CN104651393A - Method for cultivating thermo-sensitive genic male sterile rice through site-specific mutagenesis of RNase ZS1 by utilizing TALEN system - Google Patents
Method for cultivating thermo-sensitive genic male sterile rice through site-specific mutagenesis of RNase ZS1 by utilizing TALEN system Download PDFInfo
- Publication number
- CN104651393A CN104651393A CN201510009577.3A CN201510009577A CN104651393A CN 104651393 A CN104651393 A CN 104651393A CN 201510009577 A CN201510009577 A CN 201510009577A CN 104651393 A CN104651393 A CN 104651393A
- Authority
- CN
- China
- Prior art keywords
- talen
- plant
- recognition sequence
- identification module
- tale
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a method for cultivating thermo-sensitive genic male sterile rice through site-specific mutagenesis of RNase ZS1 by utilizing a TALEN system. The method comprises the following steps: designing a target sequence; converting TALE recognition sequences at the left and right sides into a recognition module; constructing a TALEN carrier containing the recognition module; synthesizing a binary vector containing TALEN-L and TALEN-R; carrying out genetic transformation to obtain positive transgenic plants; selecting mutational plants in the positive transgenic plants; carrying out passage planting and separating of the mutational plants so as to obtain the plants without transgenic components and having recovery and fertile fertility at low temperature as thermo-sensitive genic male sterile plants and the like. The activity of inactivated RNase ZS1 protein is subjected to site-specific mutagenesis through the TALEN system; therefore, the thermo-sensitive genic male sterile rice without the transgenic components can be obtained through artificial cultivation; the method is high in purposiveness and low in genome damage; and thus, possible risks due to transgenosis can be avoided.
Description
Technical field
The present invention relates to the method for cultivation of rice temp-sensing sterile line, be specifically related to one and utilize TALEN system rite-directed mutagenesis RNase Z
s1cultivate the method for rice temp-sensing sterile line.
Background technology
Paddy rice (Oryza sativa L.) is topmost food crop, and the population that the whole world exceedes half take paddy rice as staple food.Along with the growth of population and the minimizing of arable area, the unbalanced supply-demand of grain becomes day by day remarkable, and increasing per unit area yield of grain is one of major measure solving grain unbalanced supply-demand.Fortunately, hybrid rice can improve the output of 20-30% than conventional rice, and the problem solving short-commons serves very important effect, and therefore, the cultivated area of hybrid rice grows steadily, and accounts for greatly about 60% of Monitoring of Paddy Rice Plant Area now.
The method of breeding of hybridized rice can be divided into bilinear method and three series by the difference according to used sterile line type.Three series uses cytoplasmic male sterile line and restorer to produce hybrid F
1for seed, by maintenance line and cytoplasmic male sterile line outbreeding cytoplasmic male sterile line; But approximately only can account for 5% as the rice varieties of restorer in conventional rice, this greatly reduces the genetic diversity between restorer and sterile line, limits heterotic utilization.And bilinear method mainly use up/thcrmo-scnsitivc genie male stcrility system as sterile line and maintenance line because light/temp-sensing sterile line fertility by photoperiod and temperature adjusting, can be used as sterile line under sterile condition, can be used as maintenance line can educate under condition, one is dual-purpose.And because do not affect by nucleo-cytoplasmic interreaction, nearly all normal kind all can as restorer.Based on these difference in essence, double-hybrid rice strains technology has restorer more widely, do not need to utilize special Restore gene, make formulated in combination freer, be conducive to the utilization of inter-subspecific heterosis, larger potential advantages are existed to the rice matter, output, resistance etc. improving Hybrid Rice Combinations; Light/temp-sensing sterile line can one be dual-purpose, does not need maintenance line, simplifies production sequence; Temperature sensitive sterility controls by nuclear gene, has nothing to do with tenuigenin, has enriched the diversity of plasma inheritance, avoids negative effect and the single potentially dangerous that may bring of tenuigenin of ternary hybrid rice sterile cytoplasm.Therefore there is great potential in temp-sensing sterile line in breeding of hybridized rice, Comparatively speaking, at present in double-linear hybrid rice breeding widespread use be temp-sensing sterile line.
