CN104651387A - Yeast expression vector - Google Patents

Abstract

The invention discloses a yeast expression vector. The vector is obtained by double enzyme digestion of the transient expression vector pJITI66-GFP and the vector pYES2 respectively by using HindIII and EcoRI, recovering the target fragments of enzyme digestion, and connecting them with T4 DNA ligase; the vector contains available HindIII, SalI and BamHI restriction restriction multiple cloning sites and NOS terminator; compared with commercially available vectors, it introduces two new restriction restriction sites SalI and HindIII, and the range of restriction restriction restriction sites for gene selection is expanded, which is convenient for gene selection. Functional identification and cloning; at the same time, a NOS terminator is added to facilitate the effective termination of fusion protein translation.

Description

A yeast expression vector

technical field

The invention belongs to the field of biotechnology, in particular to a yeast expression vector.

Background technique

Saccharomyces cerevisiae expression vectors are commonly used in genetic engineering. At present, the commercial vectors are mainly pYES series, pYC series of Invitrogen Company, YEP series, pBT series of ATCC, etc. Among them, pYES2 is widely used as the expression vector of Saccharomyces cerevisiae expression system. It is especially widely used in gene function verification: Wang Liuqiang et al. (2011) constructed the DREB gene of Limonium bicolor into pYES2, and verified the resistance of the gene under drought, high-salt and cold stress, and resistance to other ability of heavy metals; Zhou Kai (2011) constructed the cotton GhGnT gene into pYES2 and found that its overexpression can improve the salt tolerance of yeast; Sun Xinhua et al. Resistance to strong alkalis and active oxygen. However, these commercial vectors are intracellular expression vectors and are not suitable for extracellular secretory expression. Zhao Yingyi et al. (2002) cloned the signal peptide of the inulinase gene from Kluyveromyces cerevisiae into the pYES2 vector, and constructed a secretion expression vector of S. cerevisiae; Hu Yadong et al. (2009) cloned the a-mating factor of S. cerevisiae Into the Saccharomyces cerevisiae intracellular expression vector pYES2/CT, a new type of Saccharomyces cerevisiae episomal secretion expression vector pYES2/CT/a-factor was constructed to realize the external expression of yeast system secreted proteins.

However, when the target gene is constructed on the expression vector pYES2, it is still necessary to confirm whether the target protein is expressed and the expression level by methods such as SDS-PAGE and Western hybridization after induction by adding an inducer, in order to quickly detect whether the target gene is in the For effective expression in yeast cells, Biovector Co., Ltd. introduced the green fluorescent protein gene (EGFP) into the expression vector to construct the pYES2-EGFP expression vector (as shown in Figure 1). The expression level of the target gene can be obtained, but the expression vector has only one restriction site of BamHI , which limits the cloning of the target gene and the transformation of yeast containing the restriction site gene, and cannot be widely used in genetic engineering.

The pJITI66-GFP transient expression vector was transformed by the State Key Laboratory of Crop Genetics and Breeding, Nanjing Agricultural University, and has been reported in many articles (such as "Isolation of Cotton Mesophyll Protoplasts and Establishment of Transient Expression System for Target Genes", Li Nina et al., Crop Science, 2014; "Subcellular localization and expression analysis of grape flower development genes" Yang Guang et al., Chinese Agricultural Sciences, 2011), the GFP gene contained in the vector is an enhanced fluorescent protein gene; A yeast expression vector with a restriction site has not been reported.

Contents of the invention

In view of the above problems, the invention provides a yeast expression vector pYES2-GFP, which introduces HindIII and SalI restriction sites compared with the existing vectors to facilitate the cloning of multiple target genes. The present invention is achieved in this way:

A yeast expression vector, the vector uses HindIII and EcoRI to carry out double enzyme digestion on the transient expression vector pJITI66-GFP and the vector pYES2 respectively, recovers the target fragments HindIII-GFP+NOS-EcoRI and HindIII-pYES2-EcoRI, and then Obtained after ligation with T4 DNA ligase; the yeast expression vector contains restriction sites for HindIII , SalI and BamHI and NOS terminator.

Yeast expression vector pYES2-GFP obtained by the method of the present invention.

The pYES2-GFP yeast expression vector constructed in the present invention adopts the GALI promoter, and the available multiple cloning site endonucleases are respectively HindIII, SalI and BamHI. Compared with the commercially available pYES2-EGFP expression vector, two SalI and HindIII The new enzyme cutting site, the range of enzyme cutting sites for gene selection is expanded, which is convenient for gene function identification and cloning; at the same time, the NOS terminator is added to facilitate the effective termination of fusion protein translation; when the target gene is fused with the GFP gene, it can quickly By detecting the expression of GFP, it can be inferred whether the target protein is expressed or not. The fluorescent signal is strong, and the subcellular localization of the target protein is accurate, eliminating the need for protein detection methods such as SDA-PAGE and Western hybridization. The operation is simple and the result is reliable. For the target gene in Rapid expression detection and cellular localization of target proteins in yeast cells are of great significance.

Description of drawings

Figure 1 is a schematic diagram of the structure of the commercially available pYES2-EGFP expression vector.

Fig. 2 is a schematic diagram of the construction process of the expression vector of the embodiment.

Fig. 3 is a schematic diagram of the structure of the pYES2-GFP expression vector of the embodiment.

Fig. 4 is the electrophoresis diagram of the embodiment HindIII-GFP+NOS-EcoRI.

Fig. 5 is the electrophoresis diagram of the embodiment HindIII-pYES2-EcoRI.

Fig. 6 is the electrophoresis diagram of pYES2-GFP in the embodiment.

Fig. 7 is a schematic diagram of the expression of cell membrane protein TIP5;1 in yeast cells and the results of drought tolerance function.

Fig. 8 is a schematic diagram of the results of subcellular localization analysis of cell membrane protein TIP5;1 in Arabidopsis protoplasts.

Fig. 9 is a schematic diagram of the expression results of cell membrane protein SIP1; 3 in yeast cells.

Fig. 10 is a schematic diagram of the drought tolerance function results of cell membrane protein SIP1;3 expressed in yeast cells.

Fig. 11 is the stress tolerance function identification of endoplasmic reticulum membrane protein SIP1; 3 transgenic tobacco.

Detailed ways

1. Reagents involved in the examples:

HindIII and EcoRI restriction enzymes were purchased from MBI Company (Fermentas), T4 DNA ligase and DNA polymerase (ExTaq, rTaq) were purchased from Takara Company;

Both ampicillin and kanamycin were purchased from Sigma;

The pYES2 vector was purchased from Invitrogen;

The pJITI66-GFP transient expression vector was donated by the State Key Laboratory of Crop Genetics and Breeding of Nanjing Agricultural University;

Both TIP5;1 and SIP1;3 genes were cloned from soybean plants in our laboratory.

2. Embodiment relates to kit and gene sequencing

Saccharomyces cerevisiae INVScI ((Saccharomyces cerevisiae), SD/-ura yeast deficient medium and yeast plasmid extraction kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.;

Escherichia coli ( Escherichia.coli ) plasmid extraction kit was purchased from Axygen;

Both the Agarose Gel DNA Purification and Recovery Kit and the pGEM-T Easy Vector T Cloning Kit were purchased from Promega;

The primers and sequencing used in the examples were synthesized and completed by Nanjing GenScript Co., Ltd.

3. The preparation of medium involved in the embodiment

LB liquid medium: Yeast extract 5 g, tryptone 10 g, NaCl 10 g, add water to 1 L, autoclave (121°C 0.1MPa 20 min) for later use;

LB solid medium: 5 g of yeast extract, 10 g of tryptone, 10 g of NaCl, 20 g of agar powder, add water to 1 L, autoclave (121°C 0.1MPa 20 min) for later use;

YPDA liquid medium: Weigh 50g of YPDA powder, measure 15ml of 0.2% (w/v) Adenine hemisulfate, add distilled water to make up to 1 L, autoclave (121 ℃ 0.1 MPa 20 min) for later use;

YPDA solid medium: Weigh 50g of YPDA powder, measure 15ml of 0.2% (w/v) Adenine hemisulfate, 20g of agar powder, add distilled water to make up to 1 L, autoclave (121 ℃ 0.1 MPa 20 min) for later use ;

SD/-ura liquid medium: Weigh 6.7 g of yeast amino-free nitrogen source, DO Supplement 0.60 g, add 950 ml of water, autoclave (121°C 0.I MPa 20 min), add 50 ml filter-sterilized 40% (w/v) glucose;

SD/-ura solid medium: Weigh 6.7 g of yeast amino-free nitrogen source, DO Supplement 0.60 g, agar powder 20 g, add water 950 ml, autoclave (121°C 0.I MPa 20 min), wait to cool to 55°C Add 50 ml of filter-sterilized 40% (w/v) glucose around the time;

4. The embodiment described relates to solution preparation

  10×TE buffer: 0.1 M Tris-HCl, 10 mM EDTA, pH 7.5, filtered and sterilized for later use. 10×LiAc buffer: 1M LiAc, pH 7.5, filter and sterilize for later use; 1×TE/LiAc buffer: mix 1 ml 10×TE, 1ml 10×LiAc and 8 ml sterile water, and prepare immediately. PEG / LiAc buffer: 1ml 10×TE Buffer, 1 ml 10×LiAc and 8 ml PEG 4000 (50% w/v) are mixed, and this solution is prepared immediately.

Example 1 Construction of pYES2-GFP vector

(1) Use HindIII and EcoRI to cut pJITI66-GFP transient expression vector, the restriction system is:

120ng/uL-150ng/uL pJITI66-GFP transient expression vector 6 μl, 10U uL ^–1 EcoR I endonuclease 1.5 μl, 10U uL ^–1 Hind III endonuclease 1.5 μl, 10× buffer Tango ^TM 3 μl , ddH ₂ O 18 μl.

Reaction conditions for enzyme digestion were as follows: enzyme digestion was carried out according to the manual of Fermentas restriction endonucleases.

The digested products were detected by 1% agarose gel electrophoresis, and the electrophoresis results are shown in Figure 4, where the M lane is the DL2000 molecular weight marker, the lane 1 is the control electrophoresis of the pJITI66-GFP transient expression vector without enzyme digestion, and the lane 2 is the enzyme The cut vector fragment is 980bP in size, which contains the GFP gene and NOS terminator sequence. Purify and recover the fragment according to the instructions of the agarose gel DNA purification and recovery kit, which is purified HindIII-GFP+NOS-EcoRI.

(2) Use HindIII and EcoRI to double-digest the pYES2 vector, and the restriction system is:

120ng/uL-150ng/uLpYES2 vector 6μl, 10U uL ^-1 EcoR I endonuclease 1.5μl, 10U uL ^-1 Hind III endonuclease 1.5 μl, 10× buffer Tango ^TM 3 μl, ddH ₂ O 18 μl;

Enzyme digestion reaction conditions are: carry out enzyme digestion according to the Fermentas restriction endonuclease manual.

The digested products were detected by 1% agarose gel electrophoresis, and the electrophoresis results are shown in Figure 5, where the M lane is the DL2000 molecular weight marker, the lane 1 is the pYES2 carrier control electrophoresis without enzyme digestion, and the lanes 2 and 3 are enzymes The vector fragment after cutting is 5.9kb in size. According to the instructions of the agarose gel DNA purification and recovery kit, the vector fragment after cutting is recovered and purified. This fragment is the purified HindIII-pYES2-EcoRI.

(3) Construct the HindIII-GFP+NOS-EcoRI obtained in step 1 into the HindIII-pYES2-EcoRI obtained in step 2 using T4 DNA ligase. The ligation reaction system is:

Purified HindIII-GFP+NOS-EcoRI and HindIII-pYES2-EcoRI 50ng each, 3U uL ^-1 T4 DNA ligase 1μl, 10×T4 buffer 2.5μl, ddH ₂ O to make up to 25 μl.

The ligation reaction conditions are: Ligating according to the manual of Fermentas company, and at the same time, the final product of the ligation is named pYES2-GFP expression vector, and its structure is shown in Figure 3.

(4) Take the ligation product pYES2-GFP expression vector obtained in step 3 and perform double enzyme digestion with EcoR I and Hind III . The enzyme digestion system is:

120ng/uL-150ng/uL pYES2-GFP expression vector 6 μl, 10U uL ^–1 EcoR I endonuclease 1.5 μl, 10U uL ^–1 Hind III endonuclease 1.5 μl, 10× buffer Tango ^TM 3 μl, ddH ₂ O 18 μl.

The reaction conditions are: digestion according to the Fermentas restriction endonuclease manual.

The digestion product was detected by 1% agarose gel electrophoresis, and the detection results are shown in Figure 6. The M lane in Figure 6 is the DL2000 molecular weight marker, the lane 1 is the pYES2-GFP carrier obtained in step 3, and the lanes 2 and 3 are the The pYES2-GFP fragment after double enzyme digestion is about 5.9kb in size, and the theoretical size of the GFP+NOS fragment is about 980bp. It can be seen that GFP+NOS is indeed connected into the pYES2 vector, which is compatible with the current commercial vector pYES2-EGFP (as shown in Figure 1 Shown) In comparison, four enzyme cutting sites of HindIII , NcoI, SalI, Xba1 and BamH I are added, but because NcoI and Xba1 have another cutting site on the pYES2 vector, compared with the pYES2-EGFP vector, the Two new and effective enzyme cutting sites, SalI and HindIII, were added.

The segment of the pYES2 vector was sequenced, wherein the multiple cloning site (MCS) sequence is shown in SEQ ID NO.1, and the GFP and NOS sequences are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively:

SEQ ID NO.1:

AAGCTTCCACCATGGCGTGCAGGTCGAC TCTAGA GGATCC

HindIII NcoI SalI Xba1 BamH I

SEQ ID NO.2: GFP sequence

atggtgagca agggcgagga gctgttcacc gggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacaagtaa 720

SEQ ID NO.3: NOS terminator sequence

cctcgatcga gttgagagtg aatatgagac tctaattgga taccgagggg aatttatgga 60

acgtcagtgg agcatttttg acaagaaata tttgctagct gatagtgacc ttaggcgact 120

tttgaacgcg caataatggt ttctgacgta tgtgcttagc tcattaaact ccagaaaccc 180

gcggctcagt ggctccttca acgttgcggt tctgtcagtt ccaaacgtaa aacggcttgt 240

cccgcgtcat cggcgggggt cataacgtga ctcccttaat tctccgctca tgatc 295

Sequencing results showed that two new effective restriction sites ( SalI and HindIII ) were successfully introduced into the pYES2-GFP vector.

In this embodiment, the pYES2-GFP vector construction process is shown in Figure 2.

Example 2 Detection of pYES2-GFP vector expression

SEQ ID NO.4: AT A A G C T T T T T C G A A ATGggtggcattgcat;

SEQ ID NO.5: cg CGGATCCG AAATTCACTGGAAAGA

Verify the effectiveness of the pYES2-GFP vector obtained in Example 1 with a cell membrane protein TIP cloned in our laboratory:

(1) First construct the upstream primer TIP-F (its sequence is shown in SEQ ID NO.4) and the downstream primer TIP-R (its sequence is shown in SEQ ID NO.5). Company Synthesis.

(2) Use Hind III and BamH I to double digest the pYES2-GFP expression vector. The enzyme digestion reaction system is: 120ng/uL-150ng/uL pYES2-GFP expression vector 6 μl, 10U uL ^-1 EcoR I endonuclease 1.5 μl, 10U uL ^–1 Hind III endonuclease 1.5 μl, 10× buffer Tango ^TM 3 μl, ddH ₂ O 18 μl.

The reaction conditions are: digestion according to the Fermentas restriction endonuclease manual.

The digested product was subjected to 1% agarose gel electrophoresis and then gel-cut and purified to recover the PYES2 fragment. The specific operation was performed according to the instructions of the agarose gel DNA purification and recovery kit to obtain the purified PYES2 fragment.

(3) The TIP5;I gene was cloned using forward and reverse primers with Hind III and BamH I restriction sites respectively. The specific steps were as follows: Use the forward primer TIP-F from soybean seedling root tissue mRNA by RT-PCR and reverse primer TIP-R to amplify the full-length open reading frame (ORF).

The amplification system is: cDNA 1μL (100ng/uL), 10×PCR buffer 2.5 μL, I0 mmol L ^–1 dNTPs 0.5 μL, 25 mmol L ^–1 MgCl ₂ 1.5 μL, 10 mmolL ^–1 upstream and downstream primers 1 μL each, 5 U mL ^–1 Taq DNA polymerase 0.2 μL, make up to 25 μL with ddH ₂ O.

The reaction program was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 45 s, refolding at 55°C for 45 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min.

The PCR reaction product was subjected to 1% agarose gel electrophoresis and then gel-cut and purified to recover the TIP5;1 gene fragment. The specific operation was carried out according to the instructions of the agarose gel DNA purification and recovery kit to obtain the purified TIP5;1 gene fragment. The fragment was ligated into the pGEM-T Easy Vector T cloning kit vector, sent to Nanjing Gensirui Biotechnology Co., Ltd. for sequencing, repeated 3 times, and verified as a TIP5;1 gene fragment.

(4) Construct the TIP5;1 gene into the PYES2 fragment obtained in step 2. The ligation reaction system is: 50ng each of the purified TIP5;1 gene fragment and the purified PYES2 fragment, 3U uL ^-1 T4 DNA ligase 1μl, 10 ×T4 buffer 2.5 μl, make up to 25 μl with ddH ₂ O.

Reactions were ligated according to the Fermentas company manual.

Transformed into Saccharomyces cerevisiae INVSc I ( Saccharomy cescerevisiae ) by a lithium acetate-mediated method (for the method, refer to "cloning and expression analysis of soybean GmTIP1; 1 gene", Zhang Dayong et al., Acta Crops Sinica, 2013), and the empty vector was used as a control , and named the recombinant yeasts as INVScI (pYES2- TIP5;I ) and INVScI(pYES2); in order to verify whether the non-transgenic yeast and the transgenic yeast had the same growth potential under normal growth conditions, at 30°C, et al. The number of moles of INVScI (pYES2- TIP5;1 ), INVScI (pYES2) and INVScI was undiluted or diluted 100, 1000 and 10 000 times respectively, pipetted 2 μL and inoculated on YPDA solid medium, and observed three species after overnight culture Yeast growth potential; Yeast stress treatment experiments refer to the method of Pan Yan et al. ("Cloning of LbGRP gene of Limonium bicolor and analysis of stress resistance ability", Genetics, 2010), with mass fractions of 30% PEG6000 and 5 mol L ^–1 The NaCl solution was treated for 40 h, and the water treatment was used as the control. The experiment was repeated three times. The experimental results were scanned by UNISCANCI880 flatbed scanner. The yeast clones were observed by fluorescence microscope and the stress tolerance function of the gene was identified. The results are shown in Figure 7. It was found that it is localized in the cell membrane (subcellular localization of Arabidopsis protoplasts in Figure 8 is the auxiliary experimental evidence), and it can improve the drought tolerance of yeast. Figure 7a shows the expression of cell membrane protein TIP5;1 in Saccharomyces cerevisiae cells, where The protein is located in the yeast cell membrane. Figure 7b is the drought tolerance function identification of yeast. It can be seen that the transgenic yeast has improved tolerance to drought, which is consistent with the results of transgenic Arabidopsis; Figure 8 shows that the cell membrane protein TIP5;1 in Arabidopsis Analysis of subcellular localization in protoplasts, Figure 8 (A) is the subcellular localization of pJITI66-GFP-TIP5;1 in Arabidopsis protoplasts, which is located in the cell membrane, Figure 8 (B) is the pJITI66-GFP empty vector control , green fluorescence distributed throughout the cell. The test results also found that it is located in the cell membrane, which is consistent with the location of the yeast cell (for the specific process, refer to Liu Xiaoqing et al., 2013, plant biotechnology reports).

Example 3 Verification of endoplasmic reticulum membrane protein SIP1

SEQ ID NO.6: AT A A G C T T T T C G A A ATGGTTGGTGCTATAAAAGCAGCGA;

SEQ ID NO. 7: GC CGGATCCG TCATGCTTTCTTCTGTTTTACTTC;

Taking another endoplasmic reticulum membrane protein SIP1;3 cloned in our laboratory as an example, the forward primer SEQ ID NO.6 and the reverse primer SEQ ID NO.7 were designed according to the sequence of the SIP1;3 gene. There are Hind III and BamHI restriction sites, and then constructed into the digested pYES2-GFP vector, and then transformed into Saccharomyces cerevisiae through the method mediated by lithium acetate. The methods of gene cloning, yeast transformation and functional identification are the same as the examples 2.

The tobacco genetic transformation method mainly refers to the Agrobacterium transformation method of Horsch et al:

1) Preparation of Agrobacterium liquid: inoculate the constructed Agrobacterium carrying the p53 plant expression vector into YEB liquid culture medium (containing 100 μg/ml Kan and 50 μg/ml Rif), and culture it on a shaking table at 28°C until OD600 0.6-0.8, suspend the bacteria with MS salt solution;

2) Aseptic treatment of tobacco leaves: take the young tobacco leaves grown in the greenhouse, wash the surface impurities under running water, rinse with distilled water in the ultra-clean workbench, soak in 70% ethanol for 30 seconds, and treat with 2.5% sodium hypochlorite for 10 minutes; aseptic Rinse with water 3 times and set aside;

3) cut off tobacco leaf edge and main vein with scalpel, then blade is cut into 0.5cm Size;

4) soak the cut blade in the Agrobacterium bacterium liquid for 10-15min;

5) Rinse the soaked tobacco leaves with sterile water for 3-4 times, blot the bacterial solution on the surface of the leaves with sterile filter paper, inoculate them in MS medium and incubate in dark at 25°C for 72 hours;

6) Re-inoculate the co-cultured leaves into the antibiotic-containing differentiation medium (MS+2.0mg/L 6-BA+0.5mg/L NAA+50mg/L Kan+500 mg/L cef) for culture;

7) When the resistant bud cluster grows to 2-3cm, cut off the small buds and transfer them to the rooting medium (MS+50mg/L Kan+500 mg/L cef) to induce rooting;

8) The roots to be induced can be transplanted to obtain regenerated plants when they reach about 2 cm.

The yeast clone was observed by fluorescence microscopy and the stress tolerance function of the gene was identified. The results are shown in Figure 9-11. It was found that it was located in the endoplasmic reticulum and could reduce the salt tolerance of the yeast.

Figure 9 is a schematic diagram of the fluorescence microscope observation results of the endoplasmic reticulum membrane protein SIP1; 3 expressed in yeast cells, wherein SIP-FGP is the fusion of the pYES2-GFP vector of the present invention ; the endoplasmic reticulum location of the 3 gene in yeast cells, GFP It is the pYES2-GFP empty vector control of the present invention, which is distributed in the whole yeast cell.

Figure 10 is a schematic diagram of yeast stress tolerance function identification results, it can be seen that heterologous yeast expression of SIP1; 3 gene reduces the salt tolerance of yeast; Figure 11 is the stress tolerance function identification of endoplasmic reticulum membrane protein SIP1; 3 transgenic tobacco, in the figure WT refers to wild-type tobacco, and OE1-3 refers to three different transgenic lines transgenic for the SIP1;3 gene. It was found that overexpressing the gene reduced the salt tolerance of tobacco, which was consistent with the results of the functional verification of the yeast system.

SEQUENCE LISTING

the

<110> Jiangsu Academy of Agricultural Sciences

the

<120> A yeast expression vector

the

<130> 7

the

<160> 7

the

<170> PatentIn version 3.3

the

<210> 1

<211> 40

<212> DNA

<213> Synthetic

the

<400> 1

aagcttccac catggcgtgc aggtcgactc tagaggatcc 40

the

the

<210> 2

<211> 720

<212> DNA

<213> Synthetic

the

<400> 2

atggtgagca agggcgagga gctgttcacc gggtggtgc ccatcctggt cgagctggac 60

the

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

the

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

the

ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

the

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

the

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

the

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

the

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

the

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

the

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

the

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

the

ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacaagtaa 720

the

the

<210> 3

<211> 295

<212> DNA

<213> Synthetic

the

<400> 3

cctcgatcga gttgagagtg aatatgagac tctaattgga taccgagggg aatttatgga 60

the

acgtcagtgg agcatttttg acaagaaata tttgctagct gatagtgacc ttaggcgact 120

the

tttgaacgcg caataatggt ttctgacgta tgtgcttagc tcattaaact ccagaaaccc 180

the

gcggctcagt ggctccttca acgttgcggt tctgtcagtt ccaaacgtaa aacggcttgt 240

the

cccgcgtcat cggcgggggt cataacgtga ctcccttaat tctccgctca tgatc 295

the

the

<210> 4

<211> 30

<212> DNA

<213> Synthetic

the

<400> 4

ataagctttt cgaaatgggt ggcattgcat 30

the

the

<210> 5

<211> 26

<212> DNA

<213> Synthetic

the

<400> 5

cgcggatccg aaattcactg gaaaga 26

the

the

<210> 6

<211> 39

<212> DNA

<213> Synthetic

the

<400> 6

ataagctttt cgaaatggtt ggtgctataa aagcagcga 39

the

the

<210> 7

<211> 34

<212> DNA

<213> Synthetic

the

<400> 7

gccggatccg tcatgctttc ttctgtttta cttc 34

the

the

Claims (2)

1. A yeast expression vector, characterized in that, the carrier utilizes HindIII and EcoRI to carry out double enzyme digestion on the transient expression vector pJITI66-GFP and the carrier pYES2 respectively, reclaims the fragment of the restriction enzyme, and obtains after connecting with T4DNA ligase; The yeast expression vector contains a HindIII , SalI and BamHI enzyme-cut multiple cloning site and a NOS terminator. 2. The yeast expression vector pYES2-GFP obtained by the method of claim 1.