CN102732427A - Separation method of swainsonine-producing endophytic fungi in glabrous crazyweed - Google Patents

Abstract

A separation method of swainsonine-producing endophytic fungi in glabrous crazyweed comprises the following steps of: acquiring mycelium of the strain and a broth through a bio-fermentation method, carrying out ultrasonic extraction, quantitatively and qualitatively detecting swainsonine by thin-layer chromatography and gas chromatography technologies after solvent extraction, and identifying swainsonine-producing endophytic fungi through morphological and molecular biology methods. The result shows that one out of six separated strains of endophytic fungi can generate swainsonine and the output is 16.7338 mg/L. After identification, the strain is fusarium proliferatum. In comparison with present strains for the production of swainsonine, swainsonine provided by the invention has high output. The bio-fermentation method for the production of swainsonine doesn't influence the meadow ecological environment. The separation method provided by the invention solves the problem of swainsonine sources and provides strain supports, thus establishing a theoretical foundation for future industrial production of swainsonine. The invention has a wide development prospect.

Description

Produce the separation method of trihydroxyoctahydroindolizidine endogenetic fungus in the glabrous crazyweed

Technical field

This patent belongs to field of biological pharmacy, is specifically related to produce in the glabrous crazyweed separation method and the gained product trihydroxyoctahydroindolizidine bacterial strain of trihydroxyoctahydroindolizidine endogenetic fungus.

Background technology

Trihydroxyoctahydroindolizidine belongs to western pyridine Alkaloid in the poly-hydroxy indoles; It is a kind of extremely strong alpha-Mannosidase competitive inhibitor; Cause the oligose of gp resulting anomaly and partial synthesis in lysosome, to be built up, cause the cell vacuolar degeneration, cause organ-tissue infringement and dysfunction and poison.But swainson pea have enhancing body immunologic function, antiviral, anticancer pharmacological action such as antitumor, antibiotic.What deserves to be mentioned is that the anti-tumor activity of trihydroxyoctahydroindolizidine has been the focus of the drug screening of tumour reserve in recent years.Yet the subject matter that restricts domestic trihydroxyoctahydroindolizidine antitumor drug research and development process is very difficulty of trihydroxyoctahydroindolizidine source, can not satisfy the needs of people's research far away.

Endophyte is meant lives within plant tissue a certain period in its life history, plant tissue is not caused the mikrobe of obvious disease symptom.Be the mutualism relation between endophyte and the host; Endophyte is that plant-growth supplies nutrients on the one hand; Promote plant-growth to make host plant on the other hand, environment-stress is shown certain resistance (like drought-resistant, disease and insect resistance etc.) the environment apparent fitness value; What have also shows toxicity to herbivore, to keep the needs of its existence.

At present there are three kinds of approach in the source of trihydroxyoctahydroindolizidine, and first kind is from pulse family Astragalus, whin platymiscium and darling pea plant, and extracts in the convolvulaceae Ipomoea, Malvaceae chrysanthemum harvest spp plant.The amount of trihydroxyoctahydroindolizidine is very low because plant itself contains, and extraction yield is low, and output is limited, is difficult to satisfy the demands; Second kind is to obtain through the synthetic approach, and synthetic product exists isometry and chiral structure phenomenon, makes to separate very difficulty, and productive rate is low, unsuitable large-scale industrial production; The third method is that extraction is biosynthesizing from radicula byssoidea or fermented liquid.

In obtaining three kinds of approach of trihydroxyoctahydroindolizidine at present, the synthetic approach is the emphasis that people study.Since Americanized scholar Yasuda (1984), Bennett priorities such as (1989) are reported the synthetic trihydroxyoctahydroindolizidine; People have adopted the diverse ways synthesized swainsonine; Can be divided into following four kinds: the 1. compound method of Mootoo (2001); Committed step is to use ammoniacal liquor to make the amination of diethyl aldehyde ketone (keto-bisaldehyde) reduce by 3 times, has only a kind of enantiomer to guarantee target substance.This method is with 2,3,5, and (2,3:5 6-di-O-mannofuranose) is initiator to 6-two-O-sweet dew furanose, needs for 13 steps altogether, and productive rate is 15%.2. the asymmetric synthesis method of Trost (1999) and Katsuki (2000) report is an initiator with the divalent alcohol, needs 17 steps and 11 steps respectively, and productive rate is 13% and 10%.3. the method after the improvement of Pearson (2002) report.(D-isoascorbic acid) is starting point with saccharosonic acid, needs for 10 steps altogether, and productive rate is 12%.4. Blechert (2002); Carretero (2000); Beginning along dihydroxyl leucine (syn-dihydroxylation) verivate with western pyridine in the indoles of Pyne reports such as (2002) needed for 15 steps respectively, 18 steps and 16 steps; Productive rate is respectively 38% (beginning to calculate with the meso divalent alcohol), 6.5% and 4.5%.(1993) synthetic trihydroxyoctahydroindolizidines such as academician of the Chinese Academy of Sciences Zhou Weishan are also succeeded, but productive rate is very low.From plant (mainly being loco weed), separating is to extract the method that trihydroxyoctahydroindolizidine is used always at present, but this method has significant limitation, and steppe vegetation is damaged, and trihydroxyoctahydroindolizidine content is lower in the loco weed, can not be as the method for extensive extraction trihydroxyoctahydroindolizidine.

Preceding two kinds of methods (from plant, extracting and chemosynthesis) owing to yield poorly, can not satisfy the needs of people to trihydroxyoctahydroindolizidine anti-tumor activity research and products thereof exploitation.Therefore, explore, just become the focus that present people pay close attention to through output is high, extraction cost is low and the microbial fermentation approach that environment is safe from harm is obtained trihydroxyoctahydroindolizidine.The third method that Here it is: from radicula byssoidea or fermented liquid, extracting is biosynthesizing.Biosynthesizing about trihydroxyoctahydroindolizidine; At present domestic patent of having applied for have 6 promptly " technology of purifying swainsonine by biofermentation " (02114591.1), " technology of purifying spherosinin by fermenting green muscardine fungus " (200610043120.5), " technology of producing swainsonine by fermentation of white muscardine fungi " (200710199249.X), " a kind of Oxytropis ehrig cinerea FEL of synthesized swainsonine " (200910021082.7), " a kind of Oxytropis ehrig verticillium FEL 5-AS 1 of synthesized swainsonine and application " (200910021858.5), " a kind of Oxytropis ehrig cinerea FEL FEL6-AS2 and application thereof of synthesized swainsonine " (200910021861.7), the deficiency and the defective of its existence are:

1. " technology of purifying swainsonine by biofermentation ": be to apply for by YangLing DaNong Biology Technology Co., Ltd; Chinese patent publication number CN1396263; Open day on February 12nd, 2003; The name of innovation and creation is called " technology of purifying swainsonine by biofermentation ", the microorganism strains that it adopted be from the nature leguminous plants, separate voluntarily, the beans rhizoctonia 7-3 bacterial strain (code name) of the produced trihydroxyoctahydroindolizidine of screening.The deficiency and the defective of its existence are in patent, to disclose the concrete preparation method and the approach of beans rhizoctonia 7-3 bacterial strain, also the concrete biological characteristics, standard and the quality identification method that disclose this beans rhizoctonia 7-3 bacterial strain.Make the content that the those of ordinary skill of same domain can't by specification repeat to realize like this.

2. " technology of purifying spherosinin by fermenting green muscardine fungus ": be to apply for by Xibei Univ. of Agricultural & Forest Science & Technology; Number of patent application 200610043120.5, the bacterial classification that is provided are the standard green muscardine funguss of buying from Chinese Academy of Agricultural Sciences microbial strains preservation center (Metarrhizium anisopliae).The extractive technique technology of the trihydroxyoctahydroindolizidine to the effect that of this patent protection, and do not relate to the separation method of green muscardine fungus itself.Green muscardine fungus distributes more extensive at occurring in nature; At present can be from various plants; Comprise separating in the soil obtaining that only the standard green muscardine fungus bacterial strain of Chinese Academy of Agricultural Sciences microbial strains preservation center preservation just has tens kinds more than, specifically is unclear in any patent.

3. " technology of producing swainsonine by fermentation of white muscardine fungi ": be to apply for by Yangling Tianli Biotechnology Co., Ltd.; Number of patent application 200710199249.X; The bacterial classification that is provided is the standard muscardine of buying from Chinese Academy of Agricultural Sciences microbial strains preservation center (Beauveria bassiana Vuill); Being numbered ACCC30112, also can be the muscardine that other channel obtains.The main contents of this patent protection also are the extractive technique technology of trihydroxyoctahydroindolizidine, and do not relate to the separation method of muscardine itself.Muscardine distributes more extensive at occurring in nature, can comprise separating in the soil obtaining that only the standard green muscardine fungus bacterial strain of Chinese Academy of Agricultural Sciences microbial strains preservation center preservation also has tens kinds from various plants at present.

4. " a kind of Oxytropis ehrig cinerea FEL of synthesized swainsonine ", " a kind of Oxytropis ehrig verticillium FEL 5-AS 1 of synthesized swainsonine and application " and " a kind of Oxytropis ehrig cinerea FEL FEL6-AS2 and application thereof of synthesized swainsonine " 3 patent common deficiencies are the kinds that do not disclose bacterial strain, and disclosed numbering bacterial strain trihydroxyoctahydroindolizidine output is on the low side.

Summary of the invention

Separation method and gained that this patent is specifically related to the endogenetic fungus of product trihydroxyoctahydroindolizidine in the glabrous crazyweed produce trihydroxyoctahydroindolizidine bacterial strain fusarium prolifertum (Fusarium proliferatum).Be elaborated in the face of the present invention down.

1) endogenetic fungus separates:

With the dust on deionized water flush away glabrous crazyweed (picking up from Alashan League, the Inner Mongol) surface, separate with leaf, stem, the flower of the tweezers of sterilizing plant, then leaf, stem, flower are wrapped up with gauze respectively; Carry out surface sterilization, the program of surface sterilization is: at first use 75% alcohol immersion 30s, using available chlorine content again is that 1% chlorine bleach liquor soaks 3min; The deionized water rinsing of usefulness sterilization at last 2 times; Each 1min, the PDA nutrient agar that this deionized water is inoculated in new system is surperficial, observes 3d; See whether this media surface has fungal growth, check surperficial disinfectant effect with this;

Use sterilization filter paper to inhale and remove the moisture on the plant tissue of surface sterilization, the scissors with sterilization is cut into the big or small tissue block of 3mm respectively with leaf, stem, flower etc. then, then each tissue block is inoculated in the water agar surface, puts 18 ℃ of cultivations in the incubator; When treating that tissue block grows the bacterium colony of suitable size on every side, picking edge mycelium inoculation is put 18 ℃ of cultivations in the incubator in PDA nutrient agar surface; If the bacterium colony of on the PDA substratum, growing during purifying, with its PDA media surface that is inoculated in new system once more, does not repeat this operating process, until the bacterial strain that obtains purifying yet.6 strain endogenetic fungus numbering with separation obtains is inoculated in the PDA test tube slant respectively, in 4 ℃, preserves, and changes-20 ℃ of prolonged preservation behind the 24h over to.

2) the trihydroxyoctahydroindolizidine endogenetic fungus is produced in the qualitative screening of tlc:

The endogenetic fungal bacterial strain that separation is obtained is inoculated on the PDA substratum, adopts No. 1 nutrient solution prescription to put 20 ℃～25 ℃ aerobic fermentations and cultivates 10～14 days, collects mycelium, and kept dry is subsequent use.Trihydroxyoctahydroindolizidine qualitative detection in the endogenetic fungus mycelium: exsiccant endogenetic fungus mycelia is used the mortar grind into powder,, put into Soxhlet extractor,, repeat to extract the merging ethanol extract 3 times with 75 ℃ of refluxing extraction of ethanol 4 hours with filter paper parcel; Ethanol extract concentrates respectively and volatilizes, and with deionized water it is dissolved, and adds the long D101 macroporous resin column of 5cm.With deionized water wash-out resin column, collect water elution liquid earlier, and with its concentrated volatilizing.With methyl alcohol it is dissolved then, process liquid to be checked; Trihydroxyoctahydroindolizidine qualitative detection in the endogenetic fungus fermented liquid: reclaim and concentrated broth, with deionized water it is dissolved, remaining step is with mycelium trihydroxyoctahydroindolizidine qualitative detection.With kapillary trihydroxyoctahydroindolizidine standard substance, endogenetic fungus mycelia liquid to be checked and the liquid to be checked that ferments are distinguished point sample on the GF254 silica gel thin-layer plate, use V _Chloroform: V _{Methyl alcohol}: V _{Ammoniacal liquor}: V _Water=70: the developping agent ascending method was launched in 26: 2: 2.When treating that developping agent arrives the thin layer plate forward position; Its taking-up is volatilized solvent, put 110 ℃ of heating 10min, again aceticanhydride is sprayed on the silica-gel plate surface at thin layer plate surface sprinkling H2O2; Put 110 ℃ of heating 10min; Spray Ehrlich ' s reagent at last, put 110 ℃ of heating 10min, observe sample to be checked then and whether have color and R with the trihydroxyoctahydroindolizidine standard substance _fBe worth identical spot.Tentatively judge whether contain trihydroxyoctahydroindolizidine in fermented liquid and the mycelium.XJ-H-1 thin-layer chromatography result sees table 1.

3) gc method quantitative measurement trihydroxyoctahydroindolizidine content:

Gas chromatograph: the GC-14C gas chromatograph of day island proper Tianjin company production, Weil-McLain dragon chromatographic working station.

Chromatographic condition: SE30 quartz capillary column (30m * 0.25mm, 0.33 μ m), 280 ℃ of column temperatures, 300 ℃ of injector temperatures, 280 ℃ of flame ionization ditector (FID) temperature, carrier gas is a nitrogen, flow velocity is 2mL/min, sample size 1 μ L, splitting ratio 30: 1.

Typical curve is drawn: take by weighing a certain amount of trihydroxyoctahydroindolizidine standard substance are mixed with 0.0016～5.102g/L series mass concentration with pyridine standard solution; Measure 100 each standard solution of μ L; Add interior mark (methylating-α-the D-mannoside) solution of 20 μ L 1mg/mL respectively, mixing adds 40 μ L silylanization (BSTFA+TMCS) reagent at last; Put in the moisture eliminator room temperature and carry out Silanization reaction 30min, carry out gas Chromatographic Determination.

Be X-coordinate x, be ordinate zou y with the ratio of the peak area of trihydroxyoctahydroindolizidine standard model and interior mark peak area with the mass concentration (mg/mL) of trihydroxyoctahydroindolizidine, the drawing standard curve, regression equation y=2E-05x+0.0054, (R ²=0.9977), expression linear relationship good (Fig. 1).Trihydroxyoctahydroindolizidine standard substance gc peak RT is 4.83min (Fig. 2).The mass concentration of trihydroxyoctahydroindolizidine is good linear relationship in 0.013～1.563g/L scope.

Trihydroxyoctahydroindolizidine assay in the endogenetic fungus fermented liquid: (code name is: the liquid to be checked of fermentation XJ-H-1) is centrifugal for the endogenetic fungus of the generation trihydroxyoctahydroindolizidine that recovery thin-layer chromatography technology preliminary screening goes out; Volatilize after removing insolubles; With pyridine dissolving, add inner mark solution and silylating reagent respectively successively, put in the moisture eliminator room temperature and carry out Silanization reaction 30min; 1 μ L sample introduction carries out gas chromatographic analysis then.