Peace agriculture S-1 temp-sensing sterile line is first indica type temperature sensitive sterile mutant be found, thermo-sensitive sterile material obtains often through spontaneous mutation or induced mutations, but mutation frequency is very low, and the thermo-sensitive sterile material utilizing traditional breeding method means sudden change to be obtained is cultivated and become temp-sensing sterile line and need very long process, the cultivation efficiency reduction process of cultivating improving temp-sensing sterile line has become key issue in the urgent need to address.Therefore must use genetic engineering means, break through the limitation of traditional breeding method.Although, RNAi and Antisense RNA Technique can realize expressing the suppression of target gene, but thoroughly can not remove the function of gene, the function that gene remains often improves the critical temperature of sterility of transfer-gen plant, be unfavorable for the safety of breeding, and inevitably remain exogenous array in these transfer-gen plants, relate to Transgenic Food Safety Issue.Recently, target mutating technology achieves breakthrough, has been widely used in different kind organism.These methods are all, by special target recognition sequence or homing sequence, endonuclease is directed to target position; then endonuclease cutting target DNA; under the help of cell self repair system, the DNA of cut-out is repaired link to get up, but in repair process, base often can be caused to lose or increase.At present, although interfere RNase Z by RNAi technology
s1, obtain temperature sensitive sterile plant; But RNAi technology just part reduces RNase Z
s1expression amount, its thorough inactivation can not be made, make the critical temperature of sterility of transfer-gen plant higher, and critical temperature of sterility is unstable, affects production of hybrid seeds safety.
Summary of the invention
In order to overcome the deficiencies in the prior art, a kind of profit is the object of the present invention is to provide to utilize TALEN system rite-directed mutagenesis RNase Z
s1cultivate the method for rice temp-sensing sterile line, by TALEN system rite-directed mutagenesis inactivation RNase Z
s1the activity of albumen, obtains the practical temp-sensing sterile line of artificial culture not with transgene component, and have purpose strong, Genomic damage is little, has evaded the possible risk that transgenosis is brought.
For solving the problem, the technical solution adopted in the present invention is as follows:
One utilizes TALEN system rite-directed mutagenesis RNase Z
s1cultivate the method for rice temp-sensing sterile line, it comprises the following steps:
1) target sequence design: according to RNase Z
s1left side TALE recognition sequence, right side TALE recognition sequence is designed respectively at TMS5 or Os02g0214300 of paddy rice or LOC_Os02g12290 coding region;
2) left and right side TALE recognition sequence is changed into identification module: arranged on left and right sides TALE recognition sequence is changed into identification module by the base identification principle according to TALE albumen RVD district;
3) build containing above-mentioned steps 2) the TALEN carrier of identification module;
4) synthesis is containing the binary vector of TALEN-L and TALEN-R;
5) genetic transformation obtains positive transgenic plant;
6) plant that positive transgenic plant obtains sudden change is screened;
7) plant of said mutation to be gone down to posterity plantation and being separated, acquisition fertility restorer can educate and plant not with transgene component as temperature sensitive sterile strain.
Particularly, step 1) in, according to RNase Z
s1left side TALE recognition sequence and right side TALE recognition sequence is designed respectively at TMS5 or Os02g0214300 of paddy rice or LOC_Os02g12290 coding region.Left and right sides recognition sequence general interval 13-22 base, 18 bases are best, and recognition sequence length is generally 16-20 base.
Particularly, step 3) in, containing above-mentioned steps 2) the TALEN carrier of identification module is: first synthesis and each base pair of identification module TAL identification module of answering, according to recognition sequence, described TAL identification module is polymerized, then respectively by the N-end of two TALE Module Links be polymerized to endonuclease Fok I, the endonuclease TALEN of energy specific cleavage DNA sequence dna is formed; To cut through enzyme and check order acquisition positive plasmid; Form TALEN-L and TALEN-R respectively.
Particularly, step 4) in, synthesis containing the step of the binary vector of TALEN-L and TALEN-R is: cut down by the TALEN expression cassette in TALEN-L and TALEN-R carrier and be linked in same binary vector, forms TALEN binary vector.
Particularly, step 5) be specially: by TALEN binary vector by Agrobacterium-mediated genetic transformation method or Bombardment-Mediated Transformation Rice Callus; Through screening, break up and seedling of taking root, transfer-gen plant is planted in solarium, identified by Totomycin and collect positive transgenic plant.
Particularly, step 6) be specially: extract T
0for the DNA of positive transgenic plant, increase with primer SEQID NO.5 and SEQ ID NO.6, the order-checking of product purified Hou Song company, the WT lines sequence before sequencing result and transgenosis compares, and the plant of base deletion, insertion or replacement is the successful plant that suddenlys change.
Particularly, step 7) be specially: results T
0in generation, realizes the seed of plant of rite-directed mutagenesis, under high temperature/long day condition, plant T
1for plant, to be separated to not with transgene component but the sterile plant of phenotype is planted under low temperature/short day condition by Phenotypic Observation and Totomycin positive detection, the plant that fertility restorer can be educated, as temperature sensitive sterile strain, obtains temp-sensing sterile line after breeding.
Particularly, step 6 in the present invention) plant of described sudden change shows as base deletion or base is inserted or base is replaced.
Compared to existing technology, beneficial effect of the present invention is:
1. of the present inventionly utilize TALEN system rite-directed mutagenesis RNase Z
s1rite-directed mutagenesis is obtained temperature sensitive sterile mutant by the method for cultivating rice temp-sensing sterile line, achieve the practical temp-sensing sterile line of artificial culture, and this temp-sensing sterile line can not be with transgene component, there is purpose strong, the advantage that Genomic damage is little, can evade the risk that transgenosis may be brought;
2. of the present inventionly utilize TALEN system rite-directed mutagenesis RNase Z
s1the method of cultivating rice temp-sensing sterile line shortens the time of cultivating temp-sensing sterile line, accelerates the process of breeding, provides cost savings;
3. method of the present invention does not change the genetic background of acceptor material substantially, and can by being temp-sensing sterile line by the maintenance line rite-directed mutagenesis of series of three-series hybrid rice, can ternary hybrid rice be changed into two-line hybrid rice, expand the screening scope of restorer, improve heterosis utilization efficiency, and then improve output, resistance and rice quality;
4. instant invention overcomes spontaneous mutation or traditional induced mutations TMS5 (RNase Z
s1) difficult problem existing for new mutant of inactivation; The temp-sensing sterile line of double-line hybrid breeding that what mutagenesis was new can be used for.
Below in conjunction with the drawings and specific embodiments, the present invention is described in further detail.
Accompanying drawing explanation
The TMS5-1-1T that Fig. 1 obtains for the embodiment of the present invention 1
1for plant Totomycin qualification result, wherein 1-7 is respectively T
1for 7 strains in plant;
The TMS5-1-2 plant pollen fertility under condition of different temperatures of Fig. 2 for obtaining in embodiment 1, wherein, HT represents high temperature, and LT represents low temperature, and WT represents the plant before transgenosis;
Fig. 3 is the TMS5-2-1T that the embodiment of the present invention 2 obtains
1for plant Totomycin qualification result, wherein 1-8 is respectively T
1for 8 strains in plant;
Fig. 4 is the pollen fertility under embodiment of the present invention 2TMS5-2-1 the 7th strain plant condition of different temperatures, and wherein ZH11 represents in wild rice and spends 11, HT to represent high temperature, and LT represents low temperature.
Embodiment
One utilizes TALEN system rite-directed mutagenesis RNase Z
s1cultivate the method for rice temp-sensing sterile line, it comprises the following steps:
1) target sequence design: according to RNase Z
s1left side TALE recognition sequence, right side TALE recognition sequence is designed respectively at TMS5 or Os02g0214300 of paddy rice or LOC_Os02g12290 coding region;
2) left and right side TALE recognition sequence is changed into identification module: according to TALE albumen RVD district base identification principle, arranged on left and right sides TALE recognition sequence is changed into identification module;
3) build containing above-mentioned steps 2) TALEN-L and the TALEN-R carrier of identification module;
4) synthesis is containing the binary vector of TALEN-L and TALEN-R;
5) genetic transformation obtains positive transgenic plant;
6) plant obtaining sudden change in positive transgenic plant is screened;
7) plant of said mutation is gone down to posterity plantation, obtain not with transgene component and the fertility restorer plant that can educate as temperature sensitive sterile strain.
Particularly, step 1) in, according to RNase Z
s1left side TALE recognition sequence, right side TALE recognition sequence is designed respectively at TMS5 or Os02g0214300 of paddy rice or LOC_Os02g12290 coding region.Left and right sides recognition sequence general interval 13-22 base, 18 bases are best, and recognition sequence length is generally 16-20 base.
Particularly, step 3) in, containing above-mentioned steps 2) the TALEN carrier of identification module is: first synthesis and each base pair of identification module TAL identification module of answering, according to recognition sequence, described TAL identification module is polymerized, then respectively by the N-end of two TALE Module Links be polymerized to endonuclease Fok I, the endonuclease TALEN of energy specific cleavage DNA sequence dna is formed; To cut through enzyme and check order acquisition positive plasmid; Shape becomes TALEN-L and TALEN-R respectively.
Particularly, step 4) in, synthesis containing the step of the binary vector of TALEN-L and TALEN-R is: cut down by the TALEN expression cassette in TALEN-L and TALEN-R carrier and be linked in same binary vector, forms TALEN binary vector.
Particularly, step 5) be specially: by TALEN binary vector by Agrobacterium-mediated genetic transformation method or Bombardment-Mediated Transformation Rice Callus; Through screening, break up and seedling of taking root, after hardening, transfer-gen plant is planted in solarium, detected by Totomycin and collect positive transgenic plant.
Particularly, step 6) be specially: extract T
0for the DNA of positive transgenic plant, increase with primer SEQID NO.5 and SEQ ID NO.6, the order-checking of product purified Hou Song company, sequencing result and not genetically modified WT lines gene comparision, have the plant of replacement or base deletion or insertion for the successful plant of sudden change.
Particularly, step 7) be specially: results T
0in generation, realizes the seed of transfer-gen plant of rite-directed mutagenesis, under high temperature/long day condition, plant T
1for plant, to be separated to not with transgene component and the sterile plant of phenotype is planted under low temperature/short day condition by Phenotypic Observation and Totomycin positive identification, the plant that fertility restorer can be educated, as temperature sensitive sterile strain, obtains temp-sensing sterile line after breeding.
Particularly, step 6 in the present invention) plant of described sudden change shows as at RNase Z
s1lack base between recognition sequence or insert base or base replacement.
It is below specific embodiment of the present invention.
Embodiment 1
Spend in japonica rice variety in 11 and utilize TALEN system rite-directed mutagenesis RNase Z
s1(Os02g0214300) cultivate temp-sensing sterile line, concrete steps are as follows:
1) target sequence design:
Left side TALE recognition sequence Target-TMS5-1L, sequence is SEQ ID NO.1:CGGCCGAAGGCGAAGGC, is positioned at the 61-77 of Os02g0214300 coding region;
Right side TALE recognition sequence Target-TMS5-1R, sequence is SEQ ID NO.2:CCACGGGGTAGCCCTC, is positioned at the 94-109 of Os02g0214300 coding region;
2) arranged on left and right sides TALE recognition sequence is changed into identification module:
The RVD sequence that Target-TMS 5-1L changes into TALE identification module (wherein every two amino are a module) is SEQ ID NO.3:
his Asp asn Asn asn Asn his Asp his Asp asn AsnasnIle Asn Ile Asn Asn Asn Asn His Asp Asn Asn Asn Ile Asn Ile Asn Asn Asn Asn HisAsp; Target-TMS5-1R changes into the RVD sequence SEQ ID NO.4 of TALE identification module:
his Asp his Asp asn Ilehis Asp Asn Asn Asn Asn Asn Asn Asn Asn Asn Gly Asn Ile AsnAsn His Asp His Asp His Asp Asn Gly His Asp;
3) the TALEN carrier containing above-mentioned arranged on left and right sides TALE identification module is built:
Synthesize the TAL identification module that each base pair is answered respectively, according to identification module polymerization described in recognition sequence, respectively by the N-end of two TALE Module Links be polymerized to endonuclease Fok I, form the endonuclease TALEN of energy specific cleavage DNA sequence dna; Cut and sequence verification positive plasmid through enzyme, form TALEN-TMS5-1L and TALEN-TMS5-1R respectively;
4) the TALEN binary vector containing TALEN-TMS5-1L and TALEN-TMS5-1R is built:
Being cut down by TALEN expression cassette in TALEN-TMS5-1L and TALEN-TMS5-1R carrier is linked in same binary vector, forms TALEN-TMS5-1 carrier;
5) genetic transformation obtains positive transgenic plant:
By the TALEN-TMS5-1 carrier containing target by Agrobacterium-mediated genetic transformation rice transformation callus; Through screening, break up and seedling of taking root, transfer-gen plant is planted in solarium, by Totomycin qualification positive transgenic plant;
6) the purified rear plant obtaining sudden change of positive transgenic plant:
Extract T
0for the DNA of positive plant, with primer TMS5s F, sequence is SEQ ID NO.5:AACCTCTTACAGGCTAGATG and TMS5s R, sequence is that SEQ ID NO.6:TCGTGCTCCTGACCAATCTC increases above-mentioned DNA, the order-checking of product purified Hou Song company, WT lines gene comparision before sequencing result and transgenosis, analyzes catastrophe, specifically see SEQ ID NO.7-SEQ ID NO.9;
WT(SEQ ID NO.7)：CGGGTCGGCCGAAGGCGAAGGCGCCGCCCCTCACCGTCGAGGGCTACCCCGTGGAGGGCA
TMS5-1-1(SEQ ID NO.8)：CGGGTCGGCCGAAGGCGAAGGCGCCGCCCC**ACCGTCGAGGG CTACCCCGTGGAGGGCA
TMS5-1-2(SEQ ID NO.9)：CGGGTCGGCCGAAGGCGAAGGCGCCGC C*******GTCGAGGG CTACCCCGTGGAGGGCA
Wherein, TMS5-1-1 and TMS5-1-2 represents different transgenic lines; WT represents wild-type; In sequence, " * " represents base deletion; Sequencing result shows: mutant plant accounts for 5.7% of total positives transfer-gen plant, and the disappearance of base illustrates rite-directed mutagenesis success; And this mutation type is base deletion;
7) plant of said mutation is gone down to posterity plantation, obtains plant that fertility restorer can educate as temperature sensitive sterile strain:
Results T
0in generation, realizes the seed of plant of rite-directed mutagenesis, long day/hot conditions under plant T
1for plant, be separated to not with transgene component by Fertility observation and Totomycin positive identification and the sterile plant of phenotype plant in short day/cold condition under, the recoverable plant of pollen fertility, as temperature sensitive sterile strain, obtains temp-sensing sterile line after breeding; Result is see Fig. 1 and 2.
The result of Fig. 1 shows, T
1for 2 and 5 being be not with transgene component in plant; Fig. 2 result shows, No. 2 plant at high temperature show as pollen abortion, and show as fertility restorer under low temperature.
Embodiment 2
Spend in japonica rice variety in 11 and utilize TALEN system rite-directed mutagenesis RNase Z
s1(Os02g0214300) cultivate temp-sensing sterile line, concrete steps are as follows:
1) target sequence design:
Left side TALE recognition sequence Target-TMS5-2L, sequence is SEQ ID NO.10:CACCGTCGAGGGCTAC, is positioned at the 87-102 of Os02g0214300 coding region;
Right side TALE recognition sequence Target-TMS5-2R, sequence is SEQ ID NO.11:CTCCTGCCCGCCGAT, is positioned at the 121-135 of Os02g0214300 coding region;
2) arranged on left and right sides TALE recognition sequence is changed into identification module:
The RVD sequence that Target-TMS5-2L changes into TALE identification module (wherein every two amino are a module) is SEQ ID NO.12:His Asp Asn Ile His Asp His Asp Asn Asn Asn Gly HisAsp Asn Asn Asn Ile Asn Asn Asn Asn Asn Asn His Asp Asn Gly Asn Ile His Asp; The RVD sequence that Target-TMS5-2R changes into TALE identification module is SEQ ID NO.13:His AspAsn Gly His Asp His Asp Asn Asn Asn His Asp His Asp His Asp Asn Asn His AspHis Asp Asn Asn Asn Ile Asn Gly;
3) the TALEN carrier containing above-mentioned arranged on left and right sides TALE identification module is built:
First the TAL identification module that each base pair is answered is synthesized respectively, according to recognition sequence, these identification modules are polymerized, respectively by the N-end of two TALE Module Links be polymerized to endonuclease Fok I, form the endonuclease TALEN of energy specific cleavage DNA sequence dna.Enzyme is cut and sequence verification positive plasmid, forms TALEN-TMS5-2L and TALEN-TMS5-2R respectively;
4) the TALEN binary vector containing TALEN-TMS5-2L and TALEN-TMS5-2R is built:
Being cut down by TALEN expression cassette in TALEN-TMS5-2L and TALEN-TMS5-2R carrier is respectively linked in same binary vector, forms TALEN-TMS5-2 carrier;
5) genetic transformation obtains positive transgenic plant:
By the TALEN-TMS5-1 carrier containing target by Agrobacterium-mediated genetic transformation rice transformation callus; Through screening, break up and seedling of taking root, transfer-gen plant is planted in solarium, by Totomycin qualification positive transgenic plant;
6) purified rear selection of positive transgenic plant obtains the plant suddenlyd change:
Extract T
0for the DNA of positive plant, with primer TMS5s F, sequence is SEQ ID NO.4:AACCTCTTACAGGCTAGATG; TMS5s R, sequence is that SEQ ID NO.5:TCGTGCTCCTGACCAATCTC increases above-mentioned DNA, the order-checking of product purified Hou Song company, the WT lines gene comparision before sequencing result and transgenosis, analysis catastrophe; Specifically see SEQ IDNO.14-SEQ ID NO.17;
WT(SEQ ID NO.14)：GCCCCTCACCGTCGAGGGCTACCCCGTGGAGGGCATCTCCATCGGCGGGCAGGAGACCTG
TMS5-2-1(SEQ ID NO.15)：GCCCCTCACCGTCGAGGGCTACCCCGTGGA*GGCATCTCCATCGGCGGGCAGGAGACCTG
TMS5-2-2(SEQ ID NO.16)：GCCCCTCACCGTCGAGGGCTACCCCGTGG**GGCATCTCCATCGGCGGGCAGGAGACCTG
TMS5-2-3(SEQ ID NO.17)：GCCCCTCACCGTCGAGGGCTACCCCGTGGA****ATCTCCATCGGCGGGCAGGAGACCTG
Wherein, TMS5-2-1 ,-2 represents different transgenic lines with-3; WT represents wild-type; In sequence, " * " represents base deletion; Sequencing result shows: mutant plant accounts for 3.5% of total positives transfer-gen plant, and mutation type is base deletion; Namely the disappearance of base illustrates rite-directed mutagenesis success;
7) plant of said mutation is gone down to posterity plantation, obtains plant that fertility restorer can educate as temperature sensitive sterile strain:
Results T
0in generation, realizes the seed of plant of rite-directed mutagenesis, long day/hot conditions under plant T
1for plant, be separated to not with transgene component by Phenotypic Observation and Totomycin positive detection but the sterile plant of phenotype plant in short day/cold condition under, the plant that fertility restorer can be educated is as temperature sensitive sterile strain, and after breeding, obtain temp-sensing sterile line, result is see Fig. 3 and 4.
Fig. 3 result shows, T
1for 4 and 7 being be not with transgene component in plant; Fig. 4 result shows 7, and a number plant at high temperature shows as pollen abortion, and shows as fertility restorer under low temperature.
Above-mentioned embodiment is only the preferred embodiment of the present invention; can not limit the scope of protection of the invention with this, change and the replacement of any unsubstantiality that those skilled in the art does on basis of the present invention all belong to the present invention's scope required for protection.
Claims (8)
1. one kind utilizes TALEN system rite-directed mutagenesis RNase Z
s1cultivate the method for rice temp-sensing sterile line, it comprises the following steps:
1) target sequence design: according to RNase Z
s1left side TALE recognition sequence, right side TALE recognition sequence is designed respectively at TMS5 or Os02g0214300 of paddy rice or LOC_Os02g12290 coding region;
2) left and right side TALE recognition sequence is changed into identification module: according to the base identification principle in TALE albumen RVD district, arranged on left and right sides TALE recognition sequence is changed into identification module;
3) build containing above-mentioned steps 2) TALEN-L and the TALEN-R carrier of identification module;
4) synthesis is containing the binary vector of TALEN-L and TALEN-R;
5) genetic transformation obtains positive transgenic plant;
6) plant obtaining sudden change in positive transgenic plant is screened;
7) plant of said mutation is gone down to posterity plantation, obtain not with transgene component and the fertility restorer plant that can educate as temperature sensitive sterile strain.
2. method according to claim 1, is characterized in that, left side TALE recognition sequence, TALE recognition sequence interval, right side 13-22 base.
3. method according to claim 1, it is characterized in that, step 3) in, containing above-mentioned steps 2) the TALEN carrier of identification module is: first synthesis and each base pair of identification module TAL identification module of answering, according to recognition sequence, described TAL identification module is polymerized, then respectively by the N-end of two TALE Module Links be polymerized to endonuclease Fok I, the endonuclease TALEN of energy specific cleavage DNA sequence dna is formed; To cut through enzyme and check order acquisition positive plasmid; Form TALEN-L and TALEN-R respectively.
4. method according to claim 3, it is characterized in that, step 4) in, synthesis containing the step of the binary vector of TALEN-L and TALEN-R is: cut down by the TALEN expression cassette in TALEN-L and TALEN-R carrier and be linked in same binary vector, forms TALEN binary vector.
5. method according to claim 4, is characterized in that, step 5) be specially: by TALEN binary vector by Agrobacterium tumefaciens mediated genetic transformation or Bombardment-Mediated Transformation Rice Callus; Through screening, break up and seedling of taking root, transfer-gen plant is planted in solarium, identified by Totomycin and collect positive transgenic plant.
6. method according to claim 5, is characterized in that, step 6) be specially: extract T
0for the DNA of positive transgenic plant, increase to DNA with primer SEQ ID NO.5 and SEQ ID NO.6, the order-checking of product purified Hou Song company, the WT lines gene comparision before sequencing result and transgenosis, obtains the successful plant that suddenlys change.
7. method according to claim 6, is characterized in that, step 7) be specially: results T
0in generation, realizes the seed of plant of rite-directed mutagenesis, long day/hot conditions under plant T
1for plant, by pollen fertility observe to be separated not with transgene component with Totomycin positive detection and the sterile plant of phenotype plant in short day/cold condition under, the plant that fertility restorer can be educated, as temperature sensitive sterile strain, obtains temp-sensing sterile line after breeding.
8. method according to claim 1, is characterized in that, step 6) plant of described sudden change is base deletion or base is inserted or base is replaced plant between recognition sequence.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510009577.3A CN104651393B (en) | 2015-01-06 | 2015-01-06 | A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510009577.3A CN104651393B (en) | 2015-01-06 | 2015-01-06 | A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104651393A true CN104651393A (en) | 2015-05-27 |
| CN104651393B CN104651393B (en) | 2018-07-31 |
Family
ID=53243036
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510009577.3A Active CN104651393B (en) | 2015-01-06 | 2015-01-06 | A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104651393B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105210858A (en) * | 2015-11-09 | 2016-01-06 | 湖南杂交水稻研究中心 | The breeding method of a kind of hybrid rice |
| CN113817768A (en) * | 2021-09-13 | 2021-12-21 | 湖南杂交水稻研究中心 | Method for improving rice temperature-sensitive sterile line, application and recombinant vector |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333533A (en) * | 2008-07-25 | 2008-12-31 | 华南农业大学 | Temperature sensing male fertile gene and use thereof |
| CN102505013A (en) * | 2011-10-25 | 2012-06-20 | 安徽省农业科学院水稻研究所 | Development and application of marker tightly interlocked with rice thermo-sensitive sterile gene tms5 |
| CN103555711A (en) * | 2013-07-22 | 2014-02-05 | 安徽省农业科学院水稻研究所 | Non-transgenic genome directed molecule improvement method and application of main crops |
-
2015
- 2015-01-06 CN CN201510009577.3A patent/CN104651393B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333533A (en) * | 2008-07-25 | 2008-12-31 | 华南农业大学 | Temperature sensing male fertile gene and use thereof |
| CN102505013A (en) * | 2011-10-25 | 2012-06-20 | 安徽省农业科学院水稻研究所 | Development and application of marker tightly interlocked with rice thermo-sensitive sterile gene tms5 |
| CN103555711A (en) * | 2013-07-22 | 2014-02-05 | 安徽省农业科学院水稻研究所 | Non-transgenic genome directed molecule improvement method and application of main crops |
Non-Patent Citations (3)
| Title |
|---|
| HAI ZHOU ET AL.: "Development of Commercial Thermo-sensitive Genic Male Sterile Rice Accelerates Hybrid Rice Breeding Using the CRISPR/Cas9-mediated TMS5 Editing System", 《NATURE》 * |
| 周海等: "RNaseZS1加工UbL40mRNA控制水稻温敏雄性核不育", 《遗传》 * |
| 周海等: "水稻光温敏不育基因的克隆和分子机理", 《2013全国植物生物学大会论文集》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105210858A (en) * | 2015-11-09 | 2016-01-06 | 湖南杂交水稻研究中心 | The breeding method of a kind of hybrid rice |
| CN105210858B (en) * | 2015-11-09 | 2017-07-25 | 湖南杂交水稻研究中心 | A kind of breeding method of hybrid rice |
| CN113817768A (en) * | 2021-09-13 | 2021-12-21 | 湖南杂交水稻研究中心 | Method for improving rice temperature-sensitive sterile line, application and recombinant vector |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104651393B (en) | 2018-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104651392B (en) | A method of obtaining temp-sensing sterile line using CRISPR/Cas9 system rite-directed mutagenesis P/TMS12-1 | |
| US11767536B2 (en) | Method for obtaining glyphosate-resistant rice by site-directed nucleotide substitution | |
| US11820990B2 (en) | Method for base editing in plants | |
| CN106701818A (en) | Method for cultivating rice common nuclear sterile lines | |
| CN107326042A (en) | The fixed point of paddy rice TMS10 genes knocks out system and its application | |
| Kubo et al. | Male sterility-inducing mitochondrial genomes: how do they differ? | |
| CN106011167A (en) | Application of male sterility gene OsDPW2 and rice sterility recovery method | |
| CN106164272A (en) | The plant modified | |
| CN104293827A (en) | Method for acquiring temperature-sensitive sterile line by performing site-directed mutagenesis on RNase ZS1 | |
| EP3978613A1 (en) | Parthenogenetic haploid induction gene dmp and application thereof | |
| KR20200140367A (en) | How to use plant hybrid accents | |
| CN105950651A (en) | Application of male-sterility gene OsGEN and method for restoring fertility | |
| CN111763687A (en) | Method for rapidly cultivating corn haploid induction line based on gene editing technology | |
| US20220403409A1 (en) | CCA Gene For Virus Resistance | |
| Arulganesh et al. | Genome editing of elite rice cultivar CO51 for bacterial leaf blight resistance | |
| CN113004383B (en) | Application of corn gene ZmEREB102 in improving corn yield | |
| Farinati et al. | Current insights and advances into plant male sterility: new precision breeding technology based on genome editing applications | |
| WO2009133718A1 (en) | Genome shuffling method and recurrent selection breeding system based on same method in self-fertilizing plant using dominant male sterility constructed by dna manipulation method | |
| CN104651393A (en) | Method for cultivating thermo-sensitive genic male sterile rice through site-specific mutagenesis of RNase ZS1 by utilizing TALEN system | |
| CN108795978A (en) | A kind of method and its application for formulating male sterility crop new germ plasm by gene editing | |
| CN107022564B (en) | Method for modifying wheat | |
| CN110724694A (en) | Rice fertility gene SAW1 and application thereof | |
| CN112251459B (en) | Method for preparing and identifying male gametophyte sterility | |
| CN117296710B (en) | Method for rapidly creating cytoplasmic male sterile line | |
| CN105985980A (en) | Method for obtaining temperature-sensitive sterile line through site-directed mutagenesis of RNase Z<S1> by using ZFN system |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |