CN104651511B - A kind of positive plasmid molecule pBI121-Screening and application thereof - Google Patents
A kind of positive plasmid molecule pBI121-Screening and application thereof Download PDFInfo
- Publication number
- CN104651511B CN104651511B CN201510078895.5A CN201510078895A CN104651511B CN 104651511 B CN104651511 B CN 104651511B CN 201510078895 A CN201510078895 A CN 201510078895A CN 104651511 B CN104651511 B CN 104651511B
- Authority
- CN
- China
- Prior art keywords
- pbi121
- screening
- primer
- pcr
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of positive plasmid molecule pBI121 Screening and application thereof, relate to security control and the examination detection technique of genetically modified crops in Transgene-safty field.The base sequence of pBI121 Screening is as shown in SEQ NO.1.Utilize pBI121 Screening as positive control and quality-control sample, can respectively Oryza sativa L., Brassica campestris L, Semen sojae atricolor, Semen Maydis, Cotton Gossypii and the big genetically modified crops sample of Semen Tritici aestivi 6 be carried out regular-PCR and the real-time fluorescence PCR examination detection of transgene component；The present invention solves in genetically modified crops examination detection and lacks positive control or the technical barrier of standard substance, avoid the problem that multiple positive control is set for multiple detection targets in examination detection, reduce human cost and the Financial cost preparing multiple positive control.
Description
Technical field
The present invention relates to security control and the examination detection technique of genetically modified crops in Transgene-safty field, especially
Relate to a kind of positive plasmid molecule pBI121-Screening and application thereof.
Background technology
Over nearly more than 20 years, whole world genetically modified organism research and development and commercialization fast development, 2013, the whole world was existing
27 kinds of crops relate to 336 transformants and are approved to commercially produce, and cultivated area, more than 17.5 hundred million hectares, produces
Huge economic benefit (James, Briefs No.46http://www.isaaa.org/purchasepublications/itemdescription.asp？ItemTyp E=BRIEFS&Control=IB046-2013,2013).Meanwhile, the safety issue one of genetically modified organism
Various circles of society are directly enjoyed to pay close attention to, to this end, including including China, European Union, the U.S., Japan and Korea S etc. more than 50
Individual countries and regions issue and implement GMO bio-safety administrative law Laws & Regulations one after another, with specification genetically modified organism
Research and development and commercial application (Chassy, Global Regulation of Transgenic Crops.
Molecular Genetic Approaches to Maize Improvement,Biotechnology in
Agriculture and Forestry,63,2009,107-124)。
According to supervision needs, researcher have developed different detection methods for different detection targets, including
Examination detection method, structure method for detecting specificity and transformation event method for detecting specificity.Wherein, examination inspection
The target of survey method detection is modal universal component in genetically modified crops, such as CaMV35 promoter, NOS
Terminator etc.；What transformation event method for detecting specificity detected is then the feature of the transfer-gen plant in same source
Sequence.At present, most countries all distinguishes the transgenic product that management is different based on transformation event in the world.
Transgenic industry develops rapidly, constantly has new transformation event to release, and the frequency of field test is also year by year
Soaring, if only using event method for detecting specificity, easily cause the missing inspection of transgenic product.Actually detected and
In law-enforcing work, testing agency carries out examination detection first with examination detection method to sample, does with or without turning base
Judgement because of composition.But detection the carrying out of work, the quality control of testing result and trace to the source and all be unable to do without reference material
Matter.Either at present at the standard substance ground or standard substance on sale, either substrate standard substance is still
Plasmid control material, the overwhelming majority is all based on the needs development of transformation event specific detection, does not meet
The standard substance of transgenic examination detection demand.Detection positive control of transgenic examination at present (standard substance)
Lack and hinder carrying out of detection GMOs work.
In transgenic examination detects, owing to lacking standard substance, only with the transformation event specificity of mixing
Detection standard substance utilizes the mixture of transgenic corns Bt11 and MON810 as reference standard, such as European Union
Standard substance as transgenic paddy rice examination detection.But utilize transformation event specific detection standard substance
Mixture carries out transgenic examination and there is various problems:
1, some special transgenic element does not appears in legal transformation event, so also without correspondence
Standard substance, as hygromycin gene HPT in laboratory research conventional, but complete in commercial varieties
Entirely do not have, cause the detection difficult of this element；
2, general detection GMOs standard substance does not accounts for presence or absence and the copy number ratio of each examination element
Value, when utilizing multiple standards material to be mixed for transgenic examination, the copy number of some element is probably other
The several times of element, when using as positive control, it may not be possible to the sensitivity accurately reflecting each detection parameter is
No one makes peace conformance with standard requirement；
3, Different Crop, even same origin different cultivars, its DNA extraction efficiency may have bigger gap,
Transgenic and non-transgenic raw material DNA is just had been found that in European Union's GMO detection Developments of certified reference samples
There is the difference of more than 30% in extraction efficiency.The different transformation event standard substances of mixing are being used for transgenic sieve
When looking into, some constituents extraction efficiency possible and other compositions have larger difference, cause the mistake that detection sensitivity judges
Difference.
In transgenic examination detects, part testing agency selects according to the target of detection and turns containing respective target target
Change event-specific detection standard substance is as positive control, for multiple detection targets in such examination detection
It is provided with multiple positive control, increases the workload extracting DNA, and in order to investigate DNA mass, also want
The reaction of internal standard gene is set more, has raised testing cost further, increase the workload of detection, for inspection
Survey work brings inconvenience.
In conjunction with above-mentioned consideration, with solution shortage transgenic examination this difficult problem of detection standard substance as point of penetration,
The conventional transgenic examination element of clone and crop internal standard gene, polymerization is building up on binary vector skeleton, develops
Plasmid control material is used in transgenic examination detection.
Through to existing patent and the retrieval of other documents, not yet find any logical about genetically modified crops examination detection
Positive plasmid molecule develop and application report.
Summary of the invention
The purpose of the present invention is that to solve to lack transgenic examination detection standard in detection GMOs work
This difficult problem of material is point of penetration, and the conventional transgenic examination element of clone and crop internal standard gene, polymerization builds
On binary vector skeleton, it is provided that a kind of positive plasmid molecule pBI121-Screening and application thereof, for turning
Gene crops examination detection provides positive control and quality-control sample.
The object of the present invention is achieved like this:
One, positive plasmid molecule pBI121-Screening
Positive plasmid molecule pBI121-Screening is the conventional examination element of a kind of polymerization and six big crop internal standards
The positive plasmid molecule of quasi-gene.
1, build
1. design primer Pmif:5 ' TTACAGCTTGTTGTAAACACGCG3 ' and primer Pmir:5 '
ATGCAAAAACTCATTAACTCAGTGCA, with transgenic corns MIR604 genomic DNA as template, amplification
Go out PMI gene order (SEQ NO 2)；
2. design primer Te9f:5 ' GTTCGAGTATTATGGCATTGGGAA 3 ' and primer Te9r:5 '
AGTGTTTTACTCCTCATATTAACTTCGG 3 ', with transgene rape RT73 genomic DNA as template, expands
Increase and T-e9 terminator sequence (SEQ NO 3)；
3. design primer Hptf:5 ' CTATTTCTTTGCCCTCGGACG 3 ' and primer Hptr:5 '
ATGAAAAAGCCTGAACTCACCG 3 ', with transgenic paddy rice Kemingdao genomic DNA as template, amplifies
HPT gene order (SEQ NO 4)；
4. design primer T35sf:5 ' CGCTGAAATCACCAGTCTCTCTCTAC 3 ' and primer T35sr:5 '
AGCTCGGTACCCCTGGATTTTG 3 ', goes out with transgene rape T45 genomic DNA for template amplification
T-CaMV35S terminator sequence (SEQ NO 5)；
5. design primers F 35sf:5 ' CTCAGGATTTAGCAGCATTCCAGA 3 ' and primers F 35sr:5 '
GCTTTATCTTTGCAATAAAGGCAAA 3 ', with transgene rape RT73 genomic DNA as template, amplification
Go out P-FMV35S promoter sequence (SEQ NO 6)；
6. design primer Barf:5 ' ATGGACCCAGAACGACGCC 3 ' and primer Tg7r:5 '
AGGCCCGGGCGATAAGAAAAGGCAATTTGTAGAT 3 ', with transgene rape MS1 × RF1 genomic DNA
For template, amplify Bar gene (SEQ NO 7)) and the fusion sequence of T-3g7 terminator (SEQ NO 8)
Row；
Use Overlap extension PCR by 6 fragments (PMI, T-e9, HPT, T-CaMV35S, P-FMV35S of clone
And Bar-T-3g7) it is spliced into a big fragment, the sequence of a length of 4142bp；
By the full length DNA sequence of splicing on XmaI endonuclease digestion rear clone to carrier pBI121；pBI121
Carrier contains P-NOS promoter and the resistant gene NPTII of T-NOS terminator regulating and expressing, and P-CaMV35S
Promoter and the reporter gene GusA of T-NOS terminator regulating and expressing；Double by restriction endonuclease EcoRI and XmaI
Enzyme action pBI121, eliminates the P-NOS terminator of reporter gene GusA and redundancy on this carrier, and retains
P-NOS promoter (SEQ NO 9) on pBI121 carrier, NPTII (SEQ NO 10), T-NOS are eventually
Only son (SEQ NO 11)) and P-CaMV 35S promoter (SEQ NO 12)；Plus 7 external sources inserted
Element (PMI, T-e9, HPT, T-CaMV35S, P-FMV35S, Bar and T-3g7), load in the middle of structure
Altogether containing 11 foreign elements (Fig. 2) on body；
By six big crop internal standard genes (Oryza sativa L. SPS, PLD, Brassica campestris L HMG I/Y, CruA, Semen sojae atricolor Lectin,
Semen Maydis zSSIIb, Cotton Gossypii SadIe and Semen Tritici aestivi Waxy-D1) detection target sequence be spliced together (Fig. 3),
It is spliced into the sequence (SEQ NO 13) of a segment length 1742bp；By the crop internal standard gene fusion sequence committee of splicing
The raw work synthesis of torr Shanghai, and install on pUC57 plasmid；6 big crop internal standard gene fusion sequences are passed through PmeI
Enzyme cutting clone, on the intermediate carrier equipped with 11 foreign elements, constructs polymerization 11 examination elements and 6
Positive plasmid molecule pBI121-Screeing (Fig. 1) of big crop internal standard gene.
2, feature
1. base sequence is as shown in SEQ NO.1, and its region of DNA contains 11 exogenous gene elements, and 6 your writings
Thing includes the internal standard gene of Oryza sativa L., Brassica campestris L, Semen sojae atricolor, Semen Maydis, Cotton Gossypii and Semen Tritici aestivi；
2. the base being positioned at the 9265th to 1106 is six big crop internal standard gene qualitative and quantitative detection targets
Fusion sequence, be that Oryza sativa L. internal standard gene SPS detection target, Oryza sativa L. internal standard gene PLD detect target successively
In mark, Semen sojae atricolor internal standard gene Lectin detection target, Cotton Gossypii internal standard gene SadI detection target, Brassica campestris L
Mark gene HMG I/Y detection target, Brassica campestris L internal standard gene CruA detect target, Semen Maydis internal standard gene zSSIIb
General detection target and Semen Tritici aestivi internal standard gene Waxy-D1 detect target；
3. the fusion sequence that the base of the 1103rd to 18385 is 11 exogenous gene elements it is positioned at, successively
It is P-NOS promoter, NPTII gene, T-NOS terminator, T-CaMV35S terminator, P-CaMV35S
Promoter, T-3g7 terminator, Bar gene, P-FMV35S promoter, HPT gene, T-e9 terminator,
Pmi gene；
4. the above sequence is the characteristic sequence of positive plasmid molecule pBI121-Screening, can serve as
Transgenic paddy rice, transgene rape, genetically engineered soybean, transgenic corns, transgene cotton and transgenic paddy rice
Positive control during examination detection and quality-control sample.
Two, the application of positive plasmid molecule pBI121-Screening
1, utilize pBI121-Screening as positive control and quality-control sample, Oryza sativa L. sample is turned base
Regular-PCR and real-time fluorescence PCR examination detection because of composition:
Primer combination (primer/the probe groups of synthesis Oryza sativa L. internal standard gene SPS (PLD) and exogenous gene element
Close)；Extract sample total DNA, be utilized respectively the primer combination (primer/probe of internal standard gene and foreign elements
Combination) positive plasmid molecule and sample gene group DNA are carried out PCR amplification；Regular-PCR product is with agarose
Gel electrophoresis separates, and identifies whether there is amplified production after EB dyeing；Real-time fluorescence PCR product according to whether
Typical amplification curve is had to determine whether amplified production；Normally expand and in sample in Oryza sativa L. at positive plasmid molecule
In the case of standard gene normally expands, then illustrate Oryza sativa L. sample becomes containing transgenic as there is amplified production
Point.
2, utilize pBI121-Screening as positive control and quality-control sample, Brassica campestris L sample is turned base
Regular-PCR and real-time fluorescence PCR examination detection because of composition:
Synthesis Brassica campestris L internal standard gene HMG I/Y (CruA) and exogenous gene element primer combine (primer/
Probe combinations)；Extracting sample total DNA, the primer combination being utilized respectively internal standard gene and foreign elements (is drawn
Thing/probe combinations) positive plasmid molecule and sample gene group DNA are carried out PCR amplification；Regular-PCR product
Separate with agarose gel electrophoresis, after EB dyeing, identify whether there is amplified production；Real-time fluorescence PCR product
According to whether there is typical amplification curve to determine whether amplified production；Normally expand and sample at positive plasmid molecule
In the case of middle Brassica campestris L internal standard gene normally expands, then illustrate in Brassica campestris L sample containing turning as there is amplified production
Gene element.
3, utilize pBI121-Screening as positive control and quality-control sample, soybean sample is turned base
Regular-PCR and real-time fluorescence PCR examination detection because of composition:
Primer combination (primer/probe combinations) of synthesis Semen sojae atricolor internal standard gene Lectin and exogenous gene element；
Extract sample total DNA, be utilized respectively primer combination (primer/probe combinations) of internal standard gene and foreign elements
Positive plasmid molecule and sample gene group DNA are carried out PCR amplification；Regular-PCR product is with agarose gel electricity
Swimming separates, and identifies whether there is amplified production after EB dyeing；Real-time fluorescence PCR product is according to whether there is typical case
Amplification curve determines whether amplified production；Normally expand and Semen sojae atricolor internal standard base in sample at positive plasmid molecule
In the case of normal amplification, then illustrate in soybean sample containing transgene component as there is amplified production.
4, utilize pBI121-Screening as positive control and quality-control sample, corn sample is turned base
Regular-PCR and real-time fluorescence PCR examination detection because of composition:
Primer combination (primer/probe combinations) of synthesis Semen Maydis internal standard gene zSSIIb and exogenous gene element；
Extract sample total DNA, be utilized respectively primer combination (primer/probe combinations) of internal standard gene and foreign elements
Positive plasmid molecule and sample gene group DNA are carried out PCR amplification；Regular-PCR product is with agarose gel electricity
Swimming separates, and identifies whether there is amplified production after EB dyeing；Real-time fluorescence PCR product is according to whether there is typical case
Amplification curve determines whether amplified production；Normally expand and Semen Maydis internal standard base in sample at positive plasmid molecule
In the case of normal amplification, then illustrate in corn sample containing transgene component as there is amplified production.
5, utilize pBI121-Screening as positive control and quality-control sample, cotton samples is turned base
Regular-PCR and real-time fluorescence PCR examination detection because of composition:
Primer combination (primer/probe combinations) of synthesis Cotton Gossypii internal standard gene SadI and exogenous gene element；
Extract sample total DNA, be utilized respectively primer combination (primer/probe combinations) of internal standard gene and foreign elements
Positive plasmid molecule and sample gene group DNA are carried out PCR amplification；Regular-PCR product is with agarose gel electricity
Swimming separates, and identifies whether there is amplified production after EB dyeing；Real-time fluorescence PCR product is according to whether there is typical case
Amplification curve determines whether amplified production；Normally expand and Cotton Gossypii internal standard base in sample at positive plasmid molecule
In the case of normal amplification, then illustrate in cotton samples containing transgene component as there is amplified production.
6, utilize pBI121-Screening as positive control and quality-control sample, wheat samples is turned base
Regular-PCR and real-time fluorescence PCR examination detection because of composition:
Primer combination (primer/the probe groups of synthetic wheat internal standard gene Waxy-D1 and exogenous gene element
Close)；Extract sample total DNA, be utilized respectively the primer combination (primer/probe of internal standard gene and foreign elements
Combination) positive plasmid molecule and sample gene group DNA are carried out PCR amplification；Regular-PCR product is with agarose
Gel electrophoresis separates, and identifies whether there is amplified production after EB dyeing；Real-time fluorescence PCR product according to whether
Typical amplification curve is had to determine whether amplified production；Normally expand and in sample in Semen Tritici aestivi at positive plasmid molecule
In the case of standard gene normally expands, then illustrate wheat samples becomes containing transgenic as there is amplified production
Point.
Compared with prior art, the present invention has following advantages and a good effect:
1. the positive plasmid molecule pBI121-Screening that genetically modified crops examination detection is general is provided；
2. pBI121-Screening has been polymerized 11 conventional examination detections of genetically modified crops examination detection
Target and the internal standard gene order of 6 big crops；
3. pBI121-Screening can be used as transgenic paddy rice, transgene rape, genetically engineered soybean, turns base
Positive control and quality-control sample because of Semen Maydis, transgene cotton and transgenic wheat examination detection；
4. solve in genetically modified crops examination detection and lack positive control or the technical barrier of standard substance, it is to avoid
The problem arranging multiple positive control in examination detection for multiple detection targets, reduces that to prepare multiple positive right
According to human cost and Financial cost；
5. it is applicable to transgenic paddy rice, transgene rape, genetically engineered soybean, transgenic corns, transgenic cotton
Flower and transgenic wheat and goods thereof implement examination detection, monitoring and security control.
Accompanying drawing explanation
Fig. 1 is positive plasmid molecule pBI121-Screening structure chart；
Fig. 2 is the fusion structure figure of transgenic examination 11 foreign elements of detection；
Fig. 3 is the fusion structure figure of six big crop internal standard genes；
Fig. 4 is to use in qualitative PCR method validation positive plasmid molecule in 11 foreign elements and 6 big crops
The detection target of standard gene
Foreign elements detection on a, plasmid molecule, target order: 1, P-CaMV35S primer combination 1,2,
P-CaMV35S primer combination 2,3, P-CaMV35S primer combination 3,4, P-FMV35S primer combination 1,5,
P-FMV35S primer combination 2,6, P-NOS, 7, T-NOS primer combination 1,8, T-NOS primer combination 2,
9, T-CaMV35S, 10, T-3g7,11, T-e9,12, PMI, 13, Bar, 14, NPTII primer sets
Conjunction 1,15, NPTII primer combination 2,16, NPTII primer combination 3,17, HPT；
6 big crop internal standard gene test on b, plasmid molecule, target order: 1, SPS, 2, zSSIIb,
3, Sad1,4, lectin, 5, CruA, 6, zSSIIb, 7, Waxy-D1.
Fig. 5 is to use 11 foreign elements and 6 your writings in real time fluorescent PCR method checking positive plasmid molecule
The detection target of thing internal standard gene；
Fig. 6 is to utilize positive plasmid molecule pBI121-Screening to do positive control, uses regular-PCR pair
Part Oryza sativa L., Brassica campestris L, Semen sojae atricolor, Semen Maydis, Cotton Gossypii and wheat breed carry out transgene component examination detection.
A, Oryza sativa L. internal standard gene SPS detect
Sampfe order: 1, transgenic paddy rice TT51-1,2, Kemingdao, 3, rich No. 6 of section, 4, LLRICE62,
5、pBI121-Screening；
B, Semen sojae atricolor internal standard gene Lectin detect
Sampfe order: 1, genetically engineered soybean A5547-127,2, GTS-40-3-2,3, MON89788,4,
pBI121-Screening；
C, Brassica campestris L internal standard gene C ruA detect
Sampfe order: 1, genetically modified rape GT 73,2, Topas 19/2,3, T45,4, MS1,5, RF1,
6RF2,7, MS8,8, RF3,9, pBI121-Screening；
D, Semen Maydis internal standard gene zSSIIb detect
Sampfe order: 1, transgenic corns Bt176,2, Bt11,3, MON863,4, MIR604,5,
MON89034,6, TC1507,7,59122,8, MIR162,9, pBI121-Screening；
E, Cotton Gossypii internal standard gene SadI detect
Sampfe order: 1, transgene cotton MON1445,2, MON531,3, MON15985,4, MON88913,
5, LL25,6, pBI121-Screening；
F, Semen Tritici aestivi internal standard gene Waxy-D1 detect
Sampfe order: 1, middle wheat 895,2, new wheat 21,3, pBI121-Screening；
G, P-CaMV35S promoter detection
Sampfe order: 1, A5547-127,2, GTS-40-3-2,3, KMD1,4, KF6,5, Topas 19/2,
6, T45,7, Bt76,8, Bt11,9, MON1445,10, pBI121-Screening；
H, P-NOS promoter detection
Sampfe order: 1, KMD1,2, MS1,3, RF1,4, RF2,5, pBI121-Screening；
I, P-FMV35S promoter detection
Sampfe order: 1, GT73,2, MON89034,3, pBI121-Screening；
J, NPTII gene test
Sampfe order: 1, KMD1,2, MS1,3, RF1,4, RF2,5, MON863,6, MON1445,
7, MON15985,8, pBI121-Screening；
K, Bar gene test
Sampfe order: 1, LLRICR62,2, MS1,3, MS8,4, RF1,5, RF2,6, RF3,7,
LL25,8, BT176,9, pBI121-Screening；
L, HPT gene test
Sampfe order: 1, KMD1,2, KF6,3, pBI121-Screening；
M, PMI gene test
Sampfe order: 1, MIR604,2,3272,3, MIR162,4, pBI121-Screening；
N, T-NOS terminator detects
Sampfe order: 1, TT51-1,2, KF6,3, MS1,4, RF1,5, RF2,6, BT11,7,
MON863,8, GTS40-3-2,9, MON1445,10, pBI121-Screening；
Q, T-CaMV35S terminator detects
Sampfe order: 1, KF6,2, LLRICR62,3, TOPAS19-2,4, T45,5BT176,6,
TC1507,7,3272,8, MIR162,9, A5547-127,10, pBI121-Screening；
P, T-e9 terminator detects
Sampfe order: 1, GT73,2, MON89788,3, MON1445,4, MON88913,5,
pBI121-Screening；
Q, T-3g7 terminator detects
Sampfe order: 1, MS1,2, MS8,3, RF1,4, RF2,5, RF3,6, pBI121-Screening；
Fig. 7 utilizes plasmid molecule pBI121-Screening to do positive control, to part Oryza sativa L., Brassica campestris L, turns
Semen sojae atricolor, Semen Maydis, Cotton Gossypii and wheat breed carry out real-time fluorescence PCR examination detection
A is the transgene component examination detection of Oryza sativa L.；
B is the transgene component examination detection of Semen sojae atricolor；
C is the transgene component examination detection of Semen Maydis；
D is the transgene component examination detection of Brassica campestris L；
E is the transgene component examination detection of Cotton Gossypii；
F is the transgene component examination detection of Semen Tritici aestivi.
Detailed description of the invention
Below in conjunction with the accompanying drawings with embodiment to the detailed description of the invention:
1, the structure of positive plasmid molecule pBI121-Screening
1.1, the genomic DNA of transgenic line is extracted
First 20%SDS is preheating to 65 DEG C, takes 15ml SDS and extract buffer (0.1TrisHCl, 0.05M
EDTA, 1M NaCl pH8.0) join 50ml centrifuge tube, add 2.5 μ l beta-mercaptoethanols, mixed
Even；Blade about liquid nitrogen grinding 3g, goes to the 50ml 50ml centrifuge tube containing extracting buffer by powder
In, mixing of vibrating on the oscillator, add the 20%SDS of 2ml preheating, mixing, 65 DEG C of water-baths are at least
30 minutes, test tube to be shaken gently for；After water-bath, rapidly centrifuge tube is placed on ice, adds 3ml 3M KAc,
Mixing, places 30 minutes on ice；4 DEG C of 5000g are centrifuged 5min；Supernatant is transferred to new 50ml
In centrifuge tube, add the isopropanol of 2/3 volume, mixing, place more than 30min for-20 DEG C；6000g, 4 DEG C
Centrifugal 15min, outwells supernatant, washes one time with 75% ethanol, and ultra-pure water dissolving DNA is used in vacuum drying,
After dissolving, transfer the solution in the centrifuge tube of 15ml；E.C. 3.4.21.64 is added by the 1% of DNA volume of dissolution, 55 DEG C
Water-bath 30min；Adding equal-volume phenol, mixing, jog 30min, 8000g are centrifuged 10min；In transfer
Clearly in new tube, add isopyknic phenol chloroform-isoamyl alcohol (25:24:1), jog 20min,
8000g is centrifuged 15min；Transfer supernatant, in new centrifuge tube, adds isopyknic chloroform-isoamyl alcohol (24:1),
Jog 20min, 8000g are centrifuged 15min；Drawing supernatant, often pipe adds 5 μ l RNase, mixing, 37 DEG C
Water-bath 1hr degradation of rna；With isopyknic phenol extraction once, jog 20min, 8000g are centrifuged 15min；
Transfer supernatant, in new centrifuge tube, adds isopyknic chloroform-isoamyl alcohol (24:1), jog 20min, 8000g
Centrifugal 15min；Suct and reset and add into 1/10 volume 3M NaAC, mix, addition equal-volume isopropanol ,-20 DEG C
Place 30min, precipitate DNA；6000g, 4 DEG C of centrifugal 15min, outwell supernatant, wash 2 with 75% ethanol
Time, it is centrifuged and removes 75% ethanol, vacuum drying；After drying, standby with ultra-pure water dissolving DNA.
1.2, transgenic examination element clone, splice and build
Design Pmi gene primer Pmif:5 ' TTACAGCTTGTTGTAAACACGCG3 ' and primer Pmir:5 '
ATGCAAAAACTCATTAACTCAGTGCA,；Design Te9 terminator primer Te9f:5 '
GTTCGAGTATTATGGCATTGGGAA 3 ' and Te9r:5 ' AGTGTTTTACTCCTCATATTAACTTCGG
3’,；Design HPT gene primer Hptf:5 ' CTATTTCTTTGCCCTCGGACG 3 ' and Hptr:5 '
ATGAAAAAGCCTGAACTCACCG 3’；Design T-CaMV35S terminator primer T35sf:5 '
CGCTGAAATCACCAGTCTCTCTCTAC 3 ' and T35sr:5 ' AGCTCGGTACCCCTGGATTTTG 3 '；
Design P-FMV35S promoter primer F35sf:5 ' CTCAGGATTTAGCAGCATTCCAGA 3 ' and F35sr:
5’GCTTTATCTTTGCAATAAAGGCAAA 3’；Design Bar gene and T97 terminator fusion sequence primer
Barf:5 ' ATGGACCCAGAACGACGCC 3 ' and Tg7r:5 '
AGGCCCGGGCGATAAGAAAAGGCAATTTGTAGAT 3’。
Utilize the primer of design, carry out PCR amplification with the genomic DNA extracted for template.PCR amplification system
(50 μ l) contains: 1 × KOD Plus buffer, MgSO41mmol/L, every kind of dNTP 0.2mmol/L,
Genomic DNA 1 μ l, high-fidelity KOD Plus 1U.Amplification program employing two-step method: 94 DEG C of 2min；94℃
30sec, 68 DEG C of 90sec, carry out 25 circulations；Stop after 68 DEG C of 2min, take 5 μ l PCR primer and exist
Electrophoresis detection is carried out on the agarose gel of 1%.Amplified fragments is connected to pAmp cloning vehicle, converts large intestine
Bacillus Top10, extracts plasmid standby after picking monoclonal sequence verification.
Utilizing recombinant PCR technology, be cloned into 6 fragments are first spliced by two-by-two, obtain 3 fragments,
Again in these 3 fragments two are spliced, form 1 large fragment, finally 2 fragment assemblies are become one
The molecule of restructuring.When two fragments being spliced, need to carry out two-wheeled PCR every time.Use and above-mentioned reaction
Identical PCR amplification system, two-wheeled amplification program is 94 DEG C of 2min；94 DEG C of 30sec, 57 DEG C of 30sec,
68 DEG C of 1min (length of PCR primer often increases 1Kb, and extension of time increases 1min accordingly), carry out 25
Circulation；Stop after 68 DEG C of 2min.The template that two-wheeled reaction uses is different with primer.In the first round reacts,
Two individual system amplified fragments 1,2 respectively, using the plasmid with purpose fragment as template, 5 ' ends of fragment 1
Primer uses the M13F (-47) on carrier, 3 ' end primers to use the primer of gene internal；And the 5 ' of fragment 2
End primer uses the primer of gene internal, 3 ' end primers to use the M13R (-48) on carrier.Amplification obtains
Two sections of PCR primer, two fragments are respectively at calf intestine alkaline phosphatase (CIP), T4 polynueleotide kinase
Coupled reaction is carried out after reason (T4PNK).Linked system is as follows: 1 × T4 DNA Ligase buffer, fragment
14.5 μ l, fragment 24.0 μ l, T4 DNA Ligase 0.5 μ l.Take 1 μ l after connecting 2hrs and make mould
Plate carries out second and takes turns reaction, uses 5 ' terminal specific primers and 3 ' the terminal specific primers of fragment 2 of fragment 1,
After electrophoresis detection, purification is connected to carrier pAMP, selects positive colony extracting plasmid and carries out next round recombinant PCR.
The element sequences of restructuring splicing is cloned on pBI121 carrier, first carries with EcoR I enzyme action pBI121
Body, and with T4 archaeal dna polymerase filling-in end, the most again by Xma I enzyme action carrier and element sequences.By enzyme
Carrier after cutting and element sequences purification, convert large intestine bar after connecting 2 hours at 22 DEG C with T4 DNA ligase
Bacterium, picks out positive colony, PCR and digestion verification correct Hou Songsanbo Radix Polygalae company and checks order.
1.3, the clone of six big crop internal standard genes and structure
Six big crop Oryza sativa L., Brassica campestris L, Semen sojae atricolor, Semen Maydis, Cotton Gossypii and the internal standard of Semen Tritici aestivi issued according to the Ministry of Agriculture
The national standard of gene tester, the detection target of selected six big crop internal standard genes.By in six big crops
Standard gene (Oryza sativa L. SPS, PLD, Brassica campestris L HMG I/Y, CruA, Semen sojae atricolor Lectin, Semen Maydis zSSIIb,
Cotton Gossypii SadIe and Semen Tritici aestivi Waxy-D1) detection target sequence be spliced together.Crop internal standard base by splicing
Because fusion sequence entrusts Shanghai raw work synthesis, and install on pUC57 plasmid.
Internal standard gene fusion primers F Primer:5' according to synthesis
TcaaacactgatagtttCatctgtttactcgtcaagtgtcatctcctgaag 3' and
R Primer:5'ccttcagtttCggtgttcctccattgcgaaacggtg 3', to carry internal standard base
Because the pUC57 of fusion sequence is that template carries out PCR reaction.T4 archaeal dna polymerase shows 5 '-3 at 12 DEG C '
Polymerase activity and stronger 3 '-5 ' 5 prime excision enzyme activity, by adding certain dNTP, T4 DNA in system
Polymerase can carry out 3 '-5 to PCR primer ' carry out enzyme action until the position of specific dNTP stops.PCR
Rear recovery purpose fragment, under the effect of T4 archaeal dna polymerase, successively adds dCTP, dGTP and carries out clearing up reaction.
The pBI121 carrier PmeI enzyme action of foreign gene-carrying fusion sequence, the most also at T4 archaeal dna polymerase
Under effect, successively add dCTP, dGTP and carry out clearing up reaction.By clearing up reaction, PCR primer and carrier produce
Raw identical sticky end, is then attached, and converts, screening positive clone.
The positive colony of screening is delivered the order-checking of order-checking company.
2, the checking of positive plasmid molecule pBI121-Screening
2.1, regular-PCR method validation
According to the standard issued or document, the common PCR primers of 11 exogenous gene elements of synthesis.PMI base
Cause: primer PMIF43 5 '-AGCAAAACGGCGTTGACTGA-3 ' and PMIR303 5 '-GTTTGGATGAA
CCTGAATGGAGA-3’；Bar gene: primer BarF73 5 '-GTCAACCACTACATCGAGACAAGC-3 '
With BarR332 5 '-AGCAGGTGGGTGTAGAGCGT-3 '；HPTII gene: primer HPTIIF226 5 '
-GAAGTGCTTGACATTGGGGAGT-3 ' and HPTIIR697 5 '-AGATGTTGGCGACCTCGTATT-3 '；
P-NOS promoter: primer PNOS-F1 5 '-GCCGTTTTACGTTTGGAACTG-3 ' and PNOS-R1
5’-TTATGGAACGTCAGTGGAGC-3’；T-CaMV35S terminator: primer T35S-F1 5 '-GTTTCG
CTCATGTGTTGAGC-3 ' and T35S-R1 5 '-GGGGATCTGGATTTTAGTACTG-3 '；TE9 terminator:
Primer Te9-f27 5 '-GGTCATTAGAGGCCACGATTT-3 ' and Te9-R294 5 '-CGAGTATTATG
GCATTGGGAAA-3’；Tg7 terminator: primer tg7-F 5 '-ATGCAAGTTTAAATTCAGAAATATTTC
AA-3 ' and tg7-R 5 '-ATGTATTACACATAATATCGCACTCAGTCT-3 '；P-FMV35S promoter:
Primer combination 1FMV35S-F1 5 '-AAGACATCCACCGAAGACTTA-3 ' and FMV35S-R1 5 '-AGG
ACAGCTCTTTTCCACGTT-3 ', primer combination 2FMV-1 5 '-AAGCCTCAACAAGGTCAG-3 ' and F
MV-2 5’-CTGCTCGATGTTGACAAG-3’；P-CaMV35S promoter: primer combines 1 35S-F1 5 '
-GCTCCTACAAATGCCATCATTGC-3 ' and 35S-R1 5 '-GATAGTGGGATTGTGCGTCATCCC-
3 ', primer combines 2 35S-1 5 '-GCTCCTACAAATGCCATCA-3 ' and 35S-2 5 '-GATAGTGGG
ATTGTGCGTCA-3 ', primer combines 3 35SEnh187F 5 '-CATCATTGCGATAAAGGAAAGGC-3 '
With 35SEnh311R 5 '-TGCTTTGAAGACGTGGTTGGA-3 '；T-NOS terminator: primer combines 1 NO
S-F1 5 '-GAATCCTGTTGCCGGTCTTG-3 ' and NOS-R1 5 '-TTATCCTAGTTTGCGCGCTA-3 '；
Primer combines 2 HA-nos118-f 5 '-GCATGACGTTATTTATGAGATGGG-3 ' and HA-nos118
-r 5’-GACACCGCGCGCGATAATTTATCC-3’；NPTII gene: primer combines 1 NPTIIF68 5 '
-ACTGGGCACAACAGACAATCG-3 ' and NPTIIR356 5 '-GCATCAGCCATGATGGATACTTT-3 ',
Primer combines 2 NPTII TN5-1 5 '-GGATCTCCTGTCATCT-3 ' and 5 '-TN5-2 GATCATCCT
GATCGAC-3 ', primer combines 3 APH2 short 5 '-CTCACCTTGCTCCTGCCGAGA-3 ' and APH2
reverse 5’-CGCCTTGAGCCTGGCGAACAG-3’。
According to the standard issued, the common PCR primers of synthesis six big crop internal standard genes.Semen Maydis internal standard base
Because of zSSIIb: primer zSSIIb-1F 5 '-CTCCCAATCCTTTGACATCTGC-3 ' and zSSIIB-2R
5’-TCGATTTCTCTCTTGGTGACAGG-3’；Semen sojae atricolor internal standard gene Lectin: primer Lec-1672F
5 '-GGGTGAGGATAGGGTTCTCTG-3 ' and Lec-1881R 5 '-GCGATCGAGTAGTGAGAGTCG-3 '；
Oryza sativa L. internal standard gene SPS:SPS-F 5 '-ATCTGTTTACTCGTCAAGTGTCATCTC-3 ' and SPS
-R 5’-GCCATGGATTACATATGGCAAGA-3’；Brassica campestris L internal standard gene C ruA:CruAF398 5 '-
GGCCAGGGCTTCCGTGAT-3 ' and CruAR547 5 '-CTGGTGGCTGGCTAAATCGA-3 ', in Brassica campestris L
Standard gene HMG I/Y:hmg-F 5 '-TCCTTCCGTTTCCTCGCC-3 ' and hmg-R 5 '-TTCCACG
CCCTCTCCGCT-3’；Cotton Gossypii internal standard gene Sad1: primer Sad1-F 5 '-TGGCCTCTAATCATTGT
TATGATG-3 ' and Sad1-R 5 '-TTGAGGTGAGTCAGAATGTTGTTC-3 '；Semen Tritici aestivi internal standard gene
Waxy-D1: primer Waxy-D1-1F 5 '-GTCGCGGGAACAGAGGTGT-3 ' and Waxy-D1-1R 5 '-
GGTGTTCCTCCATTGCGAAA-3’。
Utilize synthesis common PCR primers, with build positive plasmid molecule as template, carry out PCR amplification.
PCR reaction uses 25ul reaction system, and containing 1 μ L positive plasmid molecule, 1 × PCR Buffer is (containing 10mM
Tris HCl pH8.3, KCl 50mM), the forward of 200uM dNTPs, 2.5mM MgCl2,250nM draws
Thing and reverse primer, DNATaq enzyme 1u.Response procedures is, 94 DEG C of 2 minutes denaturations, 94 DEG C 15 seconds,
60 DEG C 30 seconds, 72 DEG C 30 seconds, 35 times circulation, 72 DEG C be incubated 2 minutes.PCR primer is with agarose
Gel electrophoresis separates, and identifies whether there is amplified production after EB dyeing.
2.2, real time fluorescent PCR method checking
According to the standard issued or the document delivered, the real-time fluorescence PCR of 11 exogenous gene elements of synthesis draws
Thing/probe.PMI gene: primer PMI-F240 5 '-ACTGCCTTTCCTGTTCAAAGTATTAT-3 ' and
PMI-R335 5 '-TCTTTGGCAAAACCGATTTCAGAA-3 ', probe PMI-267P 5 '-CGCAGCACA
GCCACTCTCCATTCAGG-3’；Bar gene: primer RapB-F1 5 '-ACAAGCACGGTCAACTTCC-
3 ' and RapB-R1 5 '-GAGGTCGTCCGTCCACTC-3 ', probe RapB-P 5 '-TACCGAGCCGCA
GGAACC-3’；T-NOS terminator primer/probe combinations 1: primer NOS-F2 5 '-ATCGTTCAAACATT
TGGCA-3 ' and NOS-R2 5 '-ATTGCGGGACTCTAATCATA-3 ', probe NOS-P 5 '-CATCGC
AAGACCGGCAACAGG-3’；T-NOS terminator primer/probe combinations 2 180-F 5 '-CATGTAATGCAT
GACGTTATTTATG-3 ' and 180-R 5 '-TTGTTTTCTATCGCGTATTAAATGT-3 ', probe 180-p
5’-ATGGGTTTTTATGATTAGAGTCCCGCAA-3’；NPTII gene: primer qNPTIIF72 5 '-CT
ATGACTGGGCACAACAGACA-3 ' and qNPTIIR172 5 '-CGGACAGGTCGGTCTTGACA-3 ', visits
Pin qNPTIIFP99 5 '-CTGCTCTGATGCCGCCGTGTTCCG-3 '；P-NOS promoter primer combination 1:
Primer PNOS-QF 5 '-GACAGAACCGCAACGTTGAA-3 ' and primer PNOS-QR 5 '-TTCTGACG
TATGTGCTTAGCTCATT-3 ', probe PNOS-QP 5 '-AGCCACTCAGCCGCGGGTTTC-3 '；P-NOS
Promoter primer combination 2: primer p-nos-R 5 '-TCAGTGGAGCATTTTTGACAAGAA-3 ' and p-
Nos-F1 5 '-AAGCACATACGTCAGAAACCATTATT-3 ', probe p-nos-Tm 5 '-CGCGTTCAAA
AGTCGCCTAAGGTCAC-3’；T-CaMV35S terminator: primer T35-QF 5 '-GTTTCGCTCATGTGT
TGAGC-3 ' and T35-QR 5 '-GGGGATCTGGATTTTAGTACTG-3 ', probe T35-QP 5 '-GAAA
CCCTTAGTATGTATTTGTATTTG-3’；P-FMV35S promoter: primers F MV35S-QF 5 '-AAGACA
TCCACCGAAGACTTA-3 ' and FMV35S-QR 5 '-AGGACAGCTCTTTTCCACGTT-3 ', probe F M
V35S-Qp 5’-TGGTCCCCACAAGCCAGCTGCTCGA-3’；P-CaMV35S promoter: primer 35SEn
H187F 5 '-CATCATTGCGATAAAGGAAAGGC-3 ' and 35SEnh311R 5 '-TGCTTTGAAGACGT
GGTTGGA-3 ', probe 35SEnh230P 5 '-CCGACAGTGGTCCCAAAGATGG-3 '；Te9 terminator:
Primer tE9-F 5 '-TGAGAATGAACAAAAGGACCATATCA-3 ' and tE9-R 5 '-TTTTTATTCGGT
TTTCGCTATCG-3 ', probe tE9-P 5 '-TCATTAACTCTTCTCCATCCATTTCCATTTCACAGT-3 '；
Tg7 terminator: primer tg7-F 5 '-ATGCAAGTTTAAATTCAGAAATATTTCAA-3 ' and tg7-R 5 '
-ATGTATTACACATAATATCGCACTCAGTCT-3 ', probe tg7-P 5 '-ACTGATTATATCAGCTGGT
ACATTGCCGTAGATGA-3’。
According to the national standard issued, the primer of synthesis six big crop internal standard genes and probe sequence.In Semen Maydis
Standard gene zSSIIb gene: primer zSSIIb-3F 5 '-CGGTGGATGCTAAGGCTGATG-3 ' and zS
SIIb-4R 5 '-AAAGGGCCAGGTTCATTATCCTC-3 ', probe zSSIIb-P 5 '-TAAGGAGCACTC
GCCGCCGCATCTG-3’；Semen sojae atricolor internal standard gene Lectin: primer Lec-1215F 5 '-GCCCTCTACT
CCACCCCCA-3 ' and Lec-1332R 5 '-GCCCATCTGCAAGCCTTTTT-3 ', probe Lec-1269P
5’-AGCTTCGCCGCTTCCTTCAACTTCAC-3’；Oryza sativa L. internal standard gene SPS: primer qSPS-F 5 '-
TTGCGCCTGAACGGATAT-3 ' and qSPS-R 5 '-CGGTTGATCTTTTCGGGATG-3 ', probe qSPS
-P 5’-TCCGAGCCGTCCGTGCGTC-3’；Oryza sativa L. internal standard PLD gene: primer PLD-KVM159 5 '
-TGGTGAGCGTTTTGCAGTCT-3 ' and PLD-KVM160 5 '-CTGATCCACTAGCAGGAGGTCC-3 ',
Probe PLD-TM013 5 '-TGTTGTGCTGCCAATGTGGCCTG-3 '；Brassica campestris L internal standard gene C ruA:
QCruAF 5 '-GGCCAGGGCTTCCGTGAT-3 ' and qCruAR 5 '-CCGTCGTTGTAGAACCATTG
G-3 ', probe qCruAP 5 '-AGTCCTTATGTGCTCCACTTTCTGGTGCA-3 '；Brassica campestris L internal standard gene
HMG I/Y:qhmg-F 5 '-GGTCGTCCTCCTAAGGCGAAAG-3 ' and qhmg-R 5 '-CTTCTTCGGC
GGTCGTCCAC-3 ', probe qhmg-P 5 '-CGGAGCCACTCGGTGCCGCAACTT-3 '；Cotton Gossypii internal standard
Quasi-gene Sad1:Sad1-QF 5 '-CCAAAGGAGGTGCCTGTTCA-3 ' and Sad1-QR 5 '-TTGAGG
TGAGTCAGAATGTTGTTC-3 ', probe Sad1-QP 5 '-TCACCCACTCCATGCCGCCTCACA-3 '；
Semen Tritici aestivi internal standard gene Waxy-D1: primer Waxy-D1-1F 5 '-GTCGCGGGAACAGAGGTGT-3 ' and W
Axy-D1-1R 5 '-GGTGTTCCTCCATTGCGAAA-3 ', probe Waxy-D1-P 5 '-CAAGGCGGCCGA
AATAAGTTGCC-3’。
Utilize synthesis real-time fluorescence PCR primer, with build positive plasmid molecule as template, carry out the most glimmering
Light PCR expands.Real-time fluorescence PCR analysis is carried out on a CFX96PCR instrument, PCR reaction system 20
μ L, containing 1 μ L plasmid template, 1 × PCR buffer, 1U Taq archaeal dna polymerase, 4.5mM MgCl
2,300 μMs of dNTPs, 200nM primers, and 100nM probe.PCR response procedures: 50 DEG C 2 points
After clock and 95 DEG C of 10 minutes denaturations, carry out 50 PCR cycle: 95 DEG C of degeneration in 15 seconds, 60 DEG C
Annealing in 1 minute and extension, collect fluorescence signal.
3, application process
3.1, the positive control that pBI121-Screening detects is utilized as genetically modified crops regular-PCR examination
And quality-control sample
Transgenic paddy rice TT51-1, Kemingdao, rich No. 6 of section, genetically modified rape GT 73, Topas 19/2, T45,
MS1, RF1, RF2, MS8, RF3, transgenic corns Bt176, Bt11, MON863, MIR604, MON89034,
TC1507,59122, MIR162, MON863, genetically engineered soybean A5547-127, GTS-40-3-2, MON89788,
Transgene cotton MON1445, MON531, MON15985, MON88913, LL25, and the genome of Semen Tritici aestivi
DNA.The genomic DNA standard substance of transgenic paddy rice LLRICE62 is bought from AOCS.Utilize the general of synthesis
Logical PCR primer, with plasmid molecule pBI121-Screening as positive control, enters the DNA sample extracted
Row transgene component examination detects.
