atagggagag catcacgagg 2640

gcaaacaacc tggaaacaca acttgttttg atatgggaag tgaattccga ttcagatatt 2700

aggagcacat tgtcttccga acactcatcc atgaagaagt tgacagaatt gatggatact 2760

ggtatttcgg gaaatcttca aaccattgaa agcgctttag aaatagagag agatgaagcc 2820

ttggttaaag aagatatcat caaagtatgg ctctgttgcc acgaggagag gatgagattc 2880

atttattcaa ggaaggctgg gttgccgttg gttctaccat ctggactatg cgtactctct 2940

ctttcctcct gtagtattac agatggagct ttagctattt gccttggtgg gcttacttca 3000

cttagatatt tgttcttaac agagattatg actttaacta cgcttccacc ggaagaggtc 3060

ttccaacatt tgggcaatct tagatacttg gccattcgtt cctgctggtg tctcagatca 3120

ttcgggggct tgcgatctgc tacctctctt tcagaaataa gattattttc ctgtccttct 3180

ttacagttgg cacgtggtgc agaatttatg ccaatgtccc ttgagaagct atgtgtatac 3240

agttgtgtgc tttcagctga cttcttctgc ggtgactggc cacatctgga tgatattctc 3300

ttatctgggt gtaggagctc ggcgtccttg tatgttggtg accttacctc cctcgaatca 3360

ttctcgctat atcatttgcc agatttatgt gtgctggaag gtttgtcttc cctgcagctt 3420

caccacgtgc acttgataga tgttccaaag cttactaccg agagcatctc acagttccgc 3480

gtacagcgtt cgctctatat tagcagttcc gttatgctca accacatggt ctccgctgaa 3540

ggtttcaaag ttccagggtt tctctctctt gaaagctgca aggagccatc cgtttcattc 3600

gaagaatctg caaatttcac atccgtcaag tgcctgaggt tatgtaattg tgaaatgagg 3660

tcactaccag gaaatatgaa gtgcctatcc agtctaacga aactcgatat ctatgactgc 3720

cccaacataa catctctacc agatctgccg tcctccctcc agcatatatg tatatggggt 3780

tgtgagcttt tgaagaagag ctgcagggca cctgatggag aaagctggcc aaagattgcg 3840

catatccgct ggaaggaatt cagatgaaaa atgatag 3867

 

<210> 6

<211> 1600

<212> DNA

<213> Oryza paddy rice ( oryza satival.)

 

<220>

<221> promotor

<222> (1)..(880)

 

<220>

<221> transposon

<222> (560)..(1275)

 

<220>

<221> 5’UTR

<222> (587)..(1597)

 

<220>

<223> 6

<400> 6

 

 

