CN104673908A - Method for detecting transgenic papaya through universal primer multiple PCR technology - Google Patents
Method for detecting transgenic papaya through universal primer multiple PCR technology Download PDFInfo
- Publication number
- CN104673908A CN104673908A CN201510075452.0A CN201510075452A CN104673908A CN 104673908 A CN104673908 A CN 104673908A CN 201510075452 A CN201510075452 A CN 201510075452A CN 104673908 A CN104673908 A CN 104673908A
- Authority
- CN
- China
- Prior art keywords
- primer
- uni
- papaya
- universal
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biology and particularly discloses a method for detecting a transgenic papaya through a universal primer multiple PCR technology. The method comprises the following steps: S1, designing one pair of universal primers and five pairs of specific primers connected with the universal primers; S2, detecting, namely taking the to-be-tested papaya gene group DNA as a template, adding all primers designed by the step S1 in the PCR reaction, and performing PCR and electrophoresis to obtain whether the detected papaya is a transgenic papaya. By adopting the method, the multiple PCR amplification efficiency can be increased and the detection sensitivity can be greatly increased, furthermore, the method has the advantage of reducing the detection cost due to the multiple PCR. According to the application of the detection of the transgenic papaya, the universal primer multiple PCR technology has high feasibility.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of method utilizing universal primer multiple PCR technique to detect transgenic papaya.
Background technology
Papaya is the important torrid zone of China, subtropics fancy fruit, mainly in Yunnan, Hainan, Guangdong, Fujian, Guangxi, the provinces and regions plantation such as Taiwan, not only edible, also there is extremely important industrial application value.But because disease is serious, particularly prv Papaya ring spot virus (PRSV) is sick, causes its quality to decline, and output reduces, and greatly have impact on the economic benefit of papaya in market.Early 1990s, Fitch etc. proceed to papaya coding PRSV capsid protein (Coat prote in, CP) gene, obtain the disease-resistant strain of Transgenic cp, and get permission to enter merchandized handling in 1997, extensively plant at Hawaii, America.But this strain is to the PRSV strain non-resistant effect of the Asian countries such as South China of China, Taiwan and Thailand.Plant virus research department of Agricultural University Of South China is by turning prv (papaya ring spot virus, PRSV) method of In Guangdong Province advantage strain Ys replicative enzyme (Rep) gene, obtain the transgenic papaya plant " No. Hua Nongyi " of high resistance PRSV, and got permission to carry out environment and safety evaluation for eating in 2004, within 2006, obtain the safety certificate [Nong Jian demonstrate,proves No. 001st, word (2006)] of " No. Hua Nongyi, transgenic papaya is in Guangdong Province's application " that the Ministry of Agriculture issues, this is that China the 1st example is got permission to carry out commercial transgenosis fruit tree crop, come into the market to commercially produce.
Based on the potential safe uncertainty of genetically modified food, countries in the world government all strengthens managing genetically modified food, to ensure the right to know of national human consumer.Detect genetically modified crops both at home and abroad at present, detection technique integrates and mainly contains two large types: one is based on the detection in the foreign gene nucleic acid level proceeded to; Two is the detections based on proceeding in exogenous gene expression product albumen matter level.Generally adopt in the world using PCR polymerase chain reaction (polymerase chain reaction, PCR) the qualitative detection technology based on nucleic acid as examination criteria.
Along with the fast development of transgenic technology, the kind of genetically modified crops is increasing, kind reaches more than 100, the food processed by genetically modified crops and food ingredient reach kind more than 4000, its foreign gene composition also becomes increasingly complex, need may to detect by gene multiple, Detection task increases gradually, therefore in the urgent need to researching and developing a kind of accurate, quick, easy polygene detection technique simultaneously.But traditional multiple PCR technique reaction system is often too complicated, exist between primer and repel and inhibited reaction, to such an extent as to result repeatability is good not, limits its high flux property to a certain extent.
Summary of the invention
Technical problem to be solved by this invention is, in order to overcome the defect such as repulsion and poor reproducibility between traditional multiple PCR technique system complexity, primer, provides a kind of method utilizing universal primer multiple PCR technique to detect transgenic papaya.The method by the consumption to reduce every bar Auele Specific Primer of a universal primer, the shortcoming such as repulsion, poor reproducibility between the primer that can overcome traditional multiplex PCR.
Above-mentioned technical problem to be solved by this invention is achieved by the following technical programs:
Utilize universal primer multiple PCR technique to detect a method for transgenic papaya, comprise following steps:
S1. design 1 pair of universal primer and 5 to the Auele Specific Primer being connected to universal primer, the sequence of described primer is respectively:
Uni-Papain-F：CCTTCCTTCCTTCCACGCAATCTACAATCTTGCTAACCCTA；
Uni-Papain-R：CCTTCCTTCCTTCCACGCAAGTCATCTTGAGAATAACCCAC；
Uni-35s-F：CCTTCCTTCCTTCCACGCAAAGACGATCTACCCGAGCAA；
Uni-35s-R：CCTTCCTTCCTTCCACGCAGAAGCAAGCCTTGAATCGTC；
Uni-NptII-F：CCTTCCTTCCTTCCACGCACTGTGCTCGACGTTGTCACT；
Uni-NptII-R：CCTTCCTTCCTTCCACGCACTTCCATCCGAGTACGTGCT；
Uni-RP-F：CCTTCCTTCCTTCCACGCACTTTGGTGCGGAAAAGTTGT；
Uni-RP-R：CCTTCCTTCCTTCCACGCACCATAGCCCACAGTCGAATT；
Uni-CP-F：CCTTCCTTCCTTCCACGCAAGAATGTTTGGAATGGACGG；
Uni-CP-R：CCTTCCTTCCTTCCACGCAGCATACCCAGGAGAGAGTGC；
Universal-primer：CCTTCCTTCCTTCCACGCA；
S2. detect: with papaya genomic dna to be detected for template, in PCR reaction, add all primers of S1. design, carry out PCR, electrophoresis, thus learn whether detected papaya is transgenic papaya.
Preferably, the PCR reaction described in S2., its reaction conditions is: denaturation 94 DEG C, 3min; 30 circulations: sex change 94 DEG C, 30sec, anneals 62 DEG C, and 30sec extends 72 DEG C, 1min; Stop extension 72 DEG C, 5min.
Preferably, the PCR reaction described in S2., its reaction system is 30 μ L, containing 2 × MasterMix; Primer Uni-Papain-F and Uni-Papain-R is 0.15 μ L, primer Uni-35s-F and Uni-35s-R is 0.2 μ L, primer Uni-NptII-F and Uni-NptII-R is 0.4 μ L, primer Uni-RP-F and Uni-RP-R is 0.3 μ L, primer Uni-CP-F and Uni-CP-R is 0.3 μ L, universal primer Universal-primer is 6 μ L, and the concentration of each primer is 10 μMs; DNA profiling is 6 μ L, and concentration is 20ng/ μ L.
Preferably, the electrophoresis used in S2. is agarose gel electrophoresis.
More preferably, the method for described agarose gel electrophoresis is: get 5 μ L PCR primer in mass volume ratio be the sepharose of 2%, in 1 × TAE damping fluid, voltage stabilizing 80V electrophoresis 30min.
Described method, can detect " Event 55-1 ", " GM-YK " and " No. Hua Nongyi " three kinds of transgenic papayas simultaneously.
Preferably, described multiple PCR technique is five heavy round pcrs.
Beneficial effect: (1) the present invention successfully develops first and adopts universal primer multiple PCR technique to detect transgenic papaya; (2) universal primer of the present invention can improve the amplification efficiency of multiplex PCR, improve the sensitivity of detection widely, also possess the advantage that multiplex PCR lowers testing cost, in the application of the detection of transgenic papaya, universal primer multiple PCR technique has very high feasibility simultaneously; (3) detection of universal primer multiplex PCR of the present invention is limited to 0.001ng, target dna or lower, improves more than two orders of magnitude than the multiplex PCR effect of general primer.
Accompanying drawing explanation
Fig. 1 is universal primer and Auele Specific Primer (belt lacing) substance PCR specificity verification interpretation of result figure.Wherein, the situation that in figure, each band is corresponding is: 1. primer CP; 2. primer 35S; 3. primer NPTII; 4.Papain primer; 5.RP primer, 6. belt lacing primer CP; 7. belt lacing primer 35S; 8. belt lacing primer NPTII; 9. belt lacing Papain primer; 19. belt lacing RP; M.Marker.
Fig. 2 is the proof diagram of universal primer multiplex PCR.Wherein, the situation that in figure, each band is corresponding is: 1. No. Hua Nongyi, transgenic papaya (belt lacing Papain primer); 2. transgenic papaya " No. Hua Nongyi " (belt lacing 35s primer); 3. transgenic papaya " No. Hua Nongyi " (belt lacing 35s primer and NtpII213 primer); 4. transgenic papaya " No. Hua Nongyi " (belt lacing Papain primer, 35s primer and NtpII213 primer); 5. transgenic papaya GM-YK (containing CP gene) (five kinds of primers); 6. transgenic papaya " No. Hua Nongyi " (containing RP gene) (five kinds of primers); 7 transgenic papaya GM-YK and " No. Hua Nongyi " mixing (five kinds of primers); 8 is blank; M Marker.
Fig. 3 is universal primer multiplex PCR sensitivity analysis figure.Wherein, the situation that in figure, each band is corresponding is:
1. Hua Nongyi 100ng, GM-YK 100ng; 2. Hua Nongyi 10ng, GM-YK 100ng; 3. Hua Nongyi 1ng, GM-YK 100ng; 4. Hua Nongyi 0.1ng, GM-YK 100ng; 5. Hua Nongyi 0.01ng, GM-YK 100ng; 6. Hua Nongyi 0.001ng, GM-YK 100ng; 7. blank; M.Mark.
Embodiment
The method that the universal primer substance adopted in present embodiment embodiment or multiple PCR technique detect transgenic papaya is as follows:
(1) extraction and purification of sample DNA to be tested
Adopt the fresh blade of three kinds of transgenic papayas (Event 55-1, GM-YK and No. Hua Nongyi) and common papaya (No. 2, platform agriculture), the fresh Papaya Leaf getting often kind of kind is about 100mg, add liquid nitrogen fully to grind, extract the DNA of each sample by DNA extraction kit.Ultraviolet spectrophotometry measures concentration and the purity of DNA purification.
(2) design of primers
1 pair of universal primer and 5 as shown in table 1 to the sequence of the Auele Specific Primer being connected to universal primer:
Table 1 detects the PCR primer of transgenic papaya inside and outside source gene
Note: primer concentration is 10 μMs
(3) pcr amplification condition
Amplification adopts reaction system to be 30 μ L, (comprises 0.1U Taq Polymerase/ μ L, 500 μMs of dNTP each, 20mM Tris-HCl (pH8.3), 100mM KCl, 3mM MgCl containing 2 × MasterMix
2, other stablizers and toughener), 10 μMs of primers, DNA profiling concentration is 20ng/ μ L.
Substance and multi-PRC reaction being set to amplification instrument: denaturation (94 DEG C, 3min); 30 circulations: sex change (94 DEG C, 30sec), annealing (62 DEG C, 30sec), extends (72 DEG C, 1min); Stop extending (72 DEG C, 5min).Reaction system is 30 μ L.
Universal primer multi-PRC reaction system of the present invention is in table 2:
Table 2 universal primer multi-PRC reaction system
(4) gel electrophoresis
Get 5 μ L PCR primer in the sepharose of 2% after reaction terminates, in 1 × TAE damping fluid, voltage stabilizing 80V electrophoresis 30min, detects under ultraviolet gel imaging system.
The interpretation of result of embodiment 1 universal primer substance PCR specificity verification
Test according to above-mentioned universal primer multiple PCR method, experimental result as shown in Figure 1:
Can be analyzed by Fig. 1, because composite primer has added one section of universal primer sequence at 5 ' end of original general primer, therefore universal primer increases the large 38bp of product fragment that the product fragment that obtains increases compared with general primer, thus the band of 6,7,8,9,10 swimming lanes compared with 1,2,3,4, the pillar location of 5 swimming lanes is slightly high.Not the specificity of original primer and expanding effect are not had an impact with top connection.And every pair of primers all obtains corresponding specific amplified band, and the brightness of composite primer is higher, illustrates that composite primer is consistent with the specificity of general primer to object fragment, and comparatively speaking, the expanding effect of composite primer is also better.
The checking of embodiment 2 universal primer multiplex PCR
Carry out universal primer multi-PRC reaction according to the method described above, electrophoresis result as shown in Figure 2:
In figure, result shows, the amplification (pillar location) of universal primer multiplex PCR, maintains higher specificity.Compared with the multiplex PCR of general primer, band is more limpid in sight, shows that expanding effect increases.
The sensitivity analysis of embodiment 3 universal primer multiplex PCR
Carry out universal primer multi-PRC reaction according to the method described above, carry out sensitivity analysis.The result of sensitivity is as shown in Figure 3:
Sensitivity the result shows, and amplification efficiency reduces with template amount and reduces, and the sharpness of band also declines thereupon simultaneously, when template amount is 0.001ng, still can arrive object band.So the detection of the heavy PCR of universal primer 5 of the present invention is limited to 0.001ng target dna or lower, improves more than two orders of magnitude than the multiplex PCR effect of general primer.
The applying detection of transgene component in embodiment 4 papaya
With fresh 3 transgenic papaya China's No. 1, agricultures and 3 non-transgenic papaya, the Sucus Chaenomelis genomic dna that the CTAB method of Optimal improvements is extracted is adopted after squeezing the juice, and adopting the transgene component in above-mentioned universal primer PCR method detection papaya, amplification is in table 3.
The amplification of the transgene component in table 3 papaya
Remarks :+expression detects ,-expression does not detect.
As can be seen from the amplification of table 3, in 6 fresh squeezing papayas, 3 magnificent agricultures No. 1 sample all detects corresponding internal standard gene (Papain) and foreign gene (35S, NPTII, RP, CP), and other 3 non-transgenic papayas only detect internal standard gene Papian.Show that this method can be applied to the detection of transgene component in papaya fast and accurately.
The present invention adopts universal primer voluntarily and carries out substance PCR and multiplex PCR experiment with the Auele Specific Primer of joint, verifies the feasibility of this method.Compared with common multiplex PCR system, except containing except each pair of goal gene Auele Specific Primer in universal multiple primer PCR (UP-M-PCR) system, also to play a role containing a pair universal primer Universal-primer, increase, and the universal primer selected by needing to connect above at 5 ' end of every bar Auele Specific Primer becomes composite primer, and universal primer Universal-primer is not owing to having To Template, cannot increase.When Auele Specific Primer is used up, amplified production obtains accumulation to a certain extent, and the product that universal primer starts to obtain is template, carries out sequence amplification (see Fig. 4).
The optimization of PCR reaction system relates to a pair universal primer and five to the Auele Specific Primer with joint, in contrast adds its complexity.Universal primer add the consumption that can reduce composite primer, therefore in the reaction system of 30 μ L, with 6 μ L universal primers, each primer of 0.4 μ L for initial concentration, with 0.1 μ L for concentration gradient is optimized, finally draw the reaction system as table 2, and electrophoresis result and sensitivity the result show primer specificity good (Fig. 1) and significantly competition or suppression phenomenon (Fig. 2) under multiplex PCR system, indicate that the expanding effect of this system is more successful.
Contrast does not add the PCR the result of the Auele Specific Primer of joint, find that the electrophoretic band of Auele Specific Primer no matter in the detection of substance PCR or multiplex PCR with joint is all more limpid in sight, prove that the content that the DNA content after its amplification draws than former Auele Specific Primer PCR is higher; And by the contrast of sensitivity, then directly can contrast and show that universal primer multiplex PCR sensitivity results improves more than three orders of magnitude than the sensitivity of general primer.
Claims (6)
1. utilize universal primer multiple PCR technique to detect a method for transgenic papaya, it is characterized in that, comprise following steps:
S1. design 1 pair of universal primer and 5 to the Auele Specific Primer being connected to universal primer, the sequence of described primer is respectively:
Uni-Papain-F：CCTTCCTTCCTTCCACGCAATCTACAATCTTGCTAACCCTA；
Uni-Papain-R：CCTTCCTTCCTTCCACGCAAGTCATCTTGAGAATAACCCAC；
Uni-35s-F：CCTTCCTTCCTTCCACGCAAAGACGATCTACCCGAGCAA；
Uni-35s-R：CCTTCCTTCCTTCCACGCAGAAGCAAGCCTTGAATCGTC；
Uni-NptII-F：CCTTCCTTCCTTCCACGCACTGTGCTCGACGTTGTCACT；
Uni-NptII-R：CCTTCCTTCCTTCCACGCACTTCCATCCGAGTACGTGCT；
Uni-RP-F：CCTTCCTTCCTTCCACGCACTTTGGTGCGGAAAAGTTGT；
Uni-RP-R：CCTTCCTTCCTTCCACGCACCATAGCCCACAGTCGAATT；
Uni-CP-F：CCTTCCTTCCTTCCACGCAAGAATGTTTGGAATGGACGG；
Uni-CP-R：CCTTCCTTCCTTCCACGCAGCATACCCAGGAGAGAGTGC；
Universal-primer：CCTTCCTTCCTTCCACGCA；
S2. detect: with papaya genomic dna to be detected for template, in PCR reaction, add all primers of S1. design, carry out PCR, electrophoresis, thus learn whether detected papaya is transgenic papaya.
2. method according to claim 1, is characterized in that, the PCR reaction described in S2., and its reaction conditions is: denaturation 94 DEG C, 3min; 30 circulations: sex change 94 DEG C, 30sec, anneals 62 DEG C, and 30sec extends 72 DEG C, 1min; Stop extension 72 DEG C, 5min.
3. method according to claim 1, is characterized in that, the PCR reaction described in S2., and its reaction system is 30 μ L, containing 2 × MasterMix; Primer Uni-Papain-F and Uni-Papain-R is 0.15 μ L, primer Uni-35s-F and Uni-35s-R is 0.2 μ L, primer Uni-NptII-F and Uni-NptII-R is 0.4 μ L, primer Uni-RP-F and Uni-RP-R is 0.3 μ L, primer Uni-CP-F and Uni-CP-R is 0.3 μ L, universal primer Universal-primer is 6 μ L, and the concentration of each primer is 10 μMs; DNA profiling is 6 μ L, and concentration is 20ng/ μ L.
4. method according to claim 3, is characterized in that, the electrophoresis used in S2. is agarose gel electrophoresis.
5. method according to claim 4, is characterized in that, the method for agarose gel electrophoresis is: get 5 μ L PCR primer in mass volume ratio be the sepharose of 2%, in 1 × TAE damping fluid, voltage stabilizing 80V electrophoresis 30min.
6. the method according to any one of Claims 1 to 5, is characterized in that, can detect " Event 55-1 ", " GM – YK " and " No. Hua Nongyi " three kinds of transgenic papayas simultaneously.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510075452.0A CN104673908A (en) | 2015-02-12 | 2015-02-12 | Method for detecting transgenic papaya through universal primer multiple PCR technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510075452.0A CN104673908A (en) | 2015-02-12 | 2015-02-12 | Method for detecting transgenic papaya through universal primer multiple PCR technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104673908A true CN104673908A (en) | 2015-06-03 |
Family
ID=53309490
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510075452.0A Pending CN104673908A (en) | 2015-02-12 | 2015-02-12 | Method for detecting transgenic papaya through universal primer multiple PCR technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104673908A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220397A (en) * | 2018-02-26 | 2018-06-29 | 杭州更蓝生物科技有限公司 | A kind of method for detecting transgenosis pawpaw |
| CN109055592A (en) * | 2018-08-17 | 2018-12-21 | 海南医学院 | A kind of anti-ring spot virus papaya YK16-0-1 of transgenosis and its efficient qualitative, quantitative identification method of spin-off |
| CN114622028A (en) * | 2022-03-07 | 2022-06-14 | 江汉大学 | Primer pair combination, kit and detection method for detecting transgenic papaya |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575648A (en) * | 2009-04-02 | 2009-11-11 | 陈军 | Method for testing multi-PRC reaction of transgenic fruit |
| CN102154454A (en) * | 2010-12-30 | 2011-08-17 | 暨南大学 | Method for detecting transgenosis constituents in plant by GeXP multi-PCR (polymerase chain reaction) technology and application thereof |
| CN102311954A (en) * | 2011-10-18 | 2012-01-11 | 福建农林大学 | Transgenic papaya 55-1 transformation event specific PCR detection method |
-
2015
- 2015-02-12 CN CN201510075452.0A patent/CN104673908A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575648A (en) * | 2009-04-02 | 2009-11-11 | 陈军 | Method for testing multi-PRC reaction of transgenic fruit |
| CN102154454A (en) * | 2010-12-30 | 2011-08-17 | 暨南大学 | Method for detecting transgenosis constituents in plant by GeXP multi-PCR (polymerase chain reaction) technology and application thereof |
| CN102311954A (en) * | 2011-10-18 | 2012-01-11 | 福建农林大学 | Transgenic papaya 55-1 transformation event specific PCR detection method |
Non-Patent Citations (2)
| Title |
|---|
| 白卫滨等: "通用引物多重PCR新技术对番木瓜转基因成分检测的研究", 《现代食品科技》 * |
| 白卫滨等: "采用多重PCR技术检测转基因番木瓜华农一号", 《食品与发酵工业》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108220397A (en) * | 2018-02-26 | 2018-06-29 | 杭州更蓝生物科技有限公司 | A kind of method for detecting transgenosis pawpaw |
| CN109055592A (en) * | 2018-08-17 | 2018-12-21 | 海南医学院 | A kind of anti-ring spot virus papaya YK16-0-1 of transgenosis and its efficient qualitative, quantitative identification method of spin-off |
| CN114622028A (en) * | 2022-03-07 | 2022-06-14 | 江汉大学 | Primer pair combination, kit and detection method for detecting transgenic papaya |
| CN114622028B (en) * | 2022-03-07 | 2023-12-22 | 江汉大学 | Primer pair combination, kit and detection method for detecting transgenic papaya |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Duan et al. | Loop-mediated isothermal amplification for the rapid detection of the F200Y mutant genotype of carbendazim-resistant isolates of Sclerotinia sclerotiorum | |
| CN104673908A (en) | Method for detecting transgenic papaya through universal primer multiple PCR technology | |
| CN105177148B (en) | The double PCR primer of two kinds of grape ulcer bacterium of detection and its application simultaneously | |
| CN110184387B (en) | RT-LAMP detection primer for detecting ANSVV, application thereof, detection reagent and detection method | |
| CN105986044B (en) | Avian influenza virus nucleic acid General rapid detection method | |
| CN103498010B (en) | Primer and kit for rapidly detecting tomato chlorosis virus (ToCV) and application thereof | |
| CN105986043A (en) | Method for quickly detecting nucleic acid of H5 subtype highly pathogenic avian influenza virus | |
| CN110184386B (en) | RT-LAMP (reverse transcription loop-mediated isothermal amplification) detection primer for detecting ANRSV (ANRSV), application thereof, detection reagent and detection method | |
| CN107385108A (en) | A kind of detection kit and its detection method of new marmor upsilon coe virus in lotus rhizome | |
| JP5610466B2 (en) | Method for distinguishing Shikwasha fruits and processed products | |
| KR20210038410A (en) | Specific molecular markers for discrimination of one set of autonomy and red terrestrial species, and differentiation methods and applications | |
| SanJuan-Badillo et al. | Assessment of DNA extraction methods from various maize (Zea mays L.) tissues for environmental GMO monitoring in Mexico: Part I: detection by end-point PCR | |
| WO2023087783A1 (en) | Dna barcode for screening floccularia luteovirens having high total fat content | |
| CN101016554B (en) | Transgene rape Rf3 event exogenesis insertion carrier side sequence and application thereof | |
| CN106521038B (en) | A kind of real-time fluorescence quantitative PCR detection methods of highly sensitive BHV 2 and kit | |
| CN105177138A (en) | Primer and method used for detecting Oidium heveae and application | |
| CN110734998B (en) | Primers, method and kit for identifying NFC orange juice and FC orange juice | |
| Elsanhoty | Genetically modified Roundup Ready soybean in processed meat products in the Kingdom of Saudi Arabia | |
| CN104419761A (en) | Detection kit for buckwheat allergen ingredients by employing loop-mediated isothermal amplification and application method of kit | |
| CN102703605B (en) | Kit for rapidly detecting banana streak virus (BSV) by isothermal gene amplification and use method of kit | |
| CN102367485B (en) | Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer | |
| Antanaviciute et al. | An inexpensive and rapid genomic DNA extraction protocol for rosaceous species | |
| Kidane et al. | Comparison and optimization for DNA extraction of okra (Abelmoschus esculentus L. Moench) | |
| Zaulet et al. | Detection and quantification of GMO and sequencing of the DNA amplified products | |
| CN104498633B (en) | NASBA primer, test kit and the method for detection Peach latent mosaic viroid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150603 |
|
| RJ01 | Rejection of invention patent application after publication |