CN104651393B - A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 - Google Patents
A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 Download PDFInfo
- Publication number
- CN104651393B CN104651393B CN201510009577.3A CN201510009577A CN104651393B CN 104651393 B CN104651393 B CN 104651393B CN 201510009577 A CN201510009577 A CN 201510009577A CN 104651393 B CN104651393 B CN 104651393B
- Authority
- CN
- China
- Prior art keywords
- talen
- plant
- sequence
- tale
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
TALEN system rite-directed mutagenesis RNase Z are utilized the invention discloses a kind ofS1The method for cultivating rice temp-sensing sterile line comprising target sequence designs；Left and right side TALE identifications is Sequence Transformed at identification module；Build the TALEN carriers containing identification module；Synthesize the binary vector of L containing TALEN and TALEN R；Genetic transformation obtains positive transgenic plant；The plant of mutation is obtained in selection positive transgenic plant；The plant passage plantation and separation of mutation are obtained without the fertile plant of fertility restorer under transgene component but low temperature as temperature sensitive sterile plant.RNase Z are inactivated by TALEN system rite-directed mutagenesisS1The activity of albumen realizes that artificial culture can obtain the temp-sensing sterile line without transgene component, has purpose strong, Genomic damage is small, has evaded the possibility risk that transgenosis is brought.
Description
Technical field
The present invention relates to the breeding methods of rice temp-sensing sterile line, and in particular to a kind of to utilize TALEN system rite-directed mutagenesis
RNase ZS1The method for cultivating rice temp-sensing sterile line.
Background technology
Rice (Oryza sativa L.) is most important cereal crops, and the whole world is more than that the population of half is with rice
Staple food.With the growth of population and the reduction of arable area, the unbalanced supply-demand of grain becomes increasingly significantly, to increase grain
Yield per unit area is one of the major measure for solving grain unbalanced supply-demand.Fortunately, hybrid rice can be than conventional water
Rice improve 20-30% yield, play the role of on solving the problems, such as short-commons it is very important, therefore, hybrid rice
Cultivated area grow steadily, account about 60% or so of Monitoring of Paddy Rice Plant Area now.
The method of breeding of hybridized rice can be divided into two line method and three systems according to the difference of used sterile set type
Method.Three line method uses cytoplasmic male sterile line and restorer production hybrid F1For seed, pass through maintainer and cytoplasmatic male
Sterile line outbreeding cytoplasmic male sterile line；But can as restorer rice varieties in conventional rice only about
5% is accounted for, this greatly reduces the genetic diversity between restorer and sterile line, limits the utilization of hybrid vigour.And two line method
Mainly use up/thcrmo-scnsitivc genie male stcrility system as sterile line and maintainer because light/temp-sensing sterile line fertility is by photoperiod and temperature
Degree regulation and control, can be used as sterile line under the conditions of infertility, maintainer are can be used as under the conditions of fertile, one is dual-purpose.And because not
It is influenced by nucleo-cytoplasmic interreaction, almost all of normal kind can all be used as restorer.Difference based on these substantially, two
Being method hybrid rice technology has more extensive restorer, need not utilize special restoring gene so that formulated in combination is more
Add freedom, be conducive to the utilization of inter-subspecific heterosis, exists more to the rice matter, yield, resistance etc. that improve Hybrid Rice Combinations
Big potential advantages；Light/temp-sensing sterile line can one be dual-purpose, not need maintainer, simplify production routine；Temperature sensitive sterility is by core
Gene controls, unrelated with cytoplasm, enriches the diversity of cytoplasmic inheritance, avoids the negative of ternary hybrid rice sterile cytoplasm
Effect and the single potential danger that may be brought of cytoplasm.Therefore there are huge latent in breeding of hybridized rice for temp-sensing sterile line
Power, in comparison, widely applied in double-linear hybrid rice breeding at present is temp-sensing sterile line.