PCR reaction uses 25ul reaction system, and containing 1 μ L DNA profiling, 1 × PCR Buffer is (containing 10mM
Tris HCl pH8.3, KCl 50mM), the forward of 200uM dNTPs, 2.5mM MgCl2,250nM draws
Thing and reverse primer, 1U DNA Taq enzyme.Response procedures is, 94 DEG C of 2 minutes denaturations, 94 DEG C 15
Second, 60 DEG C 30 seconds, 72 DEG C 30 seconds, 35 times circulation, 72 DEG C be incubated 2 minutes.PCR primer is with fine jade
Sepharose is separated by electrophoresis, and identifies whether there is amplified production after EB dyeing.
3.2, the positive that pBI121-Screening detects is utilized as genetically modified crops real-time fluorescence PCR examination
Comparison and quality-control sample
Utilize the real-time fluorescence PCR primer of synthesis, with plasmid molecule pBI121-Screening as positive control,
To the transgenic paddy rice extracted, transgenic corns, genetically engineered soybean, transgene rape, transgene cotton and little
Wheat DNA sample carries out transgene component examination detection.
Real-time fluorescence PCR analysis is carried out on a CFX96PCR instrument, and PCR reaction system 20 μ L, containing 1 μ
L DNA profiling, 1 × PCR buffer, 1U Taq archaeal dna polymerase, 4.5mM MgCl2,300 μMs of dNTPs,
200nM forward and reverse primer, 100nM probe.PCR response procedures: 50 DEG C 2 minutes and 95 DEG C 10
After minute denaturation, carry out 50 PCR cycle: 95 DEG C of degeneration in 15 seconds, 60 DEG C of annealing in 1 minute and
Extend, collect fluorescence signal.
4, experimental result
4.1, the structure of pBI121-Screening and sequencing analysis
Respectively from transgene rape T45, MS1 × RF1, RT73, transgenic corns MIR604, transgenic water
7 transgenic element Pmi, E9 3 ' of the genome amplification of rice Kemingdao, T-35S, FMV35s, bar-g7 3 ',
HPT.These 6 amplified fragments are cloned on pAMP carrier respectively, with the M13F (-47) on carrier and
M13R (-48) primer checks order, and selects the clone that sequence is correct, carries out recombinant PCR after extracting plasmid.Will
6 fragments being cloned into first connect two-by-two, and splicing for the first time obtains 3 fragments, and length is at 1000-1500
Left and right；Connecting before these 3 fragments two, second time is spliced to form 1 large fragment again；Finally by these 2 sheets
Mono-complete sequence of Duan Liancheng.
By restriction endonuclease EcoRI and XmaI double digestion pBI121, eliminate reporter gene gusA on this carrier
And the no terminator of redundancy, and remaining the no promoter on pBI121 carrier, nptII, no are eventually
Only son and CaMV 35S promoter.By the full length DNA sequence of amplification through XmaI endonuclease digestion rear clone to carrying
On body pBI121.Build intermediate carrier comprise P-Nos promoter, NptII gene, T-Nos terminator,
P-CaMV35S promoter, Tg73 ' terminator, Bar gene, P-FMV35S promoter, T-35S terminator,
HPT gene, TE9 terminator and PMI gene totally 11 Genetic elements (Fig. 2).11 are confirmed by order-checking
Genetic elements has all been building up on pBI121 carrier.
By six big crop internal standard genes (Oryza sativa L. SPS, PLD, Brassica campestris L HMG I/Y, CruA, Semen sojae atricolor Lectin,
Semen Maydis zSSIIb, Cotton Gossypii SadIe and Semen Tritici aestivi Waxy-D1) detection target sequence be spliced together, splice suitable
Sequence is as it is shown on figure 3, splice the long 1742bp of sequence.The crop internal standard gene fusion sequence of splicing is entrusted Shanghai
Raw work synthesis, and install on pUC57 plasmid.Expand crop internal standard gene fusion sequence by PCR, use
Internal standard gene fusion sequence is cloned into the pBI121 of foreign gene-carrying fusion sequence by PmeI enzyme action further
On carrier, the named pBI121-Screening of carrier (Fig. 1).The internal standard base built by sequence verification
Because of the most correct.
4.2, the detection target of each Genetic elements on checking pBI121-Screening
With 11 exogenous gene elements and the common PCR primers of 6 big crop internal standard genes of synthesis, with matter
Grain molecule pBI121-Screening is that template carries out PCR amplification.PCR primer is carried out electrophoresis detection, sends out
The most each Genetic elements has all amplified the PCR primer (Fig. 4) of expection size, shows plasmid molecule
The upper regular-PCR detection target containing each Genetic elements of pBI121-Screening.Plasmid molecule
PBI121-Screening can serve as positive control and the matter of 6 big genetically modified crops regular-PCR examination detections
Control sample.
With synthesis 11 exogenous gene elements and the real-time fluorescence PCR primer of 6 big crop internal standard genes,
Real-time fluorescent PCR amplification is carried out for template with plasmid molecule pBI121-Screening.Find each Genetic elements
All create typical case's amplification curve (Fig. 5), show on plasmid molecule pBI121-Screening containing each gene
The real-time PCR detection target of element.Plasmid molecule pBI121-Screening can serve as 6 and turns greatly base
Positive control and quality-control sample because of crop real-time fluorescence PCR examination detection.
The positive that 4.3, pBI121-Screening is used as 6 big genetically modified crops regular-PCR examination detections is right
According to and quality-control sample
Using plasmid molecule pBI121-Screening as positive control, with 6 big crop internal standard bases of synthesis
Because the primer of primer and 11 foreign elements carries out regular-PCR amplification, to 3 transgenic paddy rices (TT51-1,
Rich No. 6 of Kemingdao, section), 5 transgene rapes (Topas 19/2, T45, MS1, RF1 and RF2), 9
Individual transgenic corns (Bt176, Bt11, MON863, MIR604, MON89034, TC1507,59122, MIR162,
MON863), 3 genetically engineered soybeans (A5547-127, GTS-40-3-2, MON89788), 4 transgenic cottons
Transgene component in flower (MON1445, MON531, MON15985, MON88913) carries out examination detection.
Not collecting wheat transgenic sample, the regular-PCR detection that Wheat DNA only carries out internal standard gene is analyzed.
Detection PCR primer finds, the internal standard gene of 6 big crops is at plasmid molecule pBI121-Screening
With corresponding crop has good amplification；11 exogenous gene elements are at plasmid molecule
PBI121-Screening and containing respective element transgenic product in have good amplification (Fig. 6).Knot
Fruit shows that plasmid molecule pBI121-Screening can be as 6 big crop internal standard gene and 11 external source units
Part carries out control sample during regular-PCR amplification, can be determined that carrying of sample DNA by the amplification of control sample
Take quality and PCR amplification system is the most normal.
4.4, pBI121-Screening is used as the sun of 6 big genetically modified crops real-time fluorescence PCR examination detections
Property comparison and quality-control sample
Using plasmid molecule pBI121-Screening as positive control, with 6 big crop internal standard bases of synthesis
Because the primer of primer and 11 foreign elements carries out real-time fluorescent PCR amplification, to 3 transgenic paddy rices
(TT51-1, Kemingdao, rich No. 6 of section), 5 transgene rapes (Topas 19/2, T45, MS1, RF1
And RF2), 9 transgenic corns (Bt176, Bt11, MON863, MIR604, MON89034, TC1507,
59122, MIR162, MON863), 3 genetically engineered soybeans (A5547-127, GTS-40-3-2, MON89788),
Transgene component in 4 transgene cottons (MON1445, MON531, MON15985, MON88913) enters
Row examination detects.Do not collect wheat transgenic sample, only Wheat DNA is carried out the real-time fluorescence of internal standard gene
PCR detects analysis.
The internal standard gene of 6 big crops has good in plasmid molecule pBI121-Screening and corresponding crop
Good amplification；11 exogenous gene elements are at plasmid molecule pBI121-Screening with containing respective element
Transgenic product has good amplification (Fig. 7).Result shows that plasmid molecule pBI121-Screening can
Control sample during to carry out real-time fluorescent PCR amplification as 6 big crop internal standard genes and 11 foreign elements
Product, the most just can be determined that the extraction quality of sample DNA and PCR amplification system by the amplification of control sample
Often.
Claims (1)
1. the application of a positive plasmid molecule pBI121-Screening, it is characterised in that:
The base sequence of positive plasmid molecule pBI121-Screening is as shown in SEQ NO.1；
Utilize pBI121-Screening as positive control and quality-control sample, respectively to Oryza sativa L., Brassica campestris L, big
Bean, Semen Maydis, Cotton Gossypii and Semen Tritici aestivi each sample carry out regular-PCR and the real-time fluorescence PCR examination inspection of transgene component
Survey.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510078895.5A CN104651511B (en) | 2015-02-14 | 2015-02-14 | A kind of positive plasmid molecule pBI121-Screening and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510078895.5A CN104651511B (en) | 2015-02-14 | 2015-02-14 | A kind of positive plasmid molecule pBI121-Screening and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104651511A CN104651511A (en) | 2015-05-27 |
| CN104651511B true CN104651511B (en) | 2016-07-27 |
Family
ID=53243150
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510078895.5A Expired - Fee Related CN104651511B (en) | 2015-02-14 | 2015-02-14 | A kind of positive plasmid molecule pBI121-Screening and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104651511B (en) |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105713977A (en) * | 2016-03-29 | 2016-06-29 | 四川省农业科学院分析测试中心 | Primers for seven-plex PCR (polymerase chain reaction) rapid screening detection for commercially applied transgenic oilseed rape and detection method |
| CN106244674A (en) * | 2016-06-07 | 2016-12-21 | 谱尼测试集团深圳有限公司 | A kind of standard plasmid molecule for transgenic wheat detection and construction method thereof |
| CN106480216A (en) * | 2016-12-07 | 2017-03-08 | 江苏省农业科学院 | A kind of standard plasmid for detecting transgenic regulation element and its construction method and application |
| CN106834346B (en) * | 2017-01-23 | 2020-09-18 | 中国农业科学院油料作物研究所 | Transgenic rape SD-rapeseed with polymerization common screening target and application thereof |
| CN106591340B (en) * | 2017-01-25 | 2020-07-03 | 东北农业大学 | Standard plasmid molecule for qualitative detection of transgenic organism and product gene thereof |
| CN110079595A (en) * | 2019-05-15 | 2019-08-02 | 浙江省农业科学院 | The primer combination of probe object and method of external source plant sugar slurry in a kind of detection honey |
| CN110408716A (en) * | 2019-06-12 | 2019-11-05 | 中国检验检疫科学研究院 | Containing there are many DNA standard sample of internal standard gene specific segment and its applications |
| CN110527737B (en) * | 2019-08-21 | 2024-03-08 | 中国农业科学院油料作物研究所 | Positive plasmid molecule pYCID-1905 identified by transgenic rape and transformant of transgenic rape product and application thereof |
| CN110540999B (en) * | 2019-08-21 | 2021-08-20 | 中国农业科学院油料作物研究所 | Transgenic rape and positive plasmid molecule pYCSC-1905 screened by product thereof and application thereof |
| CN112646829B (en) * | 2020-12-29 | 2023-03-28 | 华智生物技术有限公司 | Plasmid standard molecule capable of being used for detecting multiple crops and multiple exogenous genes |
| CN114958989B (en) * | 2022-02-23 | 2023-10-31 | 中国农业科学院油料作物研究所 | Treatment fluid, amplification system and kit for rapid and direct double PCR amplification |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559854B (en) * | 2010-12-20 | 2015-05-20 | 中国农业科学院饲料研究所 | Standard plasmid molecular used for detecting transgenic soybean, corn and cotton and construction of the standard plasmid molecular |
| CN102586306A (en) * | 2012-03-02 | 2012-07-18 | 山东省农业科学院植物保护研究所 | Standard plasmid molecules for transgenetic soybean BPS-CV127-9 detection, constructing method thereof and application thereof |
-
2015
- 2015-02-14 CN CN201510078895.5A patent/CN104651511B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN104651511A (en) | 2015-05-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104651511B (en) | A kind of positive plasmid molecule pBI121-Screening and application thereof | |
| Machado et al. | The MYB transcription factor GhMYB25 regulates early fibre and trichome development | |
| WO2014186686A2 (en) | Targeted mutagenesis and genome engineering in plants using rna-guided cas nucleases | |
| Mahalingam et al. | Polygalacturonase and polygalacturonase inhibitor protein: gene isolation and transcription in Glycine max-Heterodera glycines interactions | |
| WO2015007194A1 (en) | Method for plant genome site-directed modification | |
| Weng et al. | Novel reference gene, high-mobility-group protein I/Y, used in qualitative and real-time quantitative polymerase chain reaction detection of transgenic rapeseed cultivars | |
| Passricha et al. | Assessing zygosity in progeny of transgenic plants: current methods and perspectives | |
| Fraiture et al. | An innovative and integrated approach based on DNA walking to identify unauthorised GMOs | |
| Chen et al. | Identification and characterization of rice blast resistance gene Pid4 by a combination of transcriptomic profiling and genome analysis | |
| Combest et al. | St PIP1, a PAMP-induced peptide in potato, elicits plant defenses and is associated with disease symptom severity in a compatible interaction with Potato virus Y | |
| CN101792761B (en) | Induction-enhanced tissue specific promoter and application thereof | |
| CN103215346A (en) | Recombinant standard plasmid and kit used in transgenic rice screening | |
| Xu et al. | Translation initiation factor eIF4E and eIFiso4E are both required for peanut stripe virus infection in peanut (Arachis hypogaea L.) | |
| CN103937812A (en) | Application of trait control gene SPL29 of rice spotted leaf on senescence and disease resistance | |
| CN100558902C (en) | Transgene rape exogenous origin gene integrator incident Rf1 exogenous insertion vector flanking sequence and application thereof | |
| CN110885813B (en) | Application of rice histone deacetylase gene HDA710 in delaying leaf senescence | |
| Prins et al. | A case study to determine the geographical origin of unknown GM papaya in routine food sample analysis, followed by identification of papaya events 16-0-1 and 18-2-4 | |
| CN104988236A (en) | Transgene wheat B73-6-1 line specificity quantitative PCR detection kit and applications thereof | |
| CN101020902B (en) | Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application | |
| CN103937908A (en) | Real-time fluorescence quantitative PCR detection method of West African strain of sweet potato chlorotic stunt virus and application | |
| CN102286624B (en) | Qualitative and quantitative PCR (polymerase chain reaction) detection method for strain specificity of transgenic carnation Moonlite | |
| CN107267503B (en) | Nucleic acid, method for detecting transgenic rice B1C893 and derivative line thereof, kit and application thereof | |
| Umer et al. | Expression of Pinellia ternata leaf agglutinin under rolC promoter confers resistance against a phytophagous sap sucking aphid, Myzus persicae | |
| CN101016554A (en) | Transgene rape Rf3 event exogenesis insertion carrier side sequence and application thereof | |
| CN104531719B (en) | Rice disease-resistant gene OsSeh1 as well as cloning method, functional identification method and application of rice disease-resistant gene OsSeh1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160727 Termination date: 20210214 |