Trihydroxyoctahydroindolizidine assay in the endogenetic fungus mycelium: the XJ-H-1 endogenetic fungus mycelium liquid to be checked of the generation trihydroxyoctahydroindolizidine that will go out through thin-layer chromatography technology preliminary screening is centrifugal, volatilizes after removing insolubles, and remaining step is the same.The ratio substitution typical curve equation of trihydroxyoctahydroindolizidine peak area and interior mark peak-to-peak area in the sample solution calculates the content of trihydroxyoctahydroindolizidine in the sample solution.The XJ-H-1 fermented liquid has chromatographic peak to occur in this RT, and appearance time 4.86min can produce trihydroxyoctahydroindolizidine (Fig. 3) this bacterium of explanation.Its peak area value substitution regression equation calculation is respectively drawn trihydroxyoctahydroindolizidine output, and the XJ-H-1 bacterial strain fermentation liquor is 16.7338mg/L.The XJ-H-1 mycelium does not detect close peak with standard substance, does not have trihydroxyoctahydroindolizidine or content extremely low in the prompting mycelium.

4) evaluation of product trihydroxyoctahydroindolizidine endogenetic fungus:

Morphology is identified: bacterial classification inoculation in the PDA substratum, is treated that bacterium colony grows to suitable size, and visual inspection bacterium colony, mycelia, conidial fructification, conidiophore characteristics such as giving birth to situation, spore shape and color.Adopt the inserted sheet method to extract self-sow attitude mycelia at the PDA substratum, the neutral gum mounting is put and is observed mycelia and spore shape under 400 power microscopes, and Taking Pictures recording.Carrying out preliminary classification according to characteristics such as bacterium colony, mycelia and spore shape with reference to " fungi identification handbook " identifies.XJ-H-1 bacterium colony mycelia morphology is identified and is seen Fig. 4.

Molecular biology identification: in rrna rDNA gene; 16SrDNA and 28SrDNA gene intervening sequence are called ITS sequence (internal transcription transcribed spacer); Have the moderate conservative property, its length and sequence variation are bigger, and its amplified material is carried out sequential analysis; Can be used for different biotypes such as bacterium, fungi, plant, kind classification are identified, is the ideal sequence of present fungal molecule Phylogenetic Studies.

Therefore, extract the endogenetic fungus genomic dna, employing ITS1 (5 '-TCCGTAGGTGAACCTGCGG-3 ') and ITS4 (5 '-TCCTCCGCTTATTGATATGC-3 ') amplification ITS sequence, carry out ITS and measure and compare, identify the endogenetic fungus kind.1. endogenetic fungus total DNA extraction: adopt fungal DNA to extract test kit, extract fungal gene group DNA according to explanation.2. pcr amplification condition: 95 ℃ of preparatory sex change 3min, 94 ℃ of sex change 30S, 55 ℃ of annealing 30S, 72 ℃ are extended 45S, 35 circulations; 72 ℃ keep 10min, 12 ℃ of insulations.3. the PCR product reclaims: reclaim test kit with glue and carry out the segmental recovery purifying of purpose.4. carrier connects and transforms: connect test kit according to the pEASY-T3 carrier, PCR product fragment is connected on the pEASY-T3 carrier, import Trarns1-T1 type competent cell.Competent cell after transforming is coated on the LB culture medium flat plate that contains Amp, put 37 ℃ and cultivate 12～16h, the single bacterium colony of picking carries out bacterium liquid PCR, and PCR reaction system and condition are the same.5. objective gene sequencing: the bacterium liquid that bacterium liquid PCR result is positive is delivered the order-checking of order-checking company.6. fungal systems growth tree is compared and made up to aim sequence: BLAST is carried out in the artificial shearing of the sequence back that order-checking company beams back on NCBI; Combining form is learned qualification result and is chosen the high bacterial classification of homology; Adopt Mega4.0 software N-J method to carry out cluster analysis then; Bootstrap number of times 1000 times makes up the endogenetic fungus phylogenetic tree and carries out kind and sort out.

The purpose fragment length that adopts ITS1 and ITS4 universal primer to amplify is 500-750bp, comprises 18SrDNA, 28SrDNA sequence and whole ITS1,5.8SrDNA and ITS4 sequences of part.The purpose fragment that amplifies XJ-H-1 is 558bp (Fig. 5).On NCBI, carry out the Blast comparison, the result shows that XJ-H-1 is fusarium prolifertum (Fusarium proliferatum), and homology is up to 99%.(Fig. 6) can find out from the XJ-H-1 phylogenetic tree, and XJ-H-1 and Fusarium proliferatum sibship are nearer, and the self check supporting rate is up to 90%, and far away with the relation of other a few genus fungies.Morphology in conjunction with " fungi identification handbook " is described, and prompting XJ-H-1 is fusarium prolifertum (Fusarium proliferatum).The systematic evolution tree of XJ-H-1 is seen Fig. 6.

Description of drawings:

Fig. 1 is the qualitative evaluation figure of thin-layer chromatography;

Fig. 2 is trihydroxyoctahydroindolizidine concentration-peak area typical curve and trihydroxyoctahydroindolizidine standard substance gas chromatogram;

(4.83 ± 0.05min) go out peak figure to Fig. 3 for the XJ-J-1 fermented liquid goes out the peak reservation period at the trihydroxyoctahydroindolizidine standard substance;

Fig. 4 is XJ-H-1 bacterium colony and microscopic morphology figure;

Fig. 5 is the 5.8S rDNA-ITS amplified fragments agarose gel electrophoresis figure of XJ-H-1;

Fig. 6 is for constructing the phylogenetic tree of the 5.8SrDNA-ITS sequence of isolated product trihydroxyoctahydroindolizidine fusarium prolifertum in the glabrous crazyweed with the NJ method.

5 accompanying drawing table explanations

1) the qualitative evaluation of thin-layer chromatography:

Can find from Fig. 1: XJ-H-1 and trihydroxyoctahydroindolizidine standard substance spot R _fAnd solid colour, can tentatively confirm to contain trihydroxyoctahydroindolizidine in the sample to be checked, explain that this endogenetic fungus can produce trihydroxyoctahydroindolizidine.

2) gas chromatographic detection:

Fig. 2 is trihydroxyoctahydroindolizidine concentration-peak area typical curve and trihydroxyoctahydroindolizidine standard substance gas chromatogram, regression equation: y=2E-05x+0.0054, (R ²=0.9977), trihydroxyoctahydroindolizidine standard substance gc peak RT: 4.83min.

The XJ-J-1 fermented liquid goes out the peak reservation period at the trihydroxyoctahydroindolizidine standard substance, and (4.83 ± 0.05min) go out the peak: 4.85min (Fig. 3).

3) XJ-H-1 bacterium colony and micro-structure diagram:

(Fig. 4 A, 4B): the average speed of growth of this bacterium on the PDA substratum is 7mm/d, covers with whole flat board in 12 days for XJ-H-1 bacterium colony and microscopic morphology.The medium matrix reverse side is a deep yellow, and bacterium colony is white in color, fluffy convexity, flocculence is intensive.The mycelia microgram shows that the separation of XJ-H-1 mycelia is clear and many, diameter 4-6 μ m, and its conidiophore is more straight, and the top is sausage shape, does not see obvious spore.Morphology in the fermented liquid: fermented liquid is faint yellow, and slightly muddy, liquid level is not seen obvious bubble.White thalline cloud suspends, and the later stage thalline is closely knit.

4) Fig. 5 is the 5.8S rDNA-ITS amplified fragments agarose gel electrophoresis figure of XJ-H-1.

5) isolated fusarium prolifertum 5.8SrDNA-ITS sequence in the glabrous crazyweed, underscore is a primer sequence:

AGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGC CTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAA ACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAA CAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAA TGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCC AGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGT TTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCG GTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCG CGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAAT ACCCGCTGAACTTAA

6) the XJ-H-1 phylogenetic tree makes up:

Fig. 6 is the phylogenetic tree that constructs the 5.8SrDNA-ITS sequence of isolated product trihydroxyoctahydroindolizidine fusarium prolifertum in the glabrous crazyweed with the NJ method.(Fig. 6) can find out from the XJ-H-1 phylogenetic tree, and XJ-H-1 and fusarium prolifertum (Fusarium proliferatum) sibship is nearer, and the self check supporting rate is up to 90%, and far away with the relation of other a few genus fungies.Morphology in conjunction with " fungi identification handbook " is described, and prompting XJ-H-1 is fusarium prolifertum (Fusarium proliferatum).

5 gained technique effects of the present invention

1) source of trihydroxyoctahydroindolizidine mainly is from loco weed, to extract at present; Research confirms that endophyte can produce the secondary metabolite identical with the host; This is not a some phenomena at nature, and the generation of active substance-trihydroxyoctahydroindolizidine is by due to the endogenetic fungus in it in the loco weed.According to incompletely statistics, China western meadow loco weed class plant has 45 kinds approximately, mainly is distributed in western provinces and regions such as the Inner Mongol, Gansu, Qinghai, Xinjiang, Tibet, Shaanxi, Ningxia, Sichuan, and distribution area has surpassed 1,100 ten thousand hm ², plant resources is very abundant.From the numerous loco weed kind of China, be separated to the trihydroxyoctahydroindolizidine superior strain probably, this will provide abundant bacterial classification source for the biological fermentation of trihydroxyoctahydroindolizidine, and the present invention will promote the exploitation of multifarious research of plant endogenesis epiphyte and tunning thereof.

2) endogenetic fungus of the present invention's isolating product trihydroxyoctahydroindolizidine from loco weed (glabrous crazyweed), it produces the bacterial strain of the amount of trihydroxyoctahydroindolizidine far above other sources, and the strains separation ratio is easier to.Even the bacterial strain variation takes place in the process of preserving bacterial classification, also can from the nature loco weed, separate obtaining again, guaranteed that the gained endogenetic fungus produces the persistence and stability of trihydroxyoctahydroindolizidine.

3) advantage of this patent is from loco weed (glabrous crazyweed), to isolate a kind of endogenetic fungus that produces trihydroxyoctahydroindolizidine; Can produce this living meta-bolites identical with the host; Trihydroxyoctahydroindolizidine is through detecting, and the trihydroxyoctahydroindolizidine output in its bio-fermented liquid is higher, is 16.7338mg/L.Compare with the existing trihydroxyoctahydroindolizidine bacterial classification that produces, its trihydroxyoctahydroindolizidine output is higher, will be the based theoretical of trihydroxyoctahydroindolizidine suitability for industrialized production from now on, and its development prospect is wide.

Embodiment:

1) endogenetic fungus separates:

With the dust on deionized water flush away glabrous crazyweed (picking up from Alashan League, the Inner Mongol) surface, separate with leaf, stem, the flower of the tweezers of sterilizing plant, then leaf, stem, flower are wrapped up with gauze respectively; Carry out surface sterilization, the program of surface sterilization is: at first use 75% alcohol immersion 30s, using available chlorine content again is that 1% chlorine bleach liquor soaks 3min; The deionized water rinsing of usefulness sterilization at last 2 times; Each 1min, the PDA nutrient agar that this deionized water is inoculated in new system is surperficial, observes 3d; See whether this media surface has fungal growth, check surperficial disinfectant effect with this;

Use sterilization filter paper to inhale and remove the moisture on the plant tissue of surface sterilization, the scissors with sterilization is cut into the big or small tissue block of 3mm respectively with leaf, stem, flower etc. then, then each tissue block is inoculated in the water agar surface, puts 18 ℃ of cultivations in the incubator; When treating that tissue block grows the bacterium colony of suitable size on every side, picking edge mycelium inoculation is put 18 ℃ of cultivations in the incubator in PDA nutrient agar surface; If the bacterium colony of on the PDA substratum, growing during purifying, with its PDA media surface that is inoculated in new system once more, does not repeat this operating process, until the bacterial strain that obtains purifying yet.6 strain endogenetic fungus numbering with separation obtains is inoculated in the PDA test tube slant respectively, in 4 ℃, preserves, and changes-20 ℃ of prolonged preservation behind the 24h over to.

2) the trihydroxyoctahydroindolizidine endogenetic fungus is produced in the qualitative screening of tlc:

The endogenetic fungal bacterial strain that separation is obtained is inoculated on the PDA substratum, adopts No. 1 nutrient solution prescription to put 20 ℃～25 ℃ aerobic fermentations and cultivates 10～14 days, collects mycelium, and kept dry is subsequent use.Trihydroxyoctahydroindolizidine qualitative detection in the endogenetic fungus mycelium: exsiccant endogenetic fungus mycelia is used the mortar grind into powder,, put into Soxhlet extractor,, repeat to extract the merging ethanol extract 3 times with 75 ℃ of refluxing extraction of ethanol 4 hours with filter paper parcel; Ethanol extract concentrates respectively and volatilizes, and with deionized water it is dissolved, and adds the long D101 macroporous resin column of 5cm.With deionized water wash-out resin column, collect water elution liquid earlier, and with its concentrated volatilizing.With methyl alcohol it is dissolved then, process liquid to be checked; Trihydroxyoctahydroindolizidine qualitative detection in the endogenetic fungus fermented liquid: reclaim and concentrated broth, with deionized water it is dissolved, remaining step is with mycelium trihydroxyoctahydroindolizidine qualitative detection.With kapillary trihydroxyoctahydroindolizidine standard substance, endogenetic fungus mycelia liquid to be checked and the liquid to be checked that ferments are distinguished point sample on the GF254 silica gel thin-layer plate, use V _Chloroform: V _{Methyl alcohol}: V _{Ammoniacal liquor}: V _Water=70: the developping agent ascending method was launched in 26: 2: 2.When treating that developping agent arrives the thin layer plate forward position; Its taking-up is volatilized solvent, put 110 ℃ of heating 10min, again aceticanhydride is sprayed on the silica-gel plate surface at thin layer plate surface sprinkling H2O2; Put 110 ℃ of heating 10min; Spray Ehrlich ' s reagent at last, put 110 ℃ of heating 10min, observe sample to be checked then and whether have color and R with the trihydroxyoctahydroindolizidine standard substance _fBe worth identical spot.Tentatively judge whether contain trihydroxyoctahydroindolizidine in fermented liquid and the mycelium.XJ-H-1 thin-layer chromatography result sees table 1.

3) gc method quantitative measurement trihydroxyoctahydroindolizidine content:

Gas chromatograph: the GC-14C gas chromatograph of day island proper Tianjin company production, Weil-McLain dragon chromatographic working station.

Chromatographic condition: SE30 quartz capillary column (30m * 0.25mm, 0.33 μ m), 280 ℃ of column temperatures, 300 ℃ of injector temperatures, 280 ℃ of flame ionization ditector (FID) temperature, carrier gas is a nitrogen, flow velocity is 2mL/min, sample size 1 μ L, splitting ratio 30: 1.

Typical curve is drawn: take by weighing a certain amount of trihydroxyoctahydroindolizidine standard substance are mixed with 0.0016～5.102g/L series mass concentration with pyridine standard solution; Measure 100 each standard solution of μ L; Add interior mark (methylating-α-the D-mannoside) solution of 20 μ L 1mg/mL respectively, mixing adds 40 μ L silylanization (BSTFA+TMCS) reagent at last; Put in the moisture eliminator room temperature and carry out Silanization reaction 30min, carry out gas Chromatographic Determination.

Be X-coordinate x, be ordinate zou y with the ratio of the peak area of trihydroxyoctahydroindolizidine standard model and interior mark peak area with the mass concentration (mg/mL) of trihydroxyoctahydroindolizidine, the drawing standard curve, regression equation y=2E-05x+0.0054, (R ²=0.9977), expression linear relationship good (Fig. 1).Trihydroxyoctahydroindolizidine standard substance gc peak RT is 4.83min (Fig. 2).The mass concentration of trihydroxyoctahydroindolizidine is good linear relationship in 0.013～1.563g/L scope.

Trihydroxyoctahydroindolizidine assay in the endogenetic fungus fermented liquid: (code name is: the liquid to be checked of fermentation XJ-H-1) is centrifugal for the endogenetic fungus of the generation trihydroxyoctahydroindolizidine that recovery thin-layer chromatography technology preliminary screening goes out; Volatilize after removing insolubles; With pyridine dissolving, add inner mark solution and silylating reagent respectively successively, put in the moisture eliminator room temperature and carry out Silanization reaction 30min; 1 μ L sample introduction carries out gas chromatographic analysis then.

Trihydroxyoctahydroindolizidine assay in the endogenetic fungus mycelium: the XJ-H-1 endogenetic fungus mycelium liquid to be checked of the generation trihydroxyoctahydroindolizidine that will go out through thin-layer chromatography technology preliminary screening is centrifugal, volatilizes after removing insolubles, and remaining step is the same.The ratio substitution typical curve equation of trihydroxyoctahydroindolizidine peak area and interior mark peak-to-peak area in the sample solution calculates the content of trihydroxyoctahydroindolizidine in the sample solution.The XJ-H-1 fermented liquid has chromatographic peak to occur in this RT, and appearance time 4.86min can produce trihydroxyoctahydroindolizidine (Fig. 3) this bacterium of explanation.Its peak area value substitution regression equation calculation is respectively drawn trihydroxyoctahydroindolizidine output, and the XJ-H-1 bacterial strain fermentation liquor is 16.7338mg/L.The XJ-H-1 mycelium does not detect close peak with standard substance, does not have trihydroxyoctahydroindolizidine or content extremely low in the prompting mycelium.

4) evaluation of product trihydroxyoctahydroindolizidine endogenetic fungus:

Morphology is identified: bacterial classification inoculation in the PDA substratum, is treated that bacterium colony grows to suitable size, and visual inspection bacterium colony, mycelia, conidial fructification, conidiophore characteristics such as giving birth to situation, spore shape and color.Adopt the inserted sheet method to extract self-sow attitude mycelia at the PDA substratum, the neutral gum mounting is put and is observed mycelia and spore shape under 400 power microscopes, and Taking Pictures recording.Carrying out preliminary classification according to characteristics such as bacterium colony, mycelia and spore shape with reference to " fungi identification handbook " identifies.XJ-H-1 bacterium colony mycelia morphology is identified and is seen Fig. 4.

Molecular biology identification: in rrna rDNA gene; 16SrDNA and 28SrDNA gene intervening sequence are called ITS sequence (internal transcription transcribed spacer); Have the moderate conservative property, its length and sequence variation are bigger, and its amplified material is carried out sequential analysis; Can be used for different biotypes such as bacterium, fungi, plant, kind classification are identified, is the ideal sequence of present fungal molecule Phylogenetic Studies.

Therefore, extract the endogenetic fungus genomic dna, employing ITS1 (5 '-TCCGTAGGTGAACCTGCGG-3 ') and ITS4 (5 '-TCCTCCGCTTATTGATATGC-3 ') amplification ITS sequence, carry out ITS and measure and compare, identify the endogenetic fungus kind.1. endogenetic fungus total DNA extraction: adopt fungal DNA to extract test kit, extract fungal gene group DNA according to explanation.2. pcr amplification condition: 95 ℃ of preparatory sex change 3min, 94 ℃ of sex change 30S, 55 ℃ of annealing 30S, 72 ℃ are extended 45S, 35 circulations; 72 ℃ keep 10min, 12 ℃ of insulations.3. the PCR product reclaims: reclaim test kit with glue and carry out the segmental recovery purifying of purpose.4. carrier connects and transforms: connect test kit according to the pEASY-T3 carrier, PCR product fragment is connected on the pEASY-T3 carrier, import Trans1-T1 type competent cell.Competent cell after transforming is coated on the LB culture medium flat plate that contains Amp, put 37 ℃ and cultivate 12～16h, the single bacterium colony of picking carries out bacterium liquid PCR, and PCR reaction system and condition are the same.5. objective gene sequencing: the bacterium liquid that bacterium liquid PCR result is positive is delivered the order-checking of order-checking company.6. fungal systems growth tree is compared and made up to aim sequence: BLAST is carried out in the artificial shearing of the sequence back that order-checking company beams back on NCBI; Combining form is learned qualification result and is chosen the high bacterial classification of homology; Adopt Mega4.0 software N-J method to carry out cluster analysis then; Bootstrap number of times 1000 times makes up the endogenetic fungus phylogenetic tree and carries out kind and sort out.

The purpose fragment length that adopts ITS1 and ITS4 universal primer to amplify is 500-750bp, comprises 18SrDNA, 28SrDNA sequence and whole ITS1,5.8SrDNA and ITS4 sequences of part.The purpose fragment that amplifies XJ-H-1 is 558bp (Fig. 5).On NCBI, carry out the Blast comparison, the result shows that XJ-H-1 is fusarium prolifertum (Fusarium proliferatum), and homology is up to 99%.(Fig. 6) can find out from the XJ-H-1 phylogenetic tree, and XJ-H-1 and Fusarium proliferatum sibship are nearer, and the self check supporting rate is up to 90%, and far away with the relation of other a few genus fungies.Morphology in conjunction with " fungi identification handbook " is described, and prompting XJ-H-1 is fusarium prolifertum (Fusarium proliferatum).The systematic evolution tree of XJ-H-1 is seen Fig. 6.

Claims (1)

1. produce the separation method of trihydroxyoctahydroindolizidine endogenetic fungus in the glabrous crazyweed, it is characterized in that, comprise step:

1) separation of endogenetic fungus in the glabrous crazyweed:

With the glabrous crazyweed surface sterilization, sterilizing program: earlier with 75% ethanol rinsing, 30～60s, sterile water wash 3 times; 0.1% mercuric chloride solution rinsing, 2～5min; Aseptic water washing is got last flushing gained sterilized water and is splashed into the PDA culture medium flat plate, cultivates 48h for 25 ℃; Observe media surface and have or not colony growth, verify with this whether the plant surface sterilization is thorough.With surface sterilization completely sample be cut into 0.5cm * 0.5cm tissue block, plant substratum in PDA, cultivate 3～5d for 25 ℃; When waiting to organize the edge of wound mycelia to grow, choose mycelia and insert new PDA substratum with inoculating needle, purifying is cultivated 3～4 times; Obtain the purifying bacterial strain, and number.The bacterial strain that obtains of separation and purification behind assorted bacterium such as the common mould of reject, flavus, black mold, is inoculated in the PDA test tube slant respectively and cultivates according to the method described above, makes prolonged preservation in-20 ℃ of refrigerators,

PDA solid culture based formulas: yam 200g, glucose 20g, agar 15g, water 1000mL;

2) endogenetic fungus biological fermentation:

Get inoculation that above-mentioned separation and purification obtains in the PDA culture medium flat plate, 25 ℃ are cultured to when being in logarithmic phase, adopt the punching measurement Law to insert liquid medium respectively No. 1,25 ℃ of fermentation culture 14d.No. 1 liquid culture liquid formula: sucrose 26g, potassium hydrogenphosphate 3g, SODIUMNITRATE 3g, sal epsom 0.5g, Repone K 0.5g, ferrous sulfate 0.01g, yeast extract 3g, water 1000mL;

3) trihydroxyoctahydroindolizidine qualitative and quantitative analysis in fermented liquid and the mycelium:

Qualitative detection: adopt tlc, collect fermented liquid, be evaporated to paste; Acid-alkali treatment, butanol extraction liquid is collected in water-saturated n-butanol extraction 6～7 times; It is subsequent use to process liquid to be checked with 95% anhydrous alcohol solution behind the concentrating under reduced pressure, and this gives birth to meta-bolites in the ultrasonic assistance alcohol extraction mycelium, collects extraction liquid; The same fermented liquid of remaining step, it is subsequent use to process liquid to be checked, adopts the thin-layer chromatography technology; Compare with the trihydroxyoctahydroindolizidine standard substance, liquid to be checked is put on self-control silica GF254 thin layer plate with kapillary, places V _Chloroform: V _{Methyl alcohol}: V _{Ammonia Water}: V _Water=70: 26: 2: 2 developping agent ascending developments, launch to finish the back taking-up and volatilize, position and the spot colors of sample to be checked on thin layer plate observed in ydrogen peroxide 50/aceticanhydride ethanol/paradimethy laminobenzaldehyde " three step development processes " colour developing, and the record color is also calculated R _fValue;

Detection by quantitative: adopt vapor-phase chromatography, dissolve the trihydroxyoctahydroindolizidine standard substance and do gradient dilution, add silylating reagent and mix with pyridine; Act on 20min under the room temperature, gas Chromatographic Determination is carried out in sampling, and chromatographic condition is: 200 ℃ of column temperatures; 300 ℃ of injector temperatures, 280 ℃ of fid detector temperature, carrier gas is a nitrogen; Nebulizer gas pressure 200kPa, flow velocity are 2mL/min, sample size 2 μ L; Splitting ratio 60: 1 (AT.SE-54 type capillary chromatographic column, 30m * 0.25mm * 0.25 μ m, chromatographic technique research and development centre of Lanzhou chemical physics institute of the Chinese Academy of Sciences).With the corresponding peak area of trihydroxyoctahydroindolizidine is X-coordinate, and trihydroxyoctahydroindolizidine concentration is ordinate zou production standard curve, then according to the typical curve equation, calculates trihydroxyoctahydroindolizidine content in the sample;

4) producing the trihydroxyoctahydroindolizidine endogenetic fungus identifies:

Morphology is identified: with bacterial classification inoculation in the PDA substratum; Treat that bacterium colony grows to suitable size; Observation bacterium colony, mycelia, conidial fructification, conidiophore characteristics such as giving birth to situation, spore shape and color, adopt the inserted sheet method to extract self-sow attitude mycelia in the PDA substratum, neutral gum mounting; Put and observe mycelia and spore shape under 400 power microscopes, and Taking Pictures recording.Carrying out preliminary classification according to characteristics such as bacterium colony, mycelia and spore shape with reference to " fungi identification handbook " identifies;

Molecular biology identification: extract the endogenetic fungus genomic dna; Adopt fungi to identify the ITS sequence in universal primer: ITS1 (5 '-TCCGTAGGTGAACCTGCGC-3 ') and ITS4 (5 '-TCCTCCGCTTATTGATATGC-3 ') the rrna rDNA gene that increases; Aim sequence is carried out BLAST on NCBI; Combining form is learned qualification result and is chosen the high bacterial classification of homology, adopts Mega4.0 software N-J method to carry out cluster analysis then, the number of times 1000 times of bootstrapping; Make up the endogenetic fungus phylogenetic tree and carry out the kind classification

Identify the endogenetic fungus race relation in conjunction with above-mentioned two kinds of methods;

5) must produce the trihydroxyoctahydroindolizidine endogenetic fungus: identify a strain through aforesaid method and produce the trihydroxyoctahydroindolizidine endogenetic fungus, this bacterium is fusarium prolifertum (Fusarium proliferatum), and trihydroxyoctahydroindolizidine output is 16.7338mg/L in its fermented liquid.

Images