It is first indica type temperature sensitive sterile mutant being found to pacify agriculture S-1 temp-sensing sterile lines, and thermo-sensitive sterile material is often
It is obtained by natural mutation or induced mutations, but the frequency of mutation is very low, and traditional breeding method means is utilized to obtain mutation
Thermo-sensitive sterile material is cultivated needs very long process as temp-sensing sterile line, and the cultivation efficiency reduction for improving temp-sensing sterile line is cultivated
Process has become critical issue in the urgent need to address.Therefore genetic engineering means must be used, the office of traditional breeding method is broken through
Limit.Although RNAi and Antisense RNA Technique can realize that the inhibition to target gene is expressed, the work(of gene can not be thoroughly removed
Can, the remaining function of gene often improves the critical temperature of sterility of transfer-gen plant, is unfavorable for the safety of breeding, and these
Exogenous array is inevitably remained in transfer-gen plant, is related to Transgenic Food Safety Issue.Recently, mutating technology is targeted
Breakthrough is achieved, is widely used in different kind organism.These methods are all to identify sequence by special target or draw
It leads sequence and endonuclease is directed to target position, then endonuclease cleavage target DNA, in cell itself repair system
With the help of the DNA of cut-out reparation is chained up, but base is often caused to lose or increase in repair process.Mesh
Before, although interfering RNase Z by RNAi technologyS1, obtain temperature sensitive sterile plant；But RNAi technology, which is part, to drop
Low RNase ZS1Expression quantity, it can not be made thoroughly to inactivate so that the critical temperature of sterility of transfer-gen plant is higher, and
Critical temperature of sterility is unstable, influences production of hybrid seeds safety.
Invention content
For overcome the deficiencies in the prior art, it is pinpointed and is dashed forward using TALEN systems the purpose of the present invention is to provide a kind of profit
Become RNase ZS1The method for cultivating rice temp-sensing sterile line inactivates RNase Z by TALEN system rite-directed mutagenesisS1The work of albumen
Property, practical temp-sensing sterile line of the artificial culture without transgene component is obtained, has purpose strong, Genomic damage is small, rule
The possibility risk that transgenosis is brought is kept away.
To solve the above problems, the technical solution adopted in the present invention is as follows：
It is a kind of to utilize TALEN system rite-directed mutagenesis RNase ZS1The method for cultivating rice temp-sensing sterile line comprising following
Step：
1) target sequence designs：According to RNase ZS1In the TMS5 or Os02g0214300 or LOC_ of rice
The code areas Os02g12290 separately design left side TALE identifications sequence, right side TALE identification sequences；
2) left and right side TALE identifications is Sequence Transformed at identification module：Principle is identified according to the base in the areas TALE albumen RVD
Arranged on left and right sides TALE identifications is Sequence Transformed at identification module；
3) structure contain above-mentioned steps 2) identification module TALEN carriers；
4) binary vector containing TALEN-L and TALEN-R is synthesized；
5) genetic transformation obtains positive transgenic plant；
6) screening positive transgenic plant obtains the plant of mutation；
7) plant of above-mentioned mutation is passed on into plantation and separation, obtains that fertility restorer is fertile and plant without transgene component
Strain is used as temperature sensitive sterile plant.
Specifically, in step 1), according to RNase ZS1In the TMS5 or Os02g0214300 or LOC_ of rice
The code areas Os02g12290 separately design left side TALE identification sequences and right side TALE identification sequences.Left and right sides identifies that sequence is general
13-22 bases are spaced, 18 bases are best, and identification sequence length is generally 16-20 base.
Specifically, in step 3), containing above-mentioned steps 2) the TALEN carriers of identification module are：Synthesis and identification module first
The TAL identification modules polymerize, then respectively by two by the corresponding TAL identification modules of each base according to identification sequence
The TALE Module Links of polymerization form the endonuclease of energy specific cleavage DNA sequence dna to the ends N- of endonuclease Fok I
Enzyme TALEN；Positive plasmid is obtained through digestion and sequencing；It is respectively formed TALEN-L and TALEN-R.
Specifically, in step 4), the step of synthesizing binary vector containing TALEN-L and TALEN-R, is：By TALEN-L and
TALEN expression cassettes in TALEN-R carriers, which are cut down, to be linked in the same binary vector, and TALEN binary vectors are formed.
Specifically, step 5) is specially：TALEN binary vectors are passed through into Agrobacterium-mediated genetic transformation method or particle gun
Method rice transformation callus；Through screening, breaks up and seedling of taking root is reflected by transfer-gen plant plantation in solarium by hygromycin
Determine and collects positive transgenic plant.
