CN104711349B - With molecular labeling D4.3 and its application of spinach gender-specific genes Y close linkages - Google Patents
With molecular labeling D4.3 and its application of spinach gender-specific genes Y close linkages Download PDFInfo
- Publication number
- CN104711349B CN104711349B CN201510106692.2A CN201510106692A CN104711349B CN 104711349 B CN104711349 B CN 104711349B CN 201510106692 A CN201510106692 A CN 201510106692A CN 104711349 B CN104711349 B CN 104711349B
- Authority
- CN
- China
- Prior art keywords
- spinach
- band
- plant
- digestion
- female
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides molecular labeling D4.3 and its application with spinach gender-specific genes Y close linkages, belongs to plant molecular genetic breeding field.The present invention provide molecular labeling D4.3 in spinach female plant and staminiferous plant it is amplifiable go out 179bp band, female plant (XX) amplified band is Jing after the digestion of restriction enzyme A luI, an only band, and staminiferous plant (XY) amplified band has two band Jing after the digestion of restriction enzyme A luI.For amplifier molecule mark D4.3 primer sequence as shown in SEQ ID NO.2 3.The molecular labeling D4.3 that the present invention is provided and spinach gender-specific genes close linkage, genetic distance about 0.3cM, can carry out spinach sex identification in seedling stage, in advance spinach male and female plant is screened, breeding efficiency is greatly promoted, there is in spinach production practices, breeding important value.
Description
Technical field
The invention belongs to plant molecular genetic breeding field, and in particular to the molecule with spinach gender-specific genes Y close linkages
Mark D4.3 and its application.
Background technology
Spinach (Spinacia oleracea L.), another name Persian is careless, red root vegetables, and Li Ke spinach belongs to crop, cultivation history
It is long, it is one of important vegetable crop of China.Spinach is nutritious, and winter resistance is strong, and wide adaptability is with short production cycle, multiple cropping
Index is high, and yield and output value is high, deep to be welcome by producers and consumers.
Spinach usually dioecism crop, a small amount of plant show as monoecism.Spinach property type receives inherent cause and ring
The impact of border factor.Rosa etc. (1925) thinks that spinach property type is mainly controlled by gene, not by soil fertility, strain spacing
From the impact of the extraneous factors such as, illumination power, planting season.Nicolaisen etc. (1940) report spinach property types by external environment because
The impact of element, many staminiferous plants in barren native aerial, summer sowing female plant more than autumn sowing.Janick etc. (1955) researchs show spinach
Property type it is influenced by environmental conditions, high temperature short-day can make male strengthen female weaken, 26.6 DEG C of day temperature, 24 DEG C of night temperature compare day temperature
21 DEG C, 18 DEG C of night temperature have increase male trend；No matter temperature height, all how female than under 12h illumination under 15～18h illumination
Strain female flower, but the difference between temperature higher then length day is less.George (1985) researchs show minority Spinach Varieties
Type only receives genic control, and is not controlled by other envirment factors.Xu Yuejin etc. (1996) is to 65 Spinach Varieties
Property type performance investigated and analysed, plant population sex ration is about 1:1, but the ratio for having 1/3 kind male and female does not meet 1:1,
Further 4 kinds therein are analyzed, wherein Weifang point leaf property type performance only by gene control, and other 3
The property type of individual kind was both controlled by gene, also by Environmental Factors.
Chinese scholars generally believe that the property type heredity of spinach is main by a pair of the X and the Y gene that are present on sex chromosome
Control, in spinach plant population, sex ration is about 1:1, but may also be controlled by other genes simultaneously, propose accordingly
Different hypothesis, but also do not have one kind generally to be accepted so far.Janick etc. (1954) is through research thinking property genotype
Plant for XX shows as female plant, and to tie a small amount of or not seed bearing staminiferous plant, the plant of YY types is to tie to the plant of XY types
The staminiferous plant of seed.Janick etc. (1955,1961,1963) it is additionally considered that monoecism sex receives another gene Xm with X and Y equipotentials
Control, separately has some modifiers to affect the ratio of female flowers and male flower, i.e. monoecism proterties to be controlled by Xm genes, Xm and
X and Y are allele, and the phenotype of XmXm is synoecy and many male flowers, XmX many female flowers for synoecy, XX
For female plant (Tan Qimeng, 1980).Bemis and Wilson (1953) is through researching and proposing gunther sex-linked genic balance hypothesis, it is believed that
In addition to sex chromosome (X/Y), also there are two pairs of strong chain sexual balance Gene As a and Gg, A on autosome can make XX strain tables
It is now female both sexes strain, G can make XY strains show as male both sexes strain.When two pairs of genes be in poised state when, such as AG/AG or AG/ag or
During ag/ag, XX is pure female plant, and XY is pure staminiferous plant.But after intersection occurs, destruction of balance is exchanged, just produce both sexes strain.Bai Misi
Deng hypothesis, though can generally explain some genetic phenomenons, lack sufficient offspring checking (Tan Qimeng, 1980).
Spinach is difficult to differentiate between male and female plant in seedling stage, and when spinach only grows to peduncle-growing period for rapeseed, property type phenotype effectively could be distinguished,
Therefore to be identified and being lifted breeding efficiency earlier to spinach plants type, molecular labeling is carried out for spinach property type both at home and abroad and ground
Study carefully, obtain some molecular labelings with property type gene linkage.Akamatsu (1998) develops chain with spinach X/Y sites dividing
Son mark T11A, V20A, can be used to differentiate spinach male and female plant.Khattak etc. (2006) thinks that spinach property type is controlled by X/Y sites
System, with seven genetic linkage maps of AFLP and SSR technique construction spinach, overall length is 580cM, and between mark, average distance is
5.18cM, X/Y site is positioned in linkage group 3 in less genetic region, with SSR marker SO4 at a distance of 1.9cM.Onodera
10 AFLP marks and spinach X/Y site close linkage are screened using BSA methods Deng (2011), 4 marks are divided into Y-site
From；SSR marker T11A, V20A chain with Y-site that checking has been delivered, which is chain in Y-site；It is found that one individually
, the strong male both sexes gene of incomplete dominance, which is with X/Y sites linked marker SO4 at a distance of 4.3cM, it was demonstrated that monoecism is determined
Gene is not the allele in X/Y sites, but closely coupled with X/Y sites.The linked marker delivered both at home and abroad at present has 4
Individual, first is that T11A, V20A and spinach gender-specific genes Y are isolated, but V20A expanding effects are inadequate when jumpbogroup experience is demonstrate,proved
Stable, T11A is isolated with Y；Second is SO4, and which, is not connected when verifying in colony at a distance of 4.3cM with spinach gender-specific genes Y
Lock, develops other SSR in the genetic fragment and is analyzed, and genetic distance is about 11cM；3rd is Yang Jinhua (2009)
Analyzed by ISSR, screen a mark related to female, total length 1176bp, and be translated into SCAR mark, the mark
Note is not chain when verifying in colony.
The content of the invention
Present invention aim at providing a kind of molecular labeling with spinach gender-specific genes Y close linkages.
Another object of the present invention is to provide a kind of using molecular labeling discriminating spinach property method for distinguishing.
To realize the purpose of the present invention, first with the female plant in spinach first-filial generation commercial variety checkerberry 1 (F1) ×
Staminiferous plant builds F2 colonies, extracts the genomic DNA of 343 F2 individual plants, studies the hereditary basis of spinach gender-specific genes, using SRAP
Label screening and the chain molecular labeling of gender-specific genes, carry out cloning and sequencing to chain specific fragment, and convert it into
DCAPS is marked, and being marked in other 7 colonies of spinach using the successful dCAPS of conversion carries out male and female sex identification, molecular labeling
Qualification result is consistent with phenotypic evaluation result.
What the present invention was provided is that dCAPS marks D4.3 with the molecular labeling of spinach gender-specific genes close linkage, female in spinach
Strain and staminiferous plant in it is amplifiable go out 179bp band, female plant (XX) amplified band Jing after the digestion of restriction enzyme A luI, only
One band, and staminiferous plant (XY) amplified band has two band Jing after the digestion of restriction enzyme A luI.
Further, dCAPS of the invention mark D4.3 is obtained to amplification by following specific primer：
Upstream primer F：ACCGGAATAACGAACAGGACCGAACAGAGC, (SEQID NO.2)
Downstream primer R：GGTTAATCTTACACATGGGGTCAAGTGCGG(SEQ IDNO.3).
The invention provides the specific primer pair for detecting dCAPS molecular labeling D4.3, which is：
Upstream primer F：ACCGGAATAACGAACAGGACCGAACAGAGC, (SEQID NO.2)
Downstream primer R：GGTTAATCTTACACATGGGGTCAAGTGCGG(SEQ IDNO.3).
The invention provides the kit containing above-mentioned specific primer pair.Further, in kit of the invention, also
Containing restriction endonuclease AluI.
The invention provides applications of the molecular labeling D4.3 in spinach sex identification.
The invention provides applications of the molecular labeling D4.3 in spinach molecular mark.
The invention provides specific primer shown in SEQ ID NO.2-3 to or the reagent containing the specific primer pair
Application of the box in spinach sex identification.
The invention provides specific primer shown in SEQ ID NO.2-3 to or the reagent containing the specific primer pair
Application of the box in spinach molecular mark.
Present invention also offers a kind of identification spinach property method for distinguishing, comprises the following steps：
(1) extract the genomic DNA of spinach to be measured；
(2) genomic DNA with spinach to be measured is as template, using the specific primer shown in SEQ ID NO.2-3 to entering
Performing PCR amplified reaction；
(3) amplified production electrophoresis detection on polyacrylamide gel, has expanded the specific band of 179bp, then to amplification
After product is reclaimed, Jing restriction enzyme As luI carry out digestion, digestion have 2 bands for staminiferous plant, digestion have 1 band for female.
In said method, in step (2), 10 μ L systems of pcr amplification reaction are：2 μ L of 20-25ng/ μ L DNA, 10uM be upper,
1 μ L of each 0.2 μ L of downstream primer, 10 × PCR buffer, 0.8 μ L of 2.5mM dNTP, 0.1 μ L of Taq enzyme, ddH2O 5.7μL；
Pcr amplification reaction program is：94℃5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, totally 35 circulations；72 DEG C are prolonged
Stretch 7min.
Wherein, in step (3), on polyacrylamide gel, the condition of electrophoresis detection is 160V, 1.5h.Preferably, polypropylene
Acrylamide gel concentration is 8%.
In step (3), 10 μ L digestion systems are, 2 μ L of pcr amplification product, 0.2 μ L of AluI enzymes, 0.9 μ L of Cutsmart,
ddH2O 6.9μL；Digestion condition be 37 DEG C overnight.
The invention provides application of the above-mentioned identification spinach property method for distinguishing in spinach breeding.
The molecular labeling of the identification spinach sex that the present invention is provided can only be in peduncle-growing period for rapeseed ability area in overcoming prior art
Point spinach male and female plant and the low problem of the breeding efficiency that brings, realize just carrying out the technology effect of spinach sex identification in seedling stage
Really.By using the specific primer of present invention offer to the genomic DNA using PCR method detection spinach to be measured, amplification
DCAPS molecular labeling D4.3, in spinach female plant and staminiferous plant it is amplifiable go out 179bp band, female plant (XX) amplified band Jing
After the digestion of restriction enzyme A luI, an only band, and staminiferous plant (XY) amplified band is Jing after the digestion of restriction enzyme A luI,
There are two band, sex identification accurately can be carried out to spinach by this molecular labeling, for screening plant, spinach is greatly improved
The breeding efficiency of dish.Relative to other marks having found both at home and abroad, molecular labeling D4.3 and the spinach gender-specific genes of the present invention
Close linkage, genetic distance about 0.3cM.Molecular labeling of the present invention has very important valency in spinach production practices, breeding
Value.
Description of the drawings
Fig. 1 is female plant in spinach F2 colonies.Plant is tall and big, and growth is vigorous, and basal leaf and stem leaf are more flourishing, female flowers
It is born in the axil of stem leaf, without anthocaulus or has the anthocaulus of varying length, without petal, has 1 piece of gynoecium, 4～6, column cap, calyx 2
～4 split, and are coated with ovary；Arrow indication is female flower.
Fig. 2 is staminiferous plant in spinach F2 colonies.Plant is shorter, and basal leaf is less, stem leaf it is undeveloped or be in flakey, scape
On only give birth to male flower, male flower split without petal, calyx 4～5, and stamen number is identical with calyx；Filigree is short, flower pesticide yellow；Arrow indication is
Male flower.
Fig. 3 be D4.3 mark detection spinach sex electrophoretogram, M be marker 1, be made up of 6 DNA fragmentations, from it is lower to
On be 100 successively, 200,300,400,500,600bp；In figure, 1 represents the PCR primer electrophoretic band of 16 individual plants amplification, and front 8
It is individual for staminiferous plant, 8 is female plant afterwards；2 represent 8 staminiferous plants after digestion there are 2 electrophoretic bands；3 represent digestion after 8 female plants it is equal
There is 1 band.
Specific embodiment
Following examples further illustrate present disclosure, but should not be construed as limiting the invention.Without departing substantially from
In the case of spirit of the invention and essence, the modification made to the inventive method, step or condition or replacement belong to the present invention
Scope.
If not specializing, the conventional meanses that technological means used is well known to those skilled in the art in embodiment.
The acquisition of the molecular labeling D4.3 of embodiment 1 and spinach gender-specific genes close linkage
1st, the structure of spinach genetic group
F2 colonies are built using the female plant in spinach first-filial generation commercial variety checkerberry 1 (F1) × staminiferous plant.F2 colony head
Proterties investigation is carried out to the florescence, totally 343 plants of F2 colonies, wherein 189 plants of female plant, 154 plants of staminiferous plant, Jing Chi-square statistics meet 1：1, spinach
Dish sex is controlled by gender-specific genes X/Y.
2nd, the extraction of genomic DNA and male and female pond build
The genomic DNA of 343 F2 individual plants is extracted using CTAB methods.
In taking F2 respectively, 10 female plants, 10 staminiferous plants are built for segregating population fractional analysis (Bulk Segregating
Analysis, BSA) female, Xiong Chi, DNA detectors (NanoDrop Spectrophotometer) machine survey DNA concentration, use
Sterile purified water is diluted to identical concentration 200ng/ μ L respectively, and 10 female plants respectively take 100 μ L, and 10 staminiferous plants respectively take 100 μ L, point
Male and female gene pool (F ponds, M ponds) Hun He not be constituted
3rd, SRAP linked markers screening
(table 1) is marked using the 256 couples of SRAP for having announced, arbitrary me primers and arbitrary em primers are combined, in male and female
Enter performing PCR amplification and polymorphism screening between pond, screen 99 pairs of marks with polymorphism altogether, using the polymorphism for screening
Verified in being marked at F2 colonies, further screened 8 pairs of molecular labelings chain with gender-specific genes, wherein finding SRAP4.3
With spinach male and female gender-specific genes close linkage.
10 μ L PCR reaction systems are：2 μ L of 20-25ng/ μ L DNA, each 0.2 μ L of 10uM primer upstream and downstream, 10 × PCR
0.8 μ L of 1 μ L of buffer, 2.5mM dNTP, 0.1 μ L of Taq enzyme, ddH2O 5.7μL。
94 DEG C of 3min of PCR amplification programs；94 DEG C of 1min, 35 DEG C of 1min, 72 DEG C of 1min, totally 5 circulations；94 DEG C of 1min, 50
DEG C 1min, 72 DEG C of 1min, totally 35 circulations；72℃10min.
1 SRAP labeled primer sequences of table
4th, dCAPS marks conversion
The specific band of the SRAP linked markers SRAP4.3 amplifications to screening carries out cutting glue reclaim, cloning and sequencing sequence
As shown in SEQ ID NO.1.By SRAP4.3 amplifying specific bands sequence respectively with the spinach reference gene group sequence announced at present
Row (http://bvseq.molgen.mpg.de/index.shtml) compare.SRAP4.3 can compare spinach reference
On genome scaffold46066, according to target locations of the SRAP 4.3 in spinach reference gene group scaffold by SEQ
Sequence shown in ID NO.1 or so extends, and designs the fragment that primer (SEQ ID NO.36-37) amplifies 1614bp length, sequence
As shown in SEQ ID NO.38.Primer sequence is：F:CCTACGAAACACTCCTGACG(SEQ ID NO.36)；R:
CAACAATGGGTCCTGCCTTC(SEQ ID NO.37).Expanded in spinach male and female gene pool with above-mentioned primer, it is female to spinach
Staminiferous plant enters performing PCR amplification, cuts glue reclaim cloning and sequencing, carries out cloning and sequencing to the band of female plant amplification, chooses 5 cloning and sequencings, and 2
It is individual from female gene pond, 3 from male gene pool, female sequencing result is shown in sequence shown in SEQ ID NO.39, and male is surveyed
Sequence result is shown in SEQ ID NO.40.Sequencing result is compared, analysis finds that the two has 3 SNP, respectively positioned at SEQ ID
The T of the 1057th, the C of 1094, the T of the 1112nd in NO.39.The present invention is further according to first SNP (SEQ ID
The T of the 1057th in NO.39) dCAPS marks are designed, upstream primer-F is:ACCGGAATAACGAACAGGACCGAACAGAGC
(SEQ ID NO.2)；Downstream primer-R is:GGTTAATCTTACACATGGGGTCAAGTGCGG(SEQ ID NO.3).Jing
SRAP4.3 converts successful dCAPS marks D4.3 detection F2 colonies, and D4.3 testing results SRAP4.3 are consistent, tight with gender-specific genes
It is close chain, can be used for molecular marker assisted selection.
The application of 2 molecular labeling D4.3 of embodiment
D4.3 is marked using the dCAPS for having been converted to work(, in other 7 colonies of spinach【Colony's explanation：Spinach first-filial generation
Female plant in commercial variety spinach Fitow (F1) × staminiferous plant builds F2 colonies, and the female plant in F2 colonies × staminiferous plant builds F3 colonies, choosing
Take 4 F3 colonies therein carry out molecular labeling sex identification (i.e. experimental population numbering be respectively 48,50,52,53)；In the same manner,
Female plant × staminiferous plant in spinach first-filial generation commercial variety black strong (F1) builds F2 colonies, and the female plant in F2 colonies × staminiferous plant builds
F3 colonies, selection 3 F3 colonies therein carry out molecular labeling sex identification, and (i.e. experimental population numbering is respectively 54,58,59)】
In carry out male and female sex identification, molecular markers for identification result is consistent with phenotypic evaluation result, as a result sees Fig. 3, have result understand, this
The molecular labeling D4.3 of invention can be used for molecular marker assisted selection breeding.
Molecular labeling D4.3 identifies that spinach property method for distinguishing is：
(1) extract the genomic DNA of spinach to be measured；
(2) genomic DNA with spinach to be measured is as template, using the specific primer shown in SEQ ID NO.2-3 to entering
Performing PCR amplified reaction；
(3) amplified production electrophoresis detection on 8% polyacrylamide gel, has expanded the specific band of 179bp, then to expanding
After volume increase thing is reclaimed, Jing restriction enzyme As luI carry out digestion, digestion have 2 bands for staminiferous plant, digestion have 1 band for female
Property.
In said method, in step (2), 10 μ L systems of pcr amplification reaction are：2 μ L of 20-25ng/ μ L DNA, 10uM be upper,
1 μ L of each 0.2 μ L of downstream primer, 10 × PCR buffer, 0.8 μ L of 2.5mM dNTP, 0.1 μ L of Taq enzyme, ddH2O 5.7μL；
Pcr amplification reaction program is：94℃5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, totally 35 circulations；72 DEG C are prolonged
Stretch 7min.
In step (3), 10 μ L digestion systems are, 2 μ L of pcr amplification product, 0.2 μ L of AluI enzymes, 0.9 μ L of Cutsmart,
ddH2O 6.9μL；Digestion condition be 37 DEG C overnight.8% native polyacrylamide gel electrophoresis amplified production in step (3)
Condition is 160V, 1.5h.
The checking of 7 colonies of Jing, qualification result and field test result identical rate 100% of the mark to spinach sex,
With good using value.
27 colony's Molecular Identification results of table and field test result
| Kind | Molecular Identification result | Field test result | Kind | Molecular Identification result | Field test result |
| 48(10) | ♀ | ♀ | 48(8) | ♂ | ♂ |
| 50(5) | ♀ | ♀ | 50(8) | ♂ | ♂ |
| 52(5) | ♀ | ♀ | 52(5) | ♂ | ♂ |
| 53(9) | ♀ | ♀ | 53(11) | ♂ | ♂ |
| 54(7) | ♀ | ♀ | 54(10) | ♂ | ♂ |
| 58(10) | ♀ | ♀ | 58(3) | ♂ | ♂ |
| 59(9) | ♀ | ♀ | 59(12) | ♂ | ♂ |
Note：All variety names are given with laboratory numbering:" ♀ " represents female plant；" ♂ " represents staminiferous plant." () " is inner to be represented
Individual plant number.
The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, on the premise of without departing from the technology of the present invention principle, some improvements and modifications can also be made, these improvements and modifications
Also should be regarded as protection scope of the present invention.
Claims (7)
1. with the molecular labeling of spinach gender-specific genes Y close linkages, it is characterised in which is dCAPS mark D4.3, female in spinach
Strain and staminiferous plant in it is amplifiable go out 179bp band, female plant amplified band Jing after the digestion of restriction enzyme A luI, only one
Band, and staminiferous plant amplified band has two band Jing after the digestion of restriction enzyme A luI；
The dCAPS mark D4.3 are obtained to amplification by following specific primer：
Upstream primer F:ACCGGAATAACGAACAGGACCGAACAGAGC
Downstream primer R：GGTTAATCTTACACATGGGGTCAAGTGCGG.
2. the specific primer pair that test right requires molecular labeling described in 1 is used for, it is characterised in which is：
Upstream primer F:ACCGGAATAACGAACAGGACCGAACAGAGC,
Downstream primer R：GGTTAATCTTACACATGGGGTCAAGTGCGG.
3. the kit containing specific primer pair described in claim 2.
4. the specific primer described in claim 2 to or claim 3 described in kit in spinach sex identification should
With.
5. it is a kind of to identify spinach property method for distinguishing, it is characterised in that to comprise the following steps：
(1) extract the genomic DNA of spinach to be measured；
(2) genomic DNA with spinach to be measured is expanded to entering performing PCR as template using the specific primer described in claim 2
Reaction；
(3) amplified production electrophoresis detection on polyacrylamide gel, has expanded the specific band of 179bp, then amplified production has been returned
After receipts, Jing restriction enzyme As luI carry out digestion, digestion have 2 bands for staminiferous plant, digestion have 1 band for female.
6. method as claimed in claim 5, it is characterised in that 10 μ L systems of pcr amplification reaction are in step (2)：20-
2 μ L of 25ng/ μ L DNA, each 0.2 μ L of 10uM upstream and downstream primer, 10 × PCR buffer, 1 μ L, 0.8 μ L of 2.5mM dNTP,
0.1 μ L of Taq enzyme, ddH2O 5.7μL；
Pcr amplification reaction program is：94℃5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, totally 35 circulations；72 DEG C of extensions
7min。
7. method as claimed in claim 5, it is characterised in that 10 μ L digestion systems are in step (3), 2 μ of pcr amplification product
0.2 μ L of L, AluI enzyme, Cutsmart 0.9 μ L, ddH2O 6.9μL；Digestion condition be 37 DEG C overnight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510106692.2A CN104711349B (en) | 2015-03-11 | 2015-03-11 | With molecular labeling D4.3 and its application of spinach gender-specific genes Y close linkages |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510106692.2A CN104711349B (en) | 2015-03-11 | 2015-03-11 | With molecular labeling D4.3 and its application of spinach gender-specific genes Y close linkages |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104711349A CN104711349A (en) | 2015-06-17 |
| CN104711349B true CN104711349B (en) | 2017-03-29 |
Family
ID=53411067
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510106692.2A Active CN104711349B (en) | 2015-03-11 | 2015-03-11 | With molecular labeling D4.3 and its application of spinach gender-specific genes Y close linkages |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104711349B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110438252B (en) * | 2019-08-02 | 2022-07-08 | 中国农业科学院蔬菜花卉研究所 | Molecular marker closely linked with male and female sex of spinach and application thereof |
| CN110453003B (en) * | 2019-08-02 | 2022-06-24 | 中国农业科学院蔬菜花卉研究所 | Molecular marker closely linked with spinach leaf type character major QTL (quantitative trait loci) and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103013966B (en) * | 2012-12-20 | 2014-04-02 | 中国农业科学院蔬菜花卉研究所 | SNP (Single Nucleotide Polymorphism) marker related to bitter character of cucumber and application of SNP marker |
| CN103215289B (en) * | 2013-01-10 | 2014-06-25 | 北京市农林科学院 | Gene sequence a for causing watermelon bisexual flower development and obtaining method thereof |
| CN104293776B (en) * | 2013-07-17 | 2016-09-07 | 中国检验检疫科学研究院 | For identifying SNP marker and the application thereof of Camellia nitidissima |
-
2015
- 2015-03-11 CN CN201510106692.2A patent/CN104711349B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104711349A (en) | 2015-06-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102162011B (en) | Molecule marking method of rice blast-resisting gene | |
| CN101485283B (en) | Method for improving selection efficiency in hybrid rice breeding | |
| CN104285776B (en) | The selection of male sterile line of maize | |
| CN104711348B (en) | The molecular marker S9.5 isolated with Herba Spinaciae gender-specific genes Y and its application | |
| CN105132570B (en) | A kind of primer sets of assistantly screening anti-stripe rust wheat and its application | |
| CN104120126B (en) | SRAP molecular marker closely linked with Fructus Lycopersici esculenti male sterility gene and preparation method thereof | |
| CN102586239B (en) | Co-segregation SSR (Simple Sequence Repeat) codominant molecular marker of onion male sterility gene Ms site and application thereof | |
| CN106555001A (en) | A kind of molecular labeling of rice blast resistant gene and its application | |
| CN104711350B (en) | Molecular marker S5.7 co-separated from spinach gender gene Y and application of molecular marker S5.7 | |
| CN104711349B (en) | With molecular labeling D4.3 and its application of spinach gender-specific genes Y close linkages | |
| CN101260437B (en) | Method for screening leaf rust resisting wheat and special-purpose primer for the same | |
| CN102220318B (en) | SSR (Single Sequence Repeats) marker interlocked with high-quality cotton fibre material 0-153 high-strength fibre major-effect genes | |
| CN103866038B (en) | For detecting tobacco to the N gene-specific primer of TMV resistance to, detection method and test kit | |
| CN102433327A (en) | Molecular marker closely linked with powdery-mildew-resistant gene of wheat Tabasco | |
| CN108048599B (en) | Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application | |
| CN108531644B (en) | Molecular marker closely linked with upland cotton AS98 dwarfing character and application thereof | |
| CN104328197B (en) | Bluish dogbane expressed sequence tag microsatellite DNA mark | |
| CN109006456B (en) | Breeding method of pimento nuclear male sterile dual-purpose line | |
| CN106399498A (en) | Molecular marker assisted selection method for cauliflower flower ball pedicel length | |
| CN103468805B (en) | Marker and method for identifying cytoplasmic sterility homozygous restorer line of Gossypium harknessii | |
| CN105803083A (en) | Molecular marker of pear fruit single fruit weight main-effect QTL (quantitative trait loci) site MSF, and application thereof | |
| CN105331689A (en) | Breeding method and molecular marker of wheat-elytrigia elongata powdery-mildew-resisting translocation line | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| CN104560961A (en) | Molecular markers linked to ZYMV (zucchini yellow mosaic virus-1) dominant disease-resistant gene ZYMV-1 and application of molecular markers | |
| CN107746895A (en) | It is a kind of it is low-phosphorous under the conditions of lifted barley harvest index QTL site molecular labeling and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |