CN104711198A - Penicillium ochrochloron and its application in preparation of brefeldin A - Google Patents
Penicillium ochrochloron and its application in preparation of brefeldin A Download PDFInfo
- Publication number
- CN104711198A CN104711198A CN201510058289.7A CN201510058289A CN104711198A CN 104711198 A CN104711198 A CN 104711198A CN 201510058289 A CN201510058289 A CN 201510058289A CN 104711198 A CN104711198 A CN 104711198A
- Authority
- CN
- China
- Prior art keywords
- bfa
- fermentation
- brefeldin
- green ochre
- ochre mould
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/80—Penicillium
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/08—Oxygen as only ring hetero atoms containing a hetero ring of at least seven ring members, e.g. zearalenone, macrolide aglycons
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical filed of microbes, and concretely relates to Penicillium ochrochloron and its application in the preparation of brefeldin A. A technical problem to be solved in the invention is providing a new choice for production of BFA through biological fermentation. A bacterial strain produced in the invention is Penicillium ochrochloron SWUKD4.211, and has a preservation number of CCTCC M2015022. The invention also provides a method for producing the BFA by adopting Penicillium ochrochloron fermentation. The BFA production ability of the bacterial strain obtained through the method can reach 356.0mg/L, and the method provides a new choice for the production of the BFA, provides a precisou strain for biological pharmacy, and has great application values.
Description
Technical field
The invention belongs to microbial technology field, be specifically related to green ochre mould and the application in preparation brefeldin A thereof.
Background technology
Brefeldin A (mine-laying luxuriant and rich with fragrance DS rhzomorph A, is called for short BFA) is a kind of naturally occurring macrolide antibiotics, chemical name [(1R, 2E, 6S, 10E, 11as, 14aR)-1,6,7,8,9,11a, 12,13,14,14a-Decahydro-1,13-dihydroxy-6-methyl-4H-cyclopent [f] oxacyclotridecin-4-one], molecular formula is C
16h
24o
4, molecular weight is 280, and structural formula is as follows:
Singleton equals to be separated the earliest from Penicillium decumben for 1958 and obtains BFA, but is named as decumbin.According to their research report, BFA be also proved to be to mouse and goldfish poisonous.1962, Betina etc. isolated compound cyanein (cyanein) from Penicillium cyaneum.They find that this compound can suppress the growth of Candida albicans, yeast saccharomyces cerevisiae and human cervix cancer cells.Wherein, suppress to increase concentration GI to average half of human cervix cancer cells's growth
50for 10nM.Along with the progressively establishment of time lapse and structure, investigators found that decumbin and cyanein was same compound in fact afterwards, and were brefeldin A (being called for short BFA) by its Uniform Name.A series of research finds: BFA decomposes by induction golgi body, thus arrestin matter is transported to Golgi Complex by endoplasmic reticulum, has the multiple biological activitys such as antimycotic, antiviral, antitumor, antimitotic, nematicide.Due to the impact on protein transport, the course of processing, so BFA has become a kind of important molecule instrument that biologist studies mammalian cell signal transduction path.
A series of research has been found that: BFA decomposes by induction golgi body, and arrestin matter, by the transport process of endoplasmic reticulum to Golgi Complex, has the multiple biological activitys such as antimycotic, antiviral, antitumor, antimitotic, nematicide.Because BFA affects protein transport, the course of processing, result BFA has become a kind of important molecule instrument that biologist studies mammalian cell signal transduction path.In addition, tumor research institute of the U.S. (NCI) staff also finds that when antitumor in-vitro screening BFA can the differentiation of inducing tumor cell and apoptosis, is used for oncotherapy has broad application prospects as hemotherapy reagent.In view of multiple biological activity and the potential pharmaceutical use of BFA, the work of research and development BFA has been subjected to increasing attention.But medicine source has become the main limiting factor that BFA develops patent medicine.
According to existing bibliographical information, we find that the bacterial strains such as Penicillium decumbens (Penicillium decunbens), mine-laying penicillium (Eupenicillium brefeldianum), clover Phoma sp (Phoma medicaginis), clover phyllosticta (Phyllosticta medicaginis), Alternaria zinniae (Alternaria zinniae) and excellent aspergillus (Aspergillus clavatus) all can ferment and produce BFA at present.But these bacterial strains can only produce a small amount of BFA mostly, production requirement can not be met.However, for providing more BFA to carry out the research of medicine source, American scientist provided the production technique that the fermentation of clover phyllosticta produces BFA in 1975, and had applied for Patents (patent No. U.S.3896002).Nineteen ninety-five, McCloud etc. have carried out correlative study to mine-laying penicillium ATCC 58665 fermentative production BFA.2005, China scientist Liu Wanyun etc. also reported the Penicillium fungi SHZK-15 that BFA is produced in a strain, but the output obtained is only 151.6mg/L fermented liquid.2009, Zheng Yuguo etc. also studied Eupenicillium brefeldianum variety ZJB 082702 in fermentation for the application in BFA, result application issued patents (patent No. CN 101445784A).These above researchs are all that the suitability for industrialized production of BFA provides possibility, but due to these bacterial classifications easily degenerate, fermentation level generally on the low side, by product is more, be difficult to meet growing merchandized handling requirement.Therefore, if the new strains of BFA good quality and high output can be found, new selection must be provided for the production of BFA, for bio-pharmaceuticals provides valuable microorganism resource.
Summary of the invention
The technical problem to be solved in the present invention is for biological fermentative production BFA provides a kind of new selection.
Technical scheme of the present invention is a strain green ochre mould Penicillium ochrochloron SWUKD4.211, and this bacterial strain is preserved in China typical culture collection center, address: Wuhan, China Wuhan University, 430072; Preservation date: on January 8th, 2015; Preserving number: CCTCC M 2015022.
Concrete, the nucleotide sequence of the 5.8s rDNA of this bacterium is as shown in SEQ ID No.1.
Concrete, the mycology feature of this bacterial strain is as follows: mycelium is comparatively thin, and diameter 0.5 ~ 2.0 μm, has tabula; Conidiophore Dan Sheng, has tabula, and top is without the top capsule expanded, and penicillus does not disperse, and stigma does not make lanceolar; Conidium is concatenated in stigma top, spherical in shape or sub-spherical, diameter 1.6 ~ 2.8 μm.
Present invention also offers the method for the green ochre mould fermentative production BFA described in employing, comprise the steps: fermention medium green ochre mould SWUKD4.211 being seeded to green ochre mould, fermentation rotating speed 130 ~ 210rpm, 26 ~ 30 DEG C of fermentations 5 ~ 9 days, fermentation liquor extracting and separating obtains secondary metabolite BFA.
Concrete, described fermention medium is composed as follows: potato 200.0g/L, carbon source 20.0 ~ 40.0g/L, calcium carbonate 2.0 ~ 8.0g/L, ammonium sulfate 0.0 ~ 2.0g/L, copper sulfate 0.0 ~ 0.02g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L; PH5.0 ~ 7.0; Wherein, described carbon source is at least one in wood sugar, glucose, sucrose, maltose or Zulkovsky starch.
Preferably, described medium component is potato 200g/L, maltose 20.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 8.0g/L, copper sulfate 0.01g/L, and the pH of substratum is 7.
Concrete, described separating technology is as follows: fermented liquid is centrifugal, collects supernatant liquor, after ethyl acetate fully extracts supernatant liquor, collect extraction phase, ethyl acetate is reclaimed in underpressure distillation, the crude extract dissolve with methanol obtained, and filters, lower than crystallization on the hot-plate of 60 DEG C, recrystallization, the colourless prismatic crystal obtained, is BFA.
Preferably, described fermentation rotating speed is 170rpm.
Preferably, described leavening temperature is 28 DEG C.
Preferably, described fermentation time is 9 days.
Present invention also offers described green ochre mould and produce the purposes in BFA.
Bacterial strain of the present invention is the plant from being collected in Maguan County, Yunnan Province---be separated the endogenetic fungus obtained Kadsura angustifolia (Kadsura angustifolia).
In the present invention, green ochre mould SWUKD4.211 fermentation process that is standby and extraction BFA is as follows:
Configuration substratum: the bacterial classification green ochre mould SWUKD4.211 be stored on PDA slant medium is inoculated on solid PDA flat board, the dull and stereotyped preparation procedure of solid PDA: take 200.0g peeled potatoes, cut fritter, add water boil 30 minutes, 4 layers of filtered through gauze, 20.0g glucose, 15.0g agar is added in filtrate, be settled to 1000.0mL, dividing after by boiling of agar is filled in 500mL Erlenmeyer flask, 121 DEG C of sterilizings 20 minutes, divide sterilized PDA substratum under sterile state and are filled in aseptic flat board.
Green ochre mould SWUKD4.11 is seeded on PDA flat board and activates, and cultivates 10 days at 28 DEG C, makes solid seed dull and stereotyped.Inoculate the activation green ochre mould SWUKD4.211 of a certain amount of (punch tool diameter 6.0mm) in fermention medium, substratum final concentration forms: potato 200.0g/L, carbon source 20.0g/L, ammonium sulfate 0.0 ~ 2.0g/L, copper sulfate 0.0 ~ 0.02g/L, calcium carbonate 2.0 ~ 8.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, pH value 5.0 ~ 7.0,121 DEG C of autoclavings 20 minutes; Wherein, described carbon source can use the degradable carbohydrate of any one, such as, in wood sugar, glucose, sucrose, maltose, Zulkovsky starch etc. one or more, but total consumption is no more than 40.0g/L.The bottling amount of fermention medium is 100mL/250mL triangular flask (including 2 diameters is the granulated glass sphere of 4mm), cultivates 5 ~ 9 days at 26 ~ 30 DEG C.
After fermentation ends, fermented liquid is centrifugal, collect supernatant liquor, and with isopyknic extraction into ethyl acetate with it 3 times, collection extraction phase, ethyl acetate is reclaimed in underpressure distillation, the crude extract dissolve with methanol obtained, filters, lower than crystallization on the hot-plate of 60 DEG C, recrystallization, obtains the BFA crystal of colourless prismatic.
In fermented liquid, BFA concentration uses efficient liquid phase chromatographic analysis: after fermented liquid is centrifugal, pipette 50.0mL supernatant liquor in 250mL separating funnel, add 50ml extraction into ethyl acetate 3 times, collect extraction phase, ethyl acetate is reclaimed in underpressure distillation, and the crude extract dissolve with methanol obtained also is settled to 25ml.0.22 μm of filtering with microporous membrane solution, filtrate adopts Japanese Shimadzu HPLC to analyze, and analysis condition is: chromatographic column, the reverse post of 250mm × 4.6mm Shim-pack VP-ODS C18; Moving phase adopts Jia Chun ︰ water (65 ︰ 35, v/v), flow velocity 0.6mL/min; Sample size is 5.0 μ L, and after post, effluent detects through UV, and determined wavelength is 230nm.
Beneficial effect of the present invention: the invention provides the green ochre mould that a plant height produces BFA.The ability that this bacterial strain produces green ochre mould can reach 356.0mg/L fermented liquid, and the production for BFA provides new selection, for bio-pharmaceuticals provides valuable microorganism resource, has great using value.
Green ochre mould Penicillium ochrochloron SWUKD4.211 provided by the invention, this bacterial strain is preserved in China typical culture collection center, address: Wuhan, China Wuhan University, 430072; Preservation date: on January 8th, 2015; Preserving number: CCTCC M 2015022.
Accompanying drawing explanation
Fig. 1 is the colonial morphology qualification of bacterial strain SWUKD4.211 on different culture media.
Fig. 2 is the light micrograph (× 600) of bacterial strain SWUKD4.211 sclerotium
Fig. 3 is the light micrograph (× 600) of bacterial strain SWUKD4.211.
Embodiment
The separation of embodiment 1 bacterial strain
(1) bacterial screening: the fritter plant sample of collection being cut into after surface sterilization long 0.5cm, is seeded to the dull and stereotyped central authorities of PDA containing 60 μ g/mL Streptomycin sulphates and 100 μ g/mL penbritins.Cultivate 2 ~ 15 days for 28 DEG C, Tip Splitting picking method is adopted in time single bacterial strain to be forwarded to fresh PDA substratum, and then repeat picking hypha separation, until be pure growth, the purifying bacterial strain obtained is numbered, and to be forwarded in fermention medium (substratum forms: potato 200g/L, glucose 20g/L), 28 DEG C, 150rpm shaking culture 15 days.Fermented liquid is centrifugal, collects supernatant liquor, and with 100mL extraction into ethyl acetate 3 times, collect extraction phase, ethyl acetate is reclaimed in underpressure distillation, the crude extract dissolve with methanol obtained, thin-layer chromatography (Thin Layer Chromatography is called for short TLC) is analyzed.Result shows that the crude extract composition of bacterial strain SWUKD4.211 is single, is mainly a kind of compound.Colourless prismatic crystal can be obtained after re-crystallization, prove that this compound is BFA through Spectrum Analysis.
Physico-chemical property and the spectrum analysis test data of BFA are as follows: BFA crystal is prismatic, colourless, is soluble in methyl alcohol, acetone, ethyl acetate, water insoluble, chloroform, sherwood oil.Infrared spectrogram shows: sample is at 3366cm
-1there is strong-OH stretching vibration absorption peak at place, at 1712cm
-1, 1644cm
-1, 1257cm
-1the charateristic avsorption band that place occurs corresponds respectively to C=O, C=C, C-O stretching vibration.
13c-NMR spectrum (DMSO) discloses this compound 16 carbon signal: C16 (δ 21.16), C13 (δ 26.92), C12 (δ 31.94), C14 (δ 33.91), C6 (δ 41.42), C8 (δ 43.56), C9 (δ 43.83), C5 (δ 52.2), C7 (δ 71.00), C15 (δ 71.32), C4 (δ 74.83), C2 (δ 116.76), C11 (δ 129.68), C10 (δ 137.61), C3 (δ 154.81), C1 (δ 166.14)
1h-NMR spectrum (DMSO) discloses this compound 24 hydrogen signals, and degree of unsaturation is 5.Sample crystallization HPLC stratographic analysis, has the simple spike that main at retention time 16.01 minutes places, this single elution peak mass spectroscopy display, this compound has 2 kinds of quasi-molecular ion peaks 303.2 [M+Na]
+, 583.3 [2M+Na]
+.Therefore, the calculating molecular weight of compound is 280.To sum up, the compound obtained is BFA, and its molecular structural formula is as follows:
(2) strain identification:
The feature of this bacterial strain is as follows:
Colonial morphology: bacterial strain SWUKD4.211 is well-grown (see table 1, seeing Fig. 1) on solid PDA, Cha Shi, Ma Dingshi, Sharpe, Radix Dauci Sativae substratum.Compared with other several substratum, the growth of its mycelia on solid Radix Dauci Sativae substratum is so inflourishing, and comparatively early produces spore, and this may illustrate that Radix Dauci Sativae substratum can be used as the product spore substratum of bacterial strain SWUKD4.211.On PDA substratum, mycelium is high-visible, and flora is intensive; Bacterium colony is fine hair shape, villous edge; Bacterium colony is in early days in white, and occur yellow-green colour afterwards, later stage bacterium colony becomes canescence, and produces (see Fig. 2) with grey sclerotium; Bacterium colony corrugationless, opaque, without water white transparency transudate, do not synthesize water colo(u)r; The back side except center is bordering on orange red except, rest part near-white, cultivates settlement diameter after 5 days and is about 4.5cm.In addition, SWUKD4.211 is inoculated in respectively using when Mierocrystalline cellulose, pectin are on the Cha Shi substratum of sole carbon source, bacterial strain can normal growth, this just illustrates that SWUKD4.211 has the ability of hydrocellulose and pectin, and when pectin is as sole carbon source, bacterial strain can better, faster grow.Microscopic examination finds, mycelium comparatively thin (diameter 0.5 ~ 2.0 μm), has tabula; Conidiophore Dan Sheng, has tabula, and top is without the top capsule expanded, and penicillus does not disperse, and stigma does not make lanceolar; Conidium is concatenated in stigma top, spherical in shape or sub-spherical, diameter 1.6 ~ 2.8 μm (see Fig. 3).
The colony diameter change of table 1P.ochrochloron SWUKD4.211 on solid medium
ITS sequence is analyzed: with the STb gene of the bacterial strain SWUKD4.211 cell extracted for masterplate, utilize primer I TS1 (SEQ ID No.2,5'-TCCGTAGGTGAACCTGCGG-3') with ITS4 (SEQ ID No.3,5'-TCCTCCGCTTATTGATATGC-3') increase the ITS1-5.8S-ITS2rDNA of aimed strain, through order-checking, PCR primer confirms that the physical length of this fragment is 560bp.Now in ncbi database, carry out the discovery of ITS sequence similarity analysis with blast, the homology of this bacterium and green ochre mould (Penicillium ochrochloron) LP74 is the highest (homology, 99%, based on ITS).
The 5.8S rDNA (SEQ ID No.1) of bacterial strain SWUKD4.211 is as follows:
GGTTTCGGAGCGAGGACTCTGGGTCCACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTCCGGCCGCCGGGGGGCATCCGCCCCCGGGCCCGCGCCCGCCGAAGACACCATTGAACGCTGTCTGAAGAATGCAGTCTGAGCGATTAGCTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGCCCCCCGGCTACCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
Comprehensive above-mentioned qualification result, bacterial strain SWUKD4.211 is green ochre mould (Penicillium ochrochloron).
The different C source of embodiment 2 is on the impact of green ochre mould SWUKD4.211 fermentation for BFA
In order to investigate the different C source of substratum to the impact of BFA fermentation level, devise 5 kinds of different fermention mediums, its bottling amount is 100mL/250mL triangular flask (including 2 diameters is the granulated glass sphere of 4mm), and fermention medium composition is respectively:
Culture medium A: potato 200.0g/L, wood sugar 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, pH=6;
Substratum B: potato 200.0g/L, glucose 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, pH=6;
Culture medium C: potato 200.0g/L, sucrose 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, pH=6;
Substratum D: potato 200.0g/L, maltose 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, pH=6;
Substratum E: potato 200.0g/L, Zulkovsky starch 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, pH=6.
Fermention medium all sterilizings 20 minutes at 121 DEG C.The bottling amount of fermention medium is 100mL/250mL triangular flask, gets a certain amount of activated strains transfer in 5 kinds of fermention mediums under aseptic condition with punch tool (diameter 6mm), 28 DEG C, cultivate 7 days under 150rpm condition.
After fermentation ends, fermented liquid is centrifugal, pipettes 50mL supernatant liquor, adds 50mL ethyl acetate, extracts 3 times under room temperature, collects extraction phase, and ethyl acetate is reclaimed in underpressure distillation, and the crude extract dissolve with methanol obtained also is settled to 25ml.0.22 μm of filtering with microporous membrane solution, filtrate adopts Japanese Shimadzu HPLC to analyze, and analysis condition is: chromatographic column, the reverse post of 250mm × 4.6mm Shim-pack VP-ODS C18; Moving phase adopts methyl alcohol: water (65:35, v/v), flow velocity 0.6mL/min; Sample size is 5.0 μ L, and after post, effluent detects through UV, and determined wavelength is 230nm.In fermented liquid A, B, C, D, E, the concentration of BFA is respectively 84.3mg/L, 78.9mg/L, 82.8mg/L, 87.4mg/L, 106.0mg/L.
Embodiment 3 different rotating speeds is on the impact of green ochre mould SWUKD4.211 fermentation for BFA
In order to investigate the impact of rotating speed on BFA fermentation level, devise 3 kinds of different shaking speed, the bottling amount of fermention medium is 100mL/250mL triangular flask (including 2 diameters is the granulated glass sphere of 4mm), and fermention medium consists of: potato 200.0g/L, glucose 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, pH=6, sterilizing 20 minutes at 121 DEG C.
The bottling amount of fermention medium is 100mL/250mL triangular flask, getting a certain amount of activated strains with punch tool (diameter 6mm) under aseptic condition transfers in fermention medium, is placed in 130rpm, 150rpm, 170rpm shaking table respectively and cultivates 7 days under 28 DEG C of conditions.After fermentation ends, fermentation liquor pre-treatment, HPLC analyze, and in 130rpm, 150rpm, 170rpm culture temperature bottom fermentation liquid, the concentration of BFA is respectively 19.2mg/L, 78.9mg/L, 109.6mg/L.
The initial pH of embodiment 4 different culture media is on the impact of green ochre mould SWUKD4.211 fermentation for BFA
In order to investigate the initial pH of substratum to the impact of BFA fermentation level, devise 3 kinds of different initial pH of substratum, fermention medium bottling amount is 100mL/250mL triangular flask (including 2 diameters is the granulated glass sphere of 4mm), and fermention medium consists of: potato 200.0g/L, glucose 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, and pH value is respectively 5,6,7, sterilizing 20 minutes at 121 DEG C.
The bottling amount of fermention medium is 100mL/250mL triangular flask, gets a certain amount of activated strains transfer in fermention medium under aseptic condition with punch tool (diameter 6mm), 28 DEG C, cultivate 7 days under 150rpm condition.
After fermentation ends, fermentation liquor pre-treatment, HPLC analyze, and in 5,6,7 substratum initial pH bottom fermentation liquid, the concentration of BFA is respectively 58.7mg/L, 78.9mg/L, 155.4mg/L.
Embodiment 5 different fermentations temperature is on the impact of green ochre mould SWUKD4.211 fermentation for BFA
In order to investigate the impact of leavening temperature on BFA fermentation level, devise 3 kinds of different leavening temperatures, fermention medium bottling amount is 100mL/250mL triangular flask (including 2 diameters is the granulated glass sphere of 4mm), and fermention medium consists of: potato 200.0g/L, glucose 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, pH=6, sterilizing 20 minutes at 121 DEG C.
The bottling amount of fermention medium is 100mL/250mL triangular flask, getting a certain amount of activated strains with punch tool (diameter 6mm) under aseptic condition transfers in fermention medium, is placed in 26 DEG C, 28 DEG C, 30 DEG C shaking tables respectively and cultivates 7 days under 150rpm condition.
After fermentation ends, fermentation liquor pre-treatment, HPLC analyze, and in 26 DEG C, 28 DEG C, 30 DEG C leavening temperature bottom fermentation liquid, the concentration of BFA is respectively 62.7mg/L, 113.4mg/L, 52.3mg/L.
The embodiment 6 different fermentations time is on the impact of green ochre mould SWUKD4.211 fermentation for BFA
In order to investigate the impact of fermentation time on BFA fermentation level, devise 5 kinds of different fermentation times, fermention medium bottling amount is 100mL/250mL triangular flask (including 2 diameters is the granulated glass sphere of 4mm), and fermention medium consists of: potato 200.0g/L, glucose 20.0g/L, ammonium sulfate 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 5.0g/L, solvent is distilled water, pH=6, sterilizing 20 minutes at 121 DEG C.
The bottling amount of fermention medium is 100mL/250mL triangular flask, gets a certain amount of activated strains transfer in fermention medium under aseptic condition with punch tool (diameter 6mm), 28 DEG C, cultivate 5,6,7,8,9 days respectively under 150rpm condition.
After fermentation ends, fermentation liquor pre-treatment, HPLC analyze, and in 5,6,7,8,9 days fermentation time bottom fermentation liquid, the concentration of BFA is respectively 89.8mg/L, 100.8mg/L, 113.4mg/L, 160.3mg/L, 218.0mg/L.
Embodiment 7 different fermentations nutrient media components is on the impact of green ochre mould SWUKD4.211 fermentation for BFA
In order to investigate the impact of different fermentations nutrient media components on BFA fermentation level, the result in conjunction with the embodiments in 2 ~ 6, designs 4 factor 3 horizontal quadratures experiment (see table 2).Fermention medium bottling amount is 100mL/250mL triangular flask (including 2 diameters is the granulated glass sphere of 4mm), fermention medium consists of: potato 200.0g/L, carbon source 20.0g/L, ammonium sulfate 0.0 ~ 2.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 2.0 ~ 8.0g/L, copper sulfate 0.0 ~ 0.02g/L, solvent is distilled water, pH=7.0, sterilizing 20 minutes at 121 DEG C; Wherein, described carbon source all can use one or more in wood sugar, glucose, sucrose, maltose and Zulkovsky starch, but total consumption is no more than 20.0g/L.
The bottling amount of fermention medium is 100mL/250mL triangular flask, gets a certain amount of activated strains transfer in fermention medium under aseptic condition with punch tool (diameter 6mm), 28 DEG C, cultivate 9 days under 170rpm condition.
After fermentation ends, fermentation liquor pre-treatment, HPLC analyze, and in different culture media component bottom fermentation liquid, the concentration of BFA is in table 2.
Table 2 green ochre mould SWUKD4211 fermentation is for BFA orthogonal experiments
As shown in Table 2, best BFA fermentation condition is: substratum includes potato 200g/L, maltose 20.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 8.0g/L, copper sulfate 0.01g/L, solvent is distilled water, pH=7.0, bottling amount is 100mL/250mL triangular flask, 28 DEG C, cultivate 9 days under 170rpm condition.Now, the production peak of BFA can reach 356.0mg/L.
Claims (11)
1. a strain green ochre mould Penicillium ochrochloron SWUKD4.211, preserving number is CCTCC M 2015022.
2. green ochre mould as claimed in claim 1, is characterized in that: mycelium is comparatively thin, and diameter 0.5 ~ 2.0 μm, has tabula; Conidiophore Dan Sheng, has tabula, and top is without the top capsule expanded, and penicillus does not disperse, and stigma does not make lanceolar; Conidium is concatenated in stigma top, spherical in shape or sub-spherical, diameter 1.6 ~ 2.8 μm.
3. green ochre mould as claimed in claim 1 or 2, is characterized in that: the nucleotide sequence of the 5.8s rDNA of this bacterium is as shown in SEQ ID No.1.
4. adopt the method for the green ochre mould fermentative production brefeldin A described in any one of claims 1 to 3, it is characterized in that: green ochre mould SWUKD4.211 is seeded to the fermention medium being applicable to green ochre mould, 130 ~ 210rpm, 26 ~ 30 DEG C fermentation 5 ~ 9 days, after fermentation ends, fermentation liquor separation and purification obtains described secondary metabolite brefeldin A.
5. method as claimed in claim 4, it is characterized in that, described fermention medium is composed as follows: potato 200.0g/L, carbon source 20.0 ~ 40.0g/L, calcium carbonate 2.0 ~ 8.0g/L, ammonium sulfate 0.0 ~ 2.0g/L, copper sulfate 0.0 ~ 0.02g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L; PH5.0 ~ 7.0; Wherein, described carbon source is at least one in wood sugar, glucose, sucrose, maltose or Zulkovsky starch.
6. method as claimed in claim 5, is characterized in that: described medium component is: potato 200g/L, maltose 20.0g/L, potassium primary phosphate 1.0g/L, magnesium sulfate heptahydrate 2.0g/L, calcium carbonate 8.0g/L, copper sulfate 0.01g/L; The pH of substratum is 7.
7. the method as described in any one of claim 4 ~ 6, is characterized in that: described fermentation rotating speed is 170rpm.
8. the method as described in any one of claim 4 ~ 7, is characterized in that: described leavening temperature is 28 DEG C.
9. the method as described in any one of claim 4 ~ 8, is characterized in that: described fermentation time is 9 days.
10. the method as described in any one of claim 4 ~ 9, it is characterized in that described separating technology is as follows: fermented liquid is centrifugal, collect supernatant liquor, after ethyl acetate fully extracts supernatant liquor, collect extraction phase, ethyl acetate is reclaimed in underpressure distillation, the crude extract dissolve with methanol obtained, and filters, lower than crystallization on the hot-plate of 60 DEG C, recrystallization, the colourless prismatic crystal obtained, is brefeldin A.
Green ochre mould described in 11. any one of claims 1 to 3 is producing the purposes in brefeldin A.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510058289.7A CN104711198A (en) | 2015-02-04 | 2015-02-04 | Penicillium ochrochloron and its application in preparation of brefeldin A |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510058289.7A CN104711198A (en) | 2015-02-04 | 2015-02-04 | Penicillium ochrochloron and its application in preparation of brefeldin A |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104711198A true CN104711198A (en) | 2015-06-17 |
Family
ID=53410918
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510058289.7A Pending CN104711198A (en) | 2015-02-04 | 2015-02-04 | Penicillium ochrochloron and its application in preparation of brefeldin A |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104711198A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109136101A (en) * | 2018-09-07 | 2019-01-04 | 重庆太极医药研究院有限公司 | A kind of fungal bacterial strain and application |
| CN114874915A (en) * | 2022-01-24 | 2022-08-09 | 中国人民解放军陆军军医大学 | Corydalis mauritiana endophytic fungus for producing brefeldin A and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445784A (en) * | 2008-12-31 | 2009-06-03 | 浙江工业大学 | Eupenicillium brefeldianum variety ZJB082702 and application thereof in preparation of Brefeldin A by fermentation |
-
2015
- 2015-02-04 CN CN201510058289.7A patent/CN104711198A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445784A (en) * | 2008-12-31 | 2009-06-03 | 浙江工业大学 | Eupenicillium brefeldianum variety ZJB082702 and application thereof in preparation of Brefeldin A by fermentation |
Non-Patent Citations (4)
| Title |
|---|
| HUANG, Q等: "Penicillium brefeldianum strain SWUKD2.0810 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence", 《GENBANK DATABASE》 * |
| QIAN HUANG等: "Diversity and biotransformative potential of endophytic fungi associated with the medicinal plant Kadsura angustifolia", 《RESEARCH IN MICROBIOLOGY》 * |
| 吴烨飞等: "Eupenicillium brefeldianum CCTCC M 208113发酵液中布雷菲德菌素A分离纯化工艺的研究", 《中国抗生素杂志》 * |
| 薛锋等: "新型抗肿瘤抗生素布雷菲德菌素A的研究进展", 《科技通报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109136101A (en) * | 2018-09-07 | 2019-01-04 | 重庆太极医药研究院有限公司 | A kind of fungal bacterial strain and application |
| CN109136101B (en) * | 2018-09-07 | 2021-06-04 | 重庆太极医药研究院有限公司 | Fungus strain and application thereof |
| CN114874915A (en) * | 2022-01-24 | 2022-08-09 | 中国人民解放军陆军军医大学 | Corydalis mauritiana endophytic fungus for producing brefeldin A and application thereof |
| CN114874915B (en) * | 2022-01-24 | 2023-06-23 | 中国人民解放军陆军军医大学 | Cordycepin A-producing endophytic fungus and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101445784B (en) | Eupenicillium brefeldianum variety ZJB082702 and application thereof in preparation of Brefeldin A by fermentation | |
| CN102154116B (en) | Endophytic fungus Phomopsis sp. and use thereof | |
| CN102807956B (en) | Ceriporia lacerata strain and application thereof | |
| CN108504594A (en) | One plant of quasi- application without mycolic acids bacterium and its in preparing anti-notoginseng root rot agent | |
| CN106047713A (en) | Talaromyces pinophilum strain Li-93 and application thereof | |
| CN102732427A (en) | Separation method of swainsonine-producing endophytic fungi in glabrous crazyweed | |
| CN108823110B (en) | Strain for producing griseofulvin and application thereof | |
| CN103205365B (en) | Aspergillus tubingensis and application thereof to preparation of ginsenoside Rh4 and aglycone of ginsenoside Rh4 | |
| CN108841889B (en) | Method for producing griseofulvin serving as major component of tranexamycin by microbial fermentation | |
| CN101126102A (en) | Marine actinomycetes for generating antineoplastic compound Norharmane | |
| CN108315265B (en) | Aspergillus versicolor Av-2 strain and application thereof | |
| CN104711198A (en) | Penicillium ochrochloron and its application in preparation of brefeldin A | |
| CN103992953A (en) | Dongxiang wild rice endophytic fungus strain capable of transforming glycyrrhizic acid to produce glycyrrhetinic acid monoglucuronide | |
| CN109182216B (en) | Marine streptomyces SCFJ-05 with inhibition effect on succulent plant stem rot | |
| CN103805543B (en) | A kind of bacterial strain and application thereof producing herbimycin | |
| CN105821100A (en) | Technology for realizing high-yield polyoxins by continuous fermentation coupled with separation | |
| CN102911877B (en) | Marine fungi cladosporium sphaerospermum and application thereof | |
| CN106085880B (en) | A kind of separation method and used medium of smut | |
| CN106479900B (en) | High yield monascus purpureus penicillium oxalicum Po-25 bacterial strain and application thereof | |
| CN108085273A (en) | One plant of streptomyces antifungus and its metabolin, metabolin preparation method and application | |
| CN102424802B (en) | Bacillus pumilus, strain culture method, and application thereof | |
| CN101240249A (en) | Dioscorea zingiberensis endogenesis fusarium capable of producing beauvericin and antibacterial activity thereof | |
| CN102584615A (en) | Alkaloid compound as well as preparation method and application thereof | |
| CN101368166A (en) | Method for preparing oligomycin A and special for bacterial strain thereof | |
| CN101270337A (en) | Method for improving productivity of cultivation of cell dioscorea opposita sapogenin by using peltate yam endogenetic oligose |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150617 |
|
| RJ01 | Rejection of invention patent application after publication |