tttcattagg tgcacccacc cacaagagct tgaaaatgtc tcactttctc tatgcctgtc 60

caaaaggaca tttgagaaaa catgaaatag gacggccaaa ataacactgc gacttgcata 120

ttgtggccaa acatatcaca ctttcttata tgcgtcagtt tgtagagtcc ctcctaaatt 180

tcttataagc atcagtttgt agagttctgc ctttcgcgtg ccctgcaata caaacgctcc 240

tctctggatc tggtaaccct gtactctctt agtgcttgtt tccttcacac ttctctgttt 300

aagttttcca gcctttggtg ttttcatgta ttaattcctt gtaactatat ttccccacac 360

caagcatttc cataatcatt caccgaaaaa ttaaaaaaaa atgtttcaag agttctgttg 420

tctttatttt gctcatgaaa aaaaaagtat ctttatattc agatgtgatt accacattac 480

cccattcttc cactgattga cttgttcaca gctgcacaat ctttcataat actctgaaca 540

acgttgttca aaagttatcc attggaagca ggggcggatt tactatgggg gcgggggggt 600

cttgagaccc cactaccgcc cttgggacca tggagacccc ccaaagcccc cactacaaat 660

tttcttgcat acagacatgg gatgtaggtt ctggagatcg gctagagggg aggctggagg 720

ttgaagacga agttctcgct atttgggccg gctatgaaga gcagcccacg agctcaatct 780

tccaatttta gcttggccca ctcccccaac ttgcagctca ggccagccca cagcccactc 840

cgccacttcc ccaattccca accactctct ccctgtcgcc acttccccaa tttcgccact 900

aaccctaggc agttgaccgg ccgtggacgc ggggtgggag ctgggcgggc ggtggccgac 960

gggcgacggg aggcggctga ggacacaagg aggcgaggcg gccggcgcac ggtggcgaca 1020

ctggctgacg agggcaggag gcggcgtggc ccgtggccct gtgggcgtgt ggcgagcggc 1080

aagcaggcgg gaggcggcgg cgaccggcga gccgcgagcg tgcgaggggc ccggaggtca 1140

aacggcggtc cagccccggc gcgccgacgg gaggcagcca ggcggcgaac cagcgtggcg 1200

gcggggaggt ggcgagccgc gagccggcga ggtttgttca gcccccacta ctaatttctg 1260

ctggatccgc ccctgattgg aagttccact atccctatta cacatacaaa aagaaaagca 1320

aaaacttaga tttgcatttc tcatctccag ctaaatttcc actacaccgt ttatctctgc 1380

atacctccag aaatagctct atttcctatc gttactattt catattagcc aaagtatccc 1420

agctatttgt cttgcactct cgcccatctg ttccccttct tatatccata caaaatagtt 1480

ctattctact tcctaggagc tctggttctg acgtaaaaca gaaaatatat agtaaaacat 1540

agaataccaa gaaaaggaaa aaaaattgtg ttataca atg1600

                                       

 

<210> 7

<211> 1288

<212> PRT

<213> Oryza paddy rice ( oryza satival.)

 

<400> 7

Met Ala Glu Val Val Leu Ala Gly Leu His Leu Ala Ala Arg Pro Ile

Phe Lys Lys Leu Leu Val Glu Ala Ser Thr Tyr Leu Gly Val Asp Met

Met Cys Glu Phe His Glu Leu Glu Thr Thr Ile Met Pro Gln Phe Glu

Leu Val Ile Glu Glu Ala Glu Lys Gly Asn His Arg Ala Lys Leu Asp

Lys Trp Leu Lys Glu Leu Lys Glu Ala Phe Tyr Asn Ala Glu Asp Leu

Leu Glu Glu His Glu Tyr Asn Ile Leu Lys His Lys Ala Lys Ser Asn

Gly Ser Leu Gly Lys Asp Ser Thr Gln Ala His Ala Ser Ser Ile Ser

Asn Ile Leu Lys Gln Pro Leu His Ala Val Ser Ser Arg Leu Ser Asn

Leu Arg Pro Glu Asn Arg Asn Leu Leu Arg Gln Leu Asn Glu Leu Lys

Thr Ile Leu Ala Lys Ala Lys Glu Phe Arg Glu Leu Leu Cys Leu Pro

Ala Val Asn Ser Val Pro Asp Ser Ile Val Pro Ile Pro Val Val Pro

Val Ala Thr Ser Leu Leu Pro Pro Arg Val Phe Gly Arg Asp Met Asp

Arg Asp Arg Ile Ile His Leu Leu Thr Glu Pro Thr Ala Ala Val Ser

Ser Ser Ala Gly Tyr Ser Gly Leu Ala Ile Val Ala His Gly Gly Ala

Gly Lys Ser Thr Leu Ala Gln Tyr Val Tyr Asn Asp Lys Arg Val Gln

Glu His Phe Asp Val Arg Met Trp Val Cys Ile Ser Arg Lys Leu Asp

Val Arg Arg His Thr Arg Glu Ile Ile Glu Ser Ala Thr Asn Gly Glu

Cys Pro Cys Val Glu Asn Leu Asp Thr Leu Gln Cys Arg Leu Lys Asp

Ile Leu Gln Lys Ser Glu Lys Leu Leu Leu Val Leu Asp Asp Val Trp

Phe Asp Lys Phe Asn Asn Glu Thr Glu Trp Asp Gln Leu Leu Asp Pro

Leu Val Ser Leu Lys Glu Gly Ser Arg Val Leu Val Thr Ser Arg Gln

Asp Val Leu Pro Ala Ala Leu Arg Cys Lys Asp Val Val Arg Leu Glu

Asp Met Glu Asp Thr Glu Phe Leu Ala Leu Phe Lys His His Ala Phe

Ser Gly Thr Glu Ile Gln Asn Pro Gln Leu Arg Gly Arg Leu Glu Lys

Ile Ala Glu Lys Ile Val Lys Arg Leu Gly His Ser Pro Leu Ala Ala

Arg Thr Val Gly Ser Gln Leu Ser Arg Lys Lys Asp Ile Asn Glu Trp

Lys Ser Ala Leu Asn Ile Glu Thr Leu Ser Glu Pro Val Lys Ala Leu

Leu Trp Ser Tyr Asn Lys Leu Asp Ser Arg Leu Gln Arg Cys Phe Leu

Tyr Cys Ser Leu Phe Pro Lys Gly His Lys Tyr Lys Ile Lys Glu Met

Val Asp Leu Trp Val Ala Glu Gly Leu Ile Asp Ser Arg Ser Pro Gly

Asp Lys Arg Ile Glu Asp Val Gly Arg Asp Tyr Phe Asn Glu Met Val

Ser Gly Ser Phe Phe Gln Pro Val Ser Glu Arg Tyr Met Gly Thr Trp

Tyr Ile Met His Asp Leu Leu His Gly Leu Ala Glu Ser Leu Thr Lys

Glu Asp Cys Phe Arg Leu Glu Asp Asp Gly Val Lys Glu Ile Pro Thr

Thr Val Arg His Leu Ser Val Arg Val Glu Ser Met Lys Phe His Lys

Gln Ser Ile Cys Asn Leu Arg Tyr Leu Arg Thr Val Ile Cys Ile Asp

Pro Leu Thr Asp Asp Gly Asp Asp Val Phe Asn Gln Ile Leu Lys His

Leu Lys Lys Leu Arg Val Leu Tyr Leu Ser Phe Tyr Asn Ser Ser Arg

Leu Pro Glu Cys Ile Gly Glu Leu Lys His Leu Arg Tyr Leu Asn Ile

Ile Arg Thr Leu Ile Ser Glu Leu Pro Arg Ser Leu Cys Thr Leu Tyr

His Leu Gln Leu Leu Gln Leu Asn Lys Lys Val Lys Cys Leu Pro Asp

Lys Leu Cys Asn Leu Ser Lys Leu Arg Arg Leu Glu Ala Phe Asp Asp

Arg Ile Asp Glu Leu Ile Asn Ala Ala Leu Pro Gln Ile Pro Phe Ile

Gly Lys Leu Thr Leu Leu Gln His Ile Asn Gly Phe Phe Val Gln Lys

Gln Lys Gly Tyr Glu Leu Gln Gln Leu Gly Asn Met Asn Glu Leu Gly

Gly Asn Leu Arg Val Met Asn Leu Glu Asn Val Ser Gly Lys Asp Glu

Ala Thr Glu Ser Lys Leu His Gln Lys Ala Arg Leu Arg Gly Leu His

Leu Ser Trp Asn Asp Val Asp Gly Met Asp Val Pro His Leu Glu Ile

Leu Glu Gly Leu Arg Pro Pro Ser Gln Leu Asp Asp Leu Thr Ile Glu

Gly Tyr Lys Ser Thr Met Tyr Pro Ser Trp Leu Leu Asp Gly Ser Tyr

Phe Glu Asn Leu Glu Ser Phe Met Leu Ala Asn Cys Cys Gly Leu Gly

Ser Leu Pro Pro Asn Thr Glu Ile Phe Arg His Cys Val Arg Leu Thr

Leu Lys Asn Val Pro Asn Met Lys Thr Leu Ser Phe Leu Pro Glu Gly

Leu Thr Ser Leu Ser Ile Glu Gly Cys Pro Leu Leu Val Phe Thr Thr

Asn Asn Asp Glu Leu Glu His His Asp Tyr Arg Glu Ser Ile Thr Arg

Ala Asn Asn Leu Glu Thr Gln Leu Val Leu Ile Trp Glu Val Asn Ser

Asp Ser Asp Ile Arg Ser Thr Leu Ser Ser Glu His Ser Ser Met Lys

Lys Leu Thr Glu Leu Met Asp Thr Gly Ile Ser Gly Asn Leu Gln Thr

Ile Glu Ser Ala Leu Glu Ile Glu Arg Asp Glu Ala Leu Val Lys Glu

Asp Ile Ile Lys Val Trp Leu Cys Cys His Glu Glu Arg Met Arg Phe

Ile Tyr Ser Arg Lys Ala Gly Leu Pro Leu Val Leu Pro Ser Gly Leu

Cys Val Leu Ser Leu Ser Ser Cys Ser Ile Thr Asp Gly Ala Leu Ala

Ile Cys Leu Gly Gly Leu Thr Ser Leu Arg Tyr Leu Phe Leu Thr Glu

Ile Met Thr Leu Thr Thr Leu Pro Pro Glu Glu Val Phe Gln His Leu

Gly Asn Leu Arg Tyr Leu Ala Ile Arg Ser Cys Trp Cys Leu Arg Ser

Phe Gly Gly Leu Arg Ser Ala Thr Ser Leu Ser Glu Ile Arg Leu Phe

Ser Cys Pro Ser Leu Gln Leu Ala Arg Gly Ala Glu Phe Met Pro Met

Ser Leu Glu Lys Leu Cys Val Tyr Ser Cys Val Leu Ser Ala Asp Phe

Phe Cys Gly Asp Trp Pro His Leu Asp Asp Ile Leu Leu Ser Gly Cys

Arg Ser Ser Ala Ser Leu Tyr Val Gly Asp Leu Thr Ser Leu Glu Ser

Phe Ser Leu Tyr His Leu Pro Asp Leu Cys Val Leu Glu Gly Leu Ser

Ser Leu Gln Leu His His Val His Leu Ile Asp Val Pro Lys Leu Thr

Thr Glu Ser Ile Ser Gln Phe Arg Val Gln Arg Ser Leu Tyr Ile Ser

Ser Ser Val Met Leu Asn His Met Val Ser Ala Glu Gly Phe Lys Val

Pro Gly Phe Leu Ser Leu Glu Ser Cys Lys Glu Pro Ser Val Ser Phe

Glu Glu Ser Ala Asn Phe Thr Ser Val Lys Cys Leu Arg Leu Cys Asn

Cys Glu Met Arg Ser Leu Pro Gly Asn Met Lys Cys Leu Ser Ser Leu

Thr Lys Leu Asp Ile Tyr Asp Cys Pro Asn Ile Thr Ser Leu Pro Asp

Leu Pro Ser Ser Leu Gln His Ile Cys Ile Trp Gly Cys Glu Leu Leu

Lys Lys Ser Cys Arg Ala Pro Asp Gly Glu Ser Trp Pro Lys Ile Ala

His Ile Arg Trp Lys Glu Phe Arg

 

Claims (5)

1. rice blast resistance gene pi64specific Function molecule marker YRT3, it is characterized in that: molecule marker YRT3 is by forward primer sequence and reverse primer nucleotide sequence that sequence increases out from rice total dna as shown in SEQ ID NO. 2 as shown in SEQ ID NO. 1, and through specific enzymes asei enzyme becomes 2 fragments after cutting, size is the molecule marker of the specificity banding pattern of 908 bp and 541bp;

Wherein, described paddy rice is rice varieties wool paddy (YMG);

Described rice blast resistance gene pi64aminoacid sequence as shown in SEQ ID NO. 7.

2. rice blast resistance gene according to claim 1 pi64functional molecular marker YRT3, it is characterized in that: described rice blast resistance gene pi64dNA sequence dna as shown in SEQ ID NO. 5.

3. one kind utilizes the rice blast resistance gene described in claim 1 or 2 pi64functional molecular marker YRT3 differentiate or screening containing rice blast resistance gene pi64the method of rice varieties, it is characterized in that:

With the STb gene of rice plant to be measured or kind for template, the primer pair of sequence as shown in SEQ ID NO.1 and 2 is adopted to carry out pcr amplification, if the amplified production size obtained is 1449 bp, and through specific enzymes asei enzyme becomes 2 fragments after cutting, size is 908 bp and 541bp, then rice plant to be measured or kind contain rice blast resistance gene pi64.

4. method according to claim 3, it is characterized in that: adopt the primer pair of sequence as shown in SEQ ID NO.1 and 2 to carry out pcr amplification, described pcr amplification, wherein the PCR reaction system of amplified production A is as follows: 2 × PCR Buffer for KOD FX 10 μ l, 2 mM dNTPs 4 μ l, 1 0pmol primer 1 μ l, 1 U/ μ l KOD FX enzyme 0.4 μ l, 100 ng/ μ l DNA profiling 2 μ l, add ddH ₂o to 20 μ l, amplification reaction condition: 94 DEG C of 2 min; 98 DEG C of 10 s → 59 DEG C 1.5 min → 68 DEG C 5 min, 35 circulations; 68 DEG C of 5 min, 10 DEG C of preservations.

5. the rice blast resistance gene described in claim 1 or 2 pi64the application of specific Function molecule marker YRT3, it is characterized in that: the rice blast resistance gene described in utilization pi64the application of functional molecular marker YRT3 in molecular mark, gene pyramiding breeding and transgenic breeding.