Specifically, step 6) is specially：Extract T0For the DNA of positive transgenic plant, with primer SEQ ID NO.5 and
SEQ ID NO.6 are expanded, the purified Hou Song companies sequencing of product, sequencing result and the WT lines sequence before transgenosis
It is compared, the plant of base deletion, insertion or replacement is to be mutated successful plant.
Specifically, step 7) is specially：Harvest T0In generation, realizes the seed of the plant of rite-directed mutagenesis, in high temperature/long day condition
Lower plantation T1For plant, the plant without transgene component but phenotype infertility is separated to by Phenotypic Observation and hygromycin positive detection
In low temperature/under the conditions of short day, the fertile plant of fertility restorer obtains temperature sensitive infertility as temperature sensitive sterile plant after breeding for strain plantation
System.
Specifically, the plant of the step 6) mutation in the present invention shows as base deletion or base is inserted into or base is replaced
It changes.
Compared with prior art, the beneficial effects of the present invention are：
1. of the present invention utilize TALEN system rite-directed mutagenesis RNase ZS1The method for cultivating rice temp-sensing sterile line will
Rite-directed mutagenesis obtains temperature sensitive sterile mutant, realizes the practical temp-sensing sterile line of artificial culture, and this temp-sensing sterile line is
There can be purpose strong, the small advantage of Genomic damage can evade what transgenosis may be brought without transgene component
Risk；
2. of the present invention utilize TALEN system rite-directed mutagenesis RNase ZS1Cultivate the method contracting of rice temp-sensing sterile line
The short time for cultivating temp-sensing sterile line, the process of breeding is accelerated, cost is saved；
3. method of the present invention does not change the genetic background of acceptor material substantially, and can be by by triple crossing water
The maintainer rite-directed mutagenesis of rice is temp-sensing sterile line, can ternary hybrid rice be changed to two-line hybrid rice, expand the screening of restorer
Range improves heterosis utilization efficiency, and then improves yield, resistance and rice quality；
4. the present invention overcomes natural mutation or traditional induced mutations TMS5 (RNase ZS1) inactivation new mutation deposited
Problem；The new temp-sensing sterile line that can be used for double-line hybrid breeding of mutagenesis.
Invention is further described in detail with reference to the accompanying drawings and detailed description.
Description of the drawings
The TMS5-1-1T that Fig. 1 is obtained by the embodiment of the present invention 11For plant hygromycin qualification result, wherein 1-7 difference
For T1For 7 plants in plant；
Fig. 2 is pollen fertility of the TMS5-1-2 plant under condition of different temperatures obtained in embodiment 1, wherein HT
Indicate that high temperature, LT indicate that low temperature, WT indicate the plant before transgenosis；
Fig. 3 is the TMS5-2-1T that the embodiment of the present invention 2 obtains1For plant hygromycin qualification result, wherein 1-8 is respectively
T1For 8 plants in plant；
Fig. 4 is the pollen fertility under the 7th plant of plant condition of different temperatures of 2TMS5-2-1 of the embodiment of the present invention, wherein ZH11
It indicates that 11, HT is spent to indicate that high temperature, LT indicate low temperature in wild rice.
Specific implementation mode
It is a kind of to utilize TALEN system rite-directed mutagenesis RNase ZS1The method for cultivating rice temp-sensing sterile line comprising following
Step：
1) target sequence designs：According to RNase ZS1In the TMS5 or Os02g0214300 or LOC_ of rice
The code areas Os02g12290 separately design left side TALE identifications sequence, right side TALE identification sequences；
2) left and right side TALE identifications is Sequence Transformed at identification module：Principle is identified according to the areas TALE albumen RVD base,
Arranged on left and right sides TALE identifications is Sequence Transformed at identification module；
3) structure contain above-mentioned steps 2) identification module TALEN-L and TALEN-R carriers；
4) binary vector containing TALEN-L and TALEN-R is synthesized；
5) genetic transformation obtains positive transgenic plant；
6) plant that mutation is obtained in positive transgenic plant is screened；
7) the plant passage plantation of above-mentioned mutation obtains without transgene component and the fertile plant of fertility restorer is as temperature
Quick sterile plant.
Specifically, in step 1), according to RNase ZS1In the TMS5 or Os02g0214300 or LOC_ of rice
The code areas Os02g12290 separately design left side TALE identifications sequence, right side TALE identification sequences.Left and right sides identifies that sequence is general
13-22 bases are spaced, 18 bases are best, and identification sequence length is generally 16-20 base.
Specifically, in step 3), containing above-mentioned steps 2) the TALEN carriers of identification module are：Synthesis and identification module first
The TAL identification modules polymerize, then respectively by two by the corresponding TAL identification modules of each base according to identification sequence
The TALE Module Links of polymerization form the endonuclease of energy specific cleavage DNA sequence dna to the ends N- of endonuclease Fok I
Enzyme TALEN；Positive plasmid is obtained through digestion and sequencing；Shape is respectively at TALEN-L and TALEN-R.
Specifically, in step 4), the step of synthesizing binary vector containing TALEN-L and TALEN-R, is：By TALEN-L and
TALEN expression cassettes in TALEN-R carriers, which are cut down, to be linked in the same binary vector, and TALEN binary vectors are formed.
Specifically, step 5) is specially：TALEN binary vectors are passed through into Agrobacterium-mediated genetic transformation method or particle gun
Method rice transformation callus；Through screening, break up and seedling of taking root, transfer-gen plant is planted in solarium after hardening, passes through tide
Mycin detects and collects positive transgenic plant.
Specifically, step 6) is specially：Extract T0For the DNA of positive transgenic plant, with primer SEQ ID NO.5 and
SEQ ID NO.6 are expanded, the purified Hou Song companies sequencing of product, the WT lines sequence of sequencing result and non-transgenosis
Compare, it is to be mutated successful plant to have the plant of replacement or base deletion or insertion.
Specifically, step 7) is specially：Harvest T0In generation, realizes the seed of the transfer-gen plant of rite-directed mutagenesis, in high temperature/length
T is planted under the conditions of day1For plant, it is separated to without transgene component and phenotype not by Phenotypic Observation and hygromycin positive identification
In low temperature/under the conditions of short day, the fertile plant of fertility restorer obtains temperature as temperature sensitive sterile plant after breeding for the plant plantation educated
Quick sterile line.
Specifically, the plant of the step 6) mutation in the present invention shows as in RNase ZS1Alkali is lacked between identification sequence
Base is inserted into base or base replacement.
It is specific embodiment of the present invention below.
Embodiment 1
TALEN system rite-directed mutagenesis RNase Z are utilized in spending 11 in japonica rice varietyS1(Os02g0214300) temperature is cultivated
Quick sterile line, is as follows：
1) target sequence designs：
Left side TALE identifies that sequence Target-TMS5-1L, sequence are SEQ ID NO.1：CGGCCGAAGGCGAAGGC,
61-77 positioned at the code areas Os02g0214300；
Right side TALE identifies that sequence Target-TMS5-1R, sequence are SEQ ID NO.2：CCACGGGGTAGCCCTC, position
94-109 in the code areas Os02g0214300；
2) arranged on left and right sides TALE identifications is Sequence Transformed at identification module：
Target-TMS 5-1L are converted to the RVD sequences of TALE identification modules (wherein each two amino is a module)
For SEQ ID NO.3：His Asp Asn Asn Asn Asn His Asp His Asp Asn Asn Asn Ile Asn Ile
Asn Asn Asn Asn His Asp Asn Asn Asn Ile Asn Ile Asn Asn Asn Asn His Asp；
Target-TMS5-1R is converted to the RVD sequence SEQ ID NO.4 of TALE identification modules：His Asp His Asp Asn Ile
His Asp Asn Asn Asn Asn Asn Asn Asn Asn Asn Gly Asn Ile Asn Asn His Asp His
Asp His Asp Asn Gly His Asp；
3) the TALEN carriers containing above-mentioned arranged on left and right sides TALE identification modules are built：
The corresponding TAL identification modules of each base are respectively synthesized, are polymerize according to identification module described in identification sequence, respectively
The TALE Module Links that two are polymerize form the interior of energy specific cleavage DNA sequence dna to the ends N- of endonuclease Fok I
Cut nuclease TALEN；Through digestion and sequence verification positive plasmid, it is respectively formed TALEN-TMS5-1L and TALEN-TMS5-1R；
4) the TALEN binary vectors containing TALEN-TMS5-1L and TALEN-TMS5-1R are built：
TALEN expression cassettes in TALEN-TMS5-1L and TALEN-TMS5-1R carriers are cut down be linked to it is same
In binary vector, TALEN-TMS5-1 carriers are formed；
5) genetic transformation obtains positive transgenic plant：
TALEN-TMS5-1 carriers containing target are passed through into Agrobacterium-mediated genetic transformation rice transformation callus；Through
Screening, breaks up and seedling of taking root identifies positive transgenic plant by transfer-gen plant plantation in solarium by hygromycin；
6) plant of mutation is obtained after positive transgenic plant is purified：
Extract T0For the DNA of positive plant, with primer TMS5s F, sequence is SEQ ID NO.5：
AACCTCTTACAGGCTAGATG and TMS5s R, sequence are SEQ ID NO.6：TCGTGCTCCTGACCAATCTC amplifications are above-mentioned
DNA, the purified Hou Song companies sequencing of product, sequencing result is compared with the WT lines sequence before transgenosis, analysis mutation feelings
Condition, referring specifically to SEQ ID NO.7- SEQ ID NO.9；
WT(SEQ ID NO.7)：CGGGTCGGCCGAAGGCGAAGGCGCCGCCCCTCA CCGTCGAGGGCTACCCCGT
GGAGGGCA
TMS5-1-1(SEQ ID NO.8)：CGGGTCGGCCGAAGGCGAAGGCGCCGCCC C**ACCGTCGAGGG
CTACCCCGTGGAGGGCA
TMS5-1-2(SEQ ID NO.9)：CGGGTCGGCCGAAGGCGAAGGCGCCGC C** *****GTCGAGGG
CTACCCCGTGGAGGGCA
Wherein, TMS5-1-1 and TMS5-1-2 indicates different transgenic lines；WT indicates wild type；" * " table in sequence
Show base deletion；Sequencing result is shown：Mutant plant accounts for the 5.7% of total positives transfer-gen plant, and the missing of base illustrates to pinpoint
It is mutated successfully；And the mutation type is base deletion；
7) the plant passage plantation of above-mentioned mutation, obtains the fertile plant of fertility restorer as temperature sensitive sterile plant：
Harvest T0In generation, realizes the seed of the plant of rite-directed mutagenesis, and T is planted under long day/hot conditions1For plant, by educating
Property observation and hygromycin positive identification be separated to without the plant of transgene component and phenotype infertility plantation in short day/cryogenic conditions
Under, the recoverable plant of pollen fertility obtains temp-sensing sterile line as temperature sensitive sterile plant after breeding；As a result referring to Fig. 1 and 2.
Fig. 1's the result shows that, T1It is without transgene component in plant 2 and 5；Fig. 2 the result shows that, No. 2 plant exist
Pollen abortion is shown as under high temperature, and shows as fertility restorer under low temperature.
Embodiment 2
TALEN system rite-directed mutagenesis RNase Z are utilized in spending 11 in japonica rice varietyS1(Os02g0214300) temperature is cultivated
Quick sterile line, is as follows：
1) target sequence designs：
Left side TALE identifies that sequence Target-TMS5-2L, sequence are SEQ ID NO.10：CACCGTCGAGGGCTAC,
87-102 positioned at the code areas Os02g0214300；
Right side TALE identifies that sequence Target-TMS5-2R, sequence are SEQ ID NO.11：CTCCTGCCCGCCGAT, position
121-135 in the code areas Os02g0214300；
2) arranged on left and right sides TALE identifications is Sequence Transformed at identification module：
Target-TMS5-2L is converted to the RVD sequences of TALE identification modules (wherein each two amino is a module)
For SEQ ID NO.12：His Asp Asn Ile His Asp His Asp Asn Asn Asn Gly His Asp Asn
Asn Asn Ile Asn Asn Asn Asn Asn Asn His Asp Asn Gly Asn Ile His Asp； Target-
The RVD sequences that TMS5-2R is converted to TALE identification modules are SEQ ID NO.13：His Asp Asn Gly His Asp His
Asp Asn Asn Asn His Asp His Asp His Asp Asn Asn His Asp His Asp Asn Asn Asn
Ile Asn Gly；
3) the TALEN carriers containing above-mentioned arranged on left and right sides TALE identification modules are built：
It is respectively synthesized the corresponding TAL identification modules of each base first, gathers these identification modules according to identification sequence
It closes, the TALE Module Links for respectively polymerizeing two to the ends N- of endonuclease Fok I, being formed can specific cleavage DNA
The endonuclease TALEN of sequence.Digestion and sequence verification positive plasmid, are respectively formed TALEN-TMS5-2L and TALEN-
TMS5-2R；
4) the TALEN binary vectors containing TALEN-TMS5-2L and TALEN-TMS5-2R are built：
The TALEN expression cassettes in TALEN-TMS5-2L and TALEN-TMS5-2R carriers are cut down respectively and are linked to together
In one binary vector, TALEN-TMS5-2 carriers are formed；
5) genetic transformation obtains positive transgenic plant：
TALEN-TMS5-1 carriers containing target are passed through into Agrobacterium-mediated genetic transformation rice transformation callus；Through
Screening, breaks up and seedling of taking root identifies positive transgenic plant by transfer-gen plant plantation in solarium by hygromycin；
6) selection obtains the plant of mutation after positive transgenic plant is purified：
Extract T0For the DNA of positive plant, with primer TMS5s F, sequence is SEQ ID NO.4：
AACCTCTTACAGGCTAGATG；TMS5s R, sequence are SEQ ID NO.5：TCGTGCTCCTGACCAATCTC amplifications are above-mentioned
DNA, the purified Hou Song companies sequencing of product, sequencing result is compared with the WT lines sequence before transgenosis, analysis mutation feelings
Condition；Referring specifically to SEQ ID NO.14-SEQ ID NO.17；
WT(SEQ ID NO.14)：GCCCCTCACCGTCGAGGGCTACCCCGTGGAGG
GCATCTCCATCGGCGGGCAGGAGACCTG
TMS5-2-1(SEQ ID NO.15)：GCCCCTCACCGTCGAGGGCTACCCCGTGG A*
GGCATCTCCATCGGCGGGCAGGAGACCTG
TMS5-2-2(SEQ ID NO.16)：GCCCCTCACCGTCGAGGGCTACCCCGTGG **
GGCATCTCCATCGGCGGGCAGGAGACCTG
TMS5-2-3(SEQ ID NO.17)：GCCCCTCACCGTCGAGGGCTACCCCGTGGA ****
ATCTCCATCGGCGGGCAGGAGACCTG
Wherein, TMS5-2-1, -2 and -3 indicate different transgenic lines；WT indicates wild type；" * " indicates alkali in sequence
Base lacks；Sequencing result is shown：Mutant plant accounts for the 3.5% of total positives transfer-gen plant, and mutation type is base deletion；That is alkali
The missing of base illustrates rite-directed mutagenesis success；
7) the plant passage plantation of above-mentioned mutation, obtains the fertile plant of fertility restorer as temperature sensitive sterile plant：
Harvest T0In generation, realizes the seed of the plant of rite-directed mutagenesis, and T is planted under long day/hot conditions1For plant, pass through table
Type is observed and hygromycin positive detection is separated to and is planted in short day/cryogenic conditions without the plant of transgene component but phenotype infertility
Under, the fertile plant of fertility restorer obtains temp-sensing sterile line as temperature sensitive sterile plant after breeding, and as a result ginseng is seen figures 3 and 4.
Fig. 3 the result shows that, T1It is without transgene component in plant 4 and 7；Fig. 4 is the result shows that 7, and number plant is in height
Pollen abortion is shown as under temperature, and shows as fertility restorer under low temperature.
The above embodiment is only the preferred embodiment of the present invention, and the scope of protection of the present invention is not limited thereto,
The variation and replacement for any unsubstantiality that those skilled in the art is done on the basis of the present invention belong to institute of the present invention
Claimed range.
Claims (7)
1. a kind of utilizing TALEN system rite-directed mutagenesisRNase Z S1 The method for cultivating rice temp-sensing sterile line comprising following step
Suddenly：
1）Target sequence designs：
According toRNase Z S1 Left side TALE identifications sequence, right side TALE knowledges are separately designed in the code areas Os02g0214300 of rice
Other sequence；Left side TALE identifies that sequence, right side TALE identify train interval 13-22 bases；Identification sequence length is 16-20 alkali
Base；
Left side TALE identifies that sequence Target-TMS5-1L, sequence are SEQ ID NO.1：CGGCCGAAGGCGAAGGC is located at
The 61-77 of the code areas Os02g0214300；
Right side TALE identifies that sequence Target-TMS5-1R, sequence are SEQ ID NO.2：CCACGGGGTAGCCCTC is located at
The 94-109 of the code areas Os02g0214300；
Or, left side TALE identifies that sequence Target-TMS5-2L, sequence are SEQ ID NO.10：CACCGTCGAGGGCTAC, position
87-102 in the code areas Os02g0214300；
Right side TALE identifies that sequence Target-TMS5-2R, sequence are SEQ ID NO.11：CTCCTGCCCGCCGAT is located at
The 121-135 of the code areas Os02g0214300；
2）Left and right side TALE identifications is Sequence Transformed at identification module：Principle is identified according to the base in the areas TALE albumen RVD, it will
Arranged on left and right sides TALE identifications are Sequence Transformed at identification module；
3）Structure contains above-mentioned steps 2）TALEN-L the and TALEN-R carriers of identification module；
4）Synthesize the binary vector containing TALEN-L and TALEN-R；
5）Genetic transformation obtains positive transgenic plant；
6）The plant of mutation is obtained in screening positive transgenic plant；
7）The plant passage plantation of above-mentioned mutation, obtain without transgene component and the fertile plant of fertility restorer as it is temperature sensitive not
Educate strain.
2. according to the method described in claim 1, it is characterized in that, step 3）In, contain above-mentioned steps 2）Identification module
TALEN carriers are：TAL identification modules corresponding with each base of identification module are synthesized first, it will be described according to identification sequence
TAL identification modules polymerize, the TALE Module Links for then respectively polymerizeing two to the ends N- of endonuclease Fok I, shape
At the endonuclease TALEN of energy specific cleavage DNA sequence dna；Positive plasmid is obtained through digestion and sequencing；It is respectively formed
TALEN- L and TALEN- R.
3. according to the method described in claim 2, it is characterized in that, step 4）In, synthesis is double containing TALEN-L and TALEN-R
The step of first carrier is：TALEN expression cassettes in TALEN- L and TALEN- R carriers are cut down and are linked to same pair
In first carrier, TALEN binary vectors are formed.
4. according to the method described in claim 3, it is characterized in that, step 5）Specially：TALEN binary vectors are passed through into crown gall
Agrobacterium-mediated genetic transformation or Bombardment-Mediated Transformation Rice Callus；Through screening, break up and seedling of taking root, by transgenosis
Plant is planted in solarium, is identified by hygromycin and collects positive transgenic plant.
5. according to the method described in claim 4, it is characterized in that, step 6）Specially：Extract T0For positive transgenic plant
DNA, DNA is expanded with primer SEQ ID NO.5 and SEQ ID NO.6, the sequencing of product purified Hou Song companies, sequencing
As a result it compared with the WT lines sequence before transgenosis, obtains and is mutated successful plant.
6. according to the method described in claim 5, it is characterized in that, step 7）Specially：Harvest T0In generation, realizes the plant of rite-directed mutagenesis
The seed of strain, T is planted under long day/hot conditions1For plant, is observed by pollen fertility and detached not with hygromycin positive detection
With the plantation of the plant of transgene component and phenotype infertility under short day/cryogenic conditions, the fertile plant of fertility restorer is as temperature sensitive
Sterile plant obtains temp-sensing sterile line after breeding.
7. according to the method described in claim 1, it is characterized in that, step 6）The plant of the mutation is base between identification sequence
Missing or the plant that base is inserted into or base is replaced.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510009577.3A CN104651393B (en) | 2015-01-06 | 2015-01-06 | A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510009577.3A CN104651393B (en) | 2015-01-06 | 2015-01-06 | A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104651393A CN104651393A (en) | 2015-05-27 |
| CN104651393B true CN104651393B (en) | 2018-07-31 |
Family
ID=53243036
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510009577.3A Active CN104651393B (en) | 2015-01-06 | 2015-01-06 | A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104651393B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105210858B (en) * | 2015-11-09 | 2017-07-25 | 湖南杂交水稻研究中心 | A kind of breeding method of hybrid rice |
| CN113817768A (en) * | 2021-09-13 | 2021-12-21 | 湖南杂交水稻研究中心 | Method for improving rice temperature-sensitive sterile line, application and recombinant vector |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333533A (en) * | 2008-07-25 | 2008-12-31 | 华南农业大学 | Temperature sensing male fertile gene and use thereof |
| CN102505013A (en) * | 2011-10-25 | 2012-06-20 | 安徽省农业科学院水稻研究所 | Development and application of marker tightly interlocked with rice thermo-sensitive sterile gene tms5 |
| CN103555711A (en) * | 2013-07-22 | 2014-02-05 | 安徽省农业科学院水稻研究所 | Non-transgenic genome directed molecule improvement method and application of main crops |
-
2015
- 2015-01-06 CN CN201510009577.3A patent/CN104651393B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333533A (en) * | 2008-07-25 | 2008-12-31 | 华南农业大学 | Temperature sensing male fertile gene and use thereof |
| CN102505013A (en) * | 2011-10-25 | 2012-06-20 | 安徽省农业科学院水稻研究所 | Development and application of marker tightly interlocked with rice thermo-sensitive sterile gene tms5 |
| CN103555711A (en) * | 2013-07-22 | 2014-02-05 | 安徽省农业科学院水稻研究所 | Non-transgenic genome directed molecule improvement method and application of main crops |
Non-Patent Citations (3)
| Title |
|---|
| Development of Commercial Thermo-sensitive Genic Male Sterile Rice Accelerates Hybrid Rice Breeding Using the CRISPR/Cas9-mediated TMS5 Editing System;Hai Zhou et al.;《Nature》;20161122;1-12 * |
| RNaseZS1加工UbL40mRNA控制水稻温敏雄性核不育;周海等;《遗传》;20141231;1274 * |
| 水稻光温敏不育基因的克隆和分子机理;周海等;《2013全国植物生物学大会论文集》;20131008;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104651393A (en) | 2015-05-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104651392B (en) | A method of obtaining temp-sensing sterile line using CRISPR/Cas9 system rite-directed mutagenesis P/TMS12-1 | |
| US11767536B2 (en) | Method for obtaining glyphosate-resistant rice by site-directed nucleotide substitution | |
| CN107326042A (en) | The fixed point of paddy rice TMS10 genes knocks out system and its application | |
| CN104293827A (en) | Method for acquiring temperature-sensitive sterile line by performing site-directed mutagenesis on RNase ZS1 | |
| EP3978613A1 (en) | Parthenogenetic haploid induction gene dmp and application thereof | |
| US20230265132A1 (en) | Compositions and methods for improving crop yields through trait stacking | |
| EP3777525A1 (en) | Method using plant hybrid vigor | |
| CN111763687B (en) | Method for rapidly cultivating corn haploid induction line based on gene editing technology | |
| CN105518141A (en) | Use of genic male sterility gene and mutation thereof in hybridization | |
| US20210324398A1 (en) | Edited nac genes in plants | |
| Fan et al. | Asymmetric evolution and expansion of the NAC transcription factor in polyploidized cotton | |
| CN106497936B (en) | The albumen and its encoding gene of control rice male fertility and application | |
| Farinati et al. | Current insights and advances into plant male sterility: new precision breeding technology based on genome editing applications | |
| CN104651393B (en) | A method of cultivating rice temp-sensing sterile line using TALEN system rite-directed mutagenesis RNase ZS1 | |
| Huang et al. | CRISPR/Cas systems: the link between functional genes and genetic improvement | |
| WO2009133718A1 (en) | Genome shuffling method and recurrent selection breeding system based on same method in self-fertilizing plant using dominant male sterility constructed by dna manipulation method | |
| CN108795978A (en) | A kind of method and its application for formulating male sterility crop new germ plasm by gene editing | |
| CN103396477B (en) | Protein related to plant potassium ion absorption capacity, and coding gent and application thereof | |
| CN104561087A (en) | OsSDS protein and application of encoding genes of OsSDS protein | |
| CN117069814B (en) | Parthenogenesis haploid induction gene GhDMP and application thereof | |
| Ahmadikhah et al. | Development of a co-dominant CMS-specific ALP marker in Tobacco (Nicotinia tabacum) | |
| CN108265077A (en) | A kind of breeding method for reducing rice grain cadmium content | |
| CN105985980A (en) | Method for obtaining temperature-sensitive sterile line through site-directed mutagenesis of RNase Z<S1> by using ZFN system | |
| CN117285610A (en) | Parthenogenesis haploid induction gene NtDMP and application thereof | |
| Chang et al. | Efficient induction and rapid identification of haploid grains in tetraploid wheat by editing genes TtMTL and pyramiding anthocyanin markers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |