CN104651387A - Yeast expression vector - Google Patents

Abstract

The invention discloses a yeast expression vector. The yeast expression vector is prepared by the following steps: carrying out double digestion on pJITI66-GFP, serving as a transient expression vector, and pYES2, serving as a vector, by utilizing HindIII and EcoRI respectively, recovering enzyme digest target fragments, and connecting the enzyme digest target fragments by virtue of T4DNA ligase to obtain the yeast expression vector. The yeast expression vector contains enzyme digest multiple cloning sites of HindIII, SalI and BamHI and an NOS terminator. Compared with the sold vector, according to the yeast expression vector disclosed by the invention, SalI and HindIII, serving as two new enzyme digest sites, are introduced, so that the enzyme digest site range selected by a gene is expanded, and function identification and cloning of the gene are convenient; meanwhile, with the addition of the NOS terminator, fusion protein translation is convenient to be effectively ended up.

Description

A kind of Yeast expression carrier

Technical field

The invention belongs to biological technical field, particularly a kind of Yeast expression carrier.

Background technology

Saccharomyces cerevisiae expression is carrier conventional in genetically engineered, the current commercial vectors mainly pYES series of Invitrogen company, the YEP series of the serial and ATCC of pYC, pBT is serial etc., wherein, pYES2 is comparatively extensive as the expression vector application of Saccharomyces Serevisiae Expression System, especially had a wide range of applications in gene function checking: Wang Liuqiang etc. (2011) are by being building up in pYES2 the dreb gene of Herba Limoii Bicoloris, demonstrate this gene at arid, high salt and damage to plants caused by sudden drop in temperature the resistance coercing under, and resist the ability of other heavy metals; Zhou Kai (2011) on pYES2, finds that its process LAN can improve yeast salt tolerance gene constructed for cotton GhGnT; Sun Xinhua etc. (2012) then demonstrate the resistance of four wing shore multitude AcERF gene pairs high temperature, highly basic and active oxygen with pYES2 carrier.But these commercial vectors are cell inner expression carrier, are unsuitable for cell exocrine and express.The inulinase gene deriving from kluyveromyces is that signal peptide is cloned on pYES2 carrier by Zhao Yingyi etc. (2002), constructs a kind of yeast saccharomyces cerevisiae secretion expression carrier; The a-mating factor of yeast saccharomyces cerevisiae is cloned in yeast saccharomyces cerevisiae intracellular expression carrier pYES2/CT by Hu Yadong etc. (2009), construct a kind of novel yeast saccharomyces cerevisiae additive type secretion expression carrier pYES2/CT/a-factor, achieve the outer expression of Yeast system secretory protein.

But, when goal gene is building up on expression vector pYES2, although after the induction of interpolation inductor, still need to confirm whether target protein expresses and expression amount by modes such as such as SDS-PAGE and Western hybridization, in order to rapid detection goal gene whether effective expression in yeast cell, green fluorescence protein gene (EGFP) is introduced in expression vector by Biovector company limited, build pYES2-EGFP expression vector (as shown in Figure 1), goal gene and green fluorescence protein gene are expressed simultaneously, destination gene expression amount can be obtained by fluoroscopic examination, but this expression vector only has bamHIa restriction enzyme site can be used, and like this to the clone of goal gene and transform containing this restriction enzyme site gene yeast and cause restriction, can not be widely used in genetically engineered.

PJITI66-GFP transient expression vector is transformed by Agricultural University Of Nanjing's crop genetic and breeding National Key Laboratory to form, report (as " foundation of cotton mesophyll protoplast electrofusion and target gene Transient Expression System " Li Nina etc. in many sections of articles, Acta Agronomica Sinica, 2014; " Subcellular Localization of grape flower development gene and expression analysis " Yang Guang etc., Scientia Agricultura Sinica, 2011), GFP gene contained by carrier is enhancement type fluorescence protein gene; At present, containing this protein gene and the Yeast expression carrier with multiple restriction enzyme site has no report.

Summary of the invention

For the problems referred to above, invention provides a kind of Yeast expression carrier pYES2-GFP, more existing carrier, and introduce HindIII and SalI restriction enzyme site, be convenient to the clone of multiple goal gene, the present invention is achieved in that

A kind of Yeast expression carrier, this carrier utilizes hindIIIwith ecoRIrespectively double digestion is carried out to transient expression vector pJITI66-GFP and carrier pYES2, reclaims enzyme and cut in object fragment HindIII-GFP+NOS-EcoRI and HindIII-pYES2-EcoRI, then obtain after connecting with T4DNA ligase enzyme; Described Yeast expression carrier comprises hindIII, salIwith bamHIrestriction enzyme site and NOS terminator.

The Yeast expression carrier pYES2-GFP obtained by the inventive method.

PYES2-GFP Yeast expression carrier constructed by the present invention adopts GALI promotor, available multiple clone site restriction endonuclease is respectively HindIII, SalI and BamHI, compare commercially available pYES2-EGFP expression vector, introduce the restriction enzyme site that SalI and HindIII two is new, the restriction enzyme site range extension of gene Selection, is convenient to Function Identification and the clone of gene; With the addition of NOS terminator simultaneously, be convenient to effective termination of fusion rotein translation; When target gene and GFP gene fusion, the expression of rapid detection GFP, namely whether deducibility target protein expresses, fluorescent signal is strong, target protein Subcellular Localization is accurate, eliminates the Protein Detection means such as such as SDA-PAGE and Western hybridization, simple to operate, reliable results, the cellular localization for the quick detection of expression of target gene in yeast cell and target protein has great importance.

Accompanying drawing explanation

Fig. 1 is commercially available pYES2-EGFP expression vector structural representation.

Fig. 2 is embodiment expression vector establishment schematic flow sheet.

Fig. 3 is embodiment pYES2-GFP expression vector structural representation.

Fig. 4 is embodiment HindIII-GFP+NOS-EcoRI electrophorogram.

Fig. 5 is embodiment HindIII-pYES2-EcoRI electrophorogram.

Fig. 6 is embodiment pYES2-GFP electrophorogram.

Fig. 7 is epicyte protein TIP5; 1 expression in yeast cell and drought-enduring function result schematic diagram.

Fig. 8 is epicyte protein TIP5; 1 Subcellular Localization result schematic diagram in protoplasts of Arabidopsis thaliana broken by ultrasonic.

Fig. 9 is epicyte protein Protein S IP1; 3 expression of results schematic diagram in yeast cell.

Figure 10 is epicyte protein Protein S IP1; The 3 drought-enduring function result schematic diagrams expressed in yeast cell.

Figure 11 is reticulon sIP1; 3the resistance to reverse function qualification of transgene tobacco.

Embodiment

1. involved reagent in embodiment:

HindIII, EcoRI restriction enzyme purchased from MBI company (Fermentas), T4 DNA ligase, archaeal dna polymerase (ExTaq, rTaq) purchased from Takara company;

Penbritin and the equal available from Sigma of kantlex;

PYES2 carrier is purchased from Invitrogen company;

PJITI66-GFP transient expression vector is so kind as to give by Agricultural University Of Nanjing's crop genetic and breeding National Key Laboratory;

tIP5; 1with sIP1; 3gene by this laboratory clone from soybean plant strain.

2. embodiment relates to test kit and gene sequencing

((Saccharomyces cerevisiae), SD/-ura yeast defective type substratum and yeast plasmid extract test kit purchased from TIANGEN Biotech (Beijing) Co., Ltd. to yeast saccharomyces cerevisiae INVScI;

Intestinal bacteria ( escherichia.coli) plasmid extraction kit is purchased from Axygen company;

Sepharose DNA purifying recovery test kit and pGEM-T Easy Vector T Cloning Kit are all purchased from Promega company;

In embodiment, the primer and order-checking are synthesized by Nanjing Jin Sirui company limited and complete.

3. the preparation of substratum involved by embodiment

LB liquid nutrient medium: yeast extract 5 g, Tryptones 10 g, NaCl 10 g, adds water to 1L, and autoclaving (121 DEG C of 0.1MPa 20 min) is for subsequent use afterwards;

LB solid medium: yeast extract 5 g, Tryptones 10 g, NaCl 10 g, agar powder 20 g, adds water to 1L, and autoclaving (121 DEG C of 0.1MPa 20 min) is for subsequent use afterwards;

YPDA liquid nutrient medium: take YPDA powder 50g, measure 0.2%(w/v) Adenine hemisulfate 15ml, adding distil water is settled to 1 L, and autoclaving (121 DEG C of 0.1 MPa 20 min) is for subsequent use afterwards;

YPDA solid medium: take YPDA powder 50g, measure 0.2%(w/v) Adenine hemisulfate 15ml, agar powder 20 g, adding distil water is settled to 1 L, and autoclaving (121 DEG C of 0.1 MPa 20 min) is for subsequent use afterwards;

SD/-ura liquid nutrient medium: take yeast without amino nitrogen source 6.7 g, DO Supplement 0.60g, add water 950 ml, autoclaving (121 DEG C of 0.I MPa 20 min), the glucose of 40% (w/v) to adding 50 ml filtration sterilizations when about 55 DEG C to be cooled;

SD/-ura solid medium: take yeast without amino nitrogen source 6.7 g, DO Supplement 0.60g, agar powder 20g, add water 950 ml, autoclaving (121 DEG C of 0.I MPa 20 min), the glucose of 40% (w/v) to adding 50 ml filtration sterilizations when about 55 DEG C to be cooled;

4. relate to solution preparation described in embodiment

10 × TE buffer:0.1 M Tris-HCI, 10 mM EDTA, pH 7.5, for subsequent use after filtration sterilization.10 × LiAc buffer:1M LiAc, pH 7.5, for subsequent use after filtration sterilization; 1 × TE/LiAc buffer:1 ml, 10 × TE, 1ml 10 × LiAc mix with 8 ml sterilized waters, matching while using.PEG/LiAc buffer:1ml 10 × TE Buffer, 1 ml 10 × LiAc and 8 ml PEG 4000(50% w/v) mix, this solution matching while using.

The structure of embodiment 1 pYES2-GFP carrier

(1) utilize hindIIIwith ecoRIdouble digestion pJITI66-GFP transient expression vector, the enzyme system of cutting is:

The pJITI66-GFP transient expression vector 6 μ l of 120ng/uL-150ng/uL, 10U uL ^{– 1}ecoR I restriction endonuclease 1.5 μ l, 10U uL ^{– 1}hind III restriction endonuclease 1.5 μ l, 10 × buffer Tango ^tM3 μ l, ddH ₂o 18 μ l.

Endonuclease reaction condition is: carry out enzyme according to Fermentas restriction enzyme handbook and cut.

Enter 1% agarose gel electrophoresis to digestion products to detect, electrophoresis result as shown in Figure 4, wherein M swimming lane is DL2000 molecular weight Marker, the pJITI66-GFP transient expression vector contrast electrophoresis of swimming lane 1 for not having enzyme to cut, swimming lane 2 for enzyme cut after carrier segments, size is 980bP, and this fragment comprises GFP gene and NOS terminator sequence, reclaim test kit specification sheets according to sepharose DNA purifying and require that purifying reclaims this fragment, be the HindIII-GFP+NOS-EcoRI of purifying.

(2) utilize hindIIIwith ecoRIdouble digestion pYES2 carrier, the enzyme system of cutting is:

120ng/uL-150ng/uLpYES2 carrier 6 μ l, 10U uL ^{– 1}ecoR I restriction endonuclease 1.5 μ l, 10U uL ^{– 1}hind III restriction endonuclease 1.5 μ l, 10 × buffer Tango ^tM3 μ l, ddH ₂o 18 μ l;

Endonuclease reaction condition is: carry out enzyme according to Fermentas restriction enzyme handbook and cut.

1% agarose gel electrophoresis detection is carried out to digestion products, electrophoresis result as shown in Figure 5, wherein M swimming lane is DL2000 molecular weight Marker, swimming lane 1 is do not carry out the pYES2 vehicle Control electrophoresis that enzyme cuts, swimming lane 2,3 is enzyme and cuts rear carrier segments, size is 5.9kb, and the carrier segments after being cut open according to sepharose DNA purifying recovery test kit specification sheets recovery purifying, this fragment is the HindIII-pYES2-EcoRI of purifying.

(3) utilize T4DNA ligase enzyme that the HindIII-GFP+NOS-EcoRI that step 1 obtains is building up in the HindIII-pYES2-EcoRI that step 2 obtains, ligation system is:

Each 50ng, the 3U uL of HindIII-GFP+NOS-EcoRI and HindIII-pYES2-EcoRI of purifying ^{– 1}t4DNA ligase enzyme 1 μ l, 10 × T4 buffer 2.5 μ l, ddH ₂o complements to 25 μ l.

Ligation condition is: connect according to Fermentas company manual, and will connect end product from called after pYES2-GFP expression vector, its structure as shown in Figure 3 simultaneously.

(4) get step 3 obtain connection product pYES2-GFP expression vector with ecoR Iwith hind IIIcarry out double digestion, the enzyme system of cutting is:

The pYES2-GFP expression vector 6 μ l of 120ng/uL-150ng/uL, 10U uL ^{– 1}ecoR I restriction endonuclease 1.5 μ l, 10U uL ^{– 1}hind III restriction endonuclease 1.5 μ l, 10 × buffer Tango ^tM3 μ l, ddH ₂o 18 μ l.

Reaction conditions is: carry out enzyme according to Fermentas restriction enzyme handbook and cut.

Get digestion products 1% agarose gel electrophoresis to detect, detected result as shown in Figure 6, in Fig. 6, M swimming lane is DL2000 molecular weight Marker, swimming lane 1 is the pYES2-GFP carrier that step 3 obtains, and swimming lane 2,3 is the pYES2-GFP fragment after double digestion, and this clip size is about 5.9kb, it is visible that the theoretical size of GFP+NOS fragment is about 980bp, GFP+NOS connects in pYES2 carrier really, with current commercial vectors pYES2-EGFP(as shown in Figure 1) comparatively speaking, add hindIII, ncoI, SalI, Xba1with bamH Ifour restriction enzyme sites, but due to ncoIwith xba1pYES2 carrier also has another one point of contact, and pYES2-EGFP carrier of therefore comparing adds salIwith hindIIItwo new, effective restriction enzyme sites.

Check order to the section of pYES2 carrier, wherein multiple clone site (MCS) sequence is as shown in SEQ ID NO.1, GFP and NOS sequence is respectively as shown in SEQ ID NO.2 and SEQ ID NO.3:

SEQ ID NO.1：

AAGCTTCCACCATGGCGTGCAGGTCGAC TCTAGAGGATCC

HindIII NcoI SalI Xba1 BamH I

SEQ ID NO.2:GFP sequence

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacaagtaa 720

SEQ ID NO.3:NOS terminator sequence

cctcgatcga gttgagagtg aatatgagac tctaattgga taccgagggg aatttatgga 60

acgtcagtgg agcatttttg acaagaaata tttgctagct gatagtgacc ttaggcgact 120

tttgaacgcg caataatggt ttctgacgta tgtgcttagc tcattaaact ccagaaaccc 180

gcggctcagt ggctccttca acgttgcggt tctgtcagtt ccaaacgtaa aacggcttgt 240

cccgcgtcat cggcgggggt cataacgtga ctcccttaat tctccgctca tgatc 295

Sequencing result show two new effective restriction enzyme sites ( salIwith hindIII) successfully introduce in pYES2-GFP carrier.

The present embodiment pYES2-GFP vector construction flow process as shown in Figure 2.

Embodiment 2 pYES2-GFP vector expression detects

SEQ ID NO.4:AT A A G C T T T T C G A A ATGggtggcattgcat;

SEQ ID NO.5:cg CGGATCCG AAATTCACTGGAAAGA

The validity of this carrier of pYES2-GFP that embodiment 1 obtains is verified with this laboratory clone epicyte protein TIP:

(1) first build its sequence of upstream primer TIP-F(as shown in SEQ ID NO.4) and its sequence of downstream primer TIP-R(as shown in SEQ ID NO.5), primer transfers to Jin Sirui biological company limited in Nanjing to synthesize.

(2) utilize hind IIIwith bamH Idouble digestion pYES2-GFP expression vector, endonuclease reaction system is: the pYES2-GFP expression vector 6 μ l of 120ng/uL-150ng/uL, 10U uL ^{– 1}ecoR I restriction endonuclease 1.5 μ l, 10U uL ^{– 1}hind III restriction endonuclease 1.5 μ l, 10 × buffer Tango ^tM3 μ l, ddH ₂o 18 μ l.

Reaction conditions is: carry out enzyme according to Fermentas restriction enzyme handbook and cut.

Digestion products is cut after 1% agarose gel electrophoresis glue purification and reclaim PYES2 fragment, concrete operations are reclaimed test kit operation instruction according to sepharose DNA purifying and are carried out, and obtain the PYES2 fragment of purifying.

(3) utilize respectively with hind IIIwith bamH Iforward and reverse primer clone TIP5 of restriction enzyme site; I gene, concrete steps are: utilize RT-PCR method from soybean seedling root tissue mRNA with forward primer TIP-F and reverse primer TIP-R amplification total length open reading frame (ORF).

Amplification system is: cDNA1 μ L(100ng/uL), 10 × PCR buffer 2.5 μ L, I0 mmol L ^{– 1}dNTPs 0.5 μ L, 25 mmol L ^{– 1}mgCl ₂1.5 μ L, 10 mmolL ^{– 1}the each 1 μ L of upstream and downstream primer, 5 U mL ^{– 1}taq DNA polysaccharase 0.2 μ L, ddH ₂o complements to 25 μ L.

Response procedures is: 94 DEG C of denaturation 3 min; 94 DEG C of sex change 45 s, 55 DEG C of renaturation 45 s, 72 DEG C extend 1 min, 35 circulations; 72 DEG C extend 10 min.

PCR reaction product is cut after 1% agarose gel electrophoresis glue purification and reclaim TIP5; I gene fragment, concrete operations are reclaimed test kit operation instruction according to sepharose DNA purifying and are carried out, and obtain the TIP5 of purifying; I gene fragment, is connected into this fragment in pGEM-T Easy Vector T Cloning Kit carrier, delivers the order-checking of Jin Sirui bio tech ltd, Nanjing, repeats 3 times, be verified as TIP5; 1 gene fragment.

(4) will tIP 5; 1gene constructed in the PYES2 fragment of step 2 acquisition, ligation system is: the TIP5 of purifying; Each 50ng, the 3U uL of PYES2 fragment of 1 gene fragment and purifying ^{– 1}t4DNA ligase enzyme 1 μ l, 10 × T4 buffer 2.5 μ l, ddH ₂o complements to 25 μ l.

Reaction connects according to Fermentas company manual.

The method mediated by Lithium Acetate be transformed into yeast saccharomyces cerevisiae INVSc I ( saccharomy cescerevisiae) in (method is with reference to " soybean GmTIP1; The cloning and expression analysis of 1 gene ", magnify brave etc., Acta Agronomica Sinica, 2013), to proceed to empty carrier for contrast, by recombination yeast called after INVScI (pYES2-respectively tIP5; I) and INVScI (pYES2); In order to verify whether non-transgenic yeast has identical growth potential with Pignus pignoris grain yeast under normal growing conditions, under 30 DEG C of conditions, the INVScI (pYES2-of mole number will be waited tIP5; 1), INVScI (pYES2) and INVScI, after not diluting and diluting 100,1000 and 10 000 times respectively, draw 2 μ L and be seeded on YPDA solid medium, after incubated overnight, observe the growth potential of 3 primary yeasts; The experiment of yeast Stress treatment, with reference to (" clone of Herba Limoii Bicoloris LbGRP gene and anti-adversity ability analysis ", heredity, 2010) methods such as Pan Yan, is respectively quality volume fraction 30% PEG6000 and 5 mol L ^{– 1}naCl solution-treated 40 h; take water treatment as contrast; experiment repetition 3 times; experimental result scans through UNISCANCI880 flat bed scanner; yeast clone is carried out to the qualification of fluorescence microscope and the resistance to reverse function of this gene, its result as shown in Figure 7, finds that it is positioned cytolemma position (with Fig. 8 protoplasts of Arabidopsis thaliana broken by ultrasonic Subcellular Localization for assistant experiment evidence); and the drought tolerance of yeast can be improved, Fig. 7 a represents epicyte protein TIP5; 1 expression in brewing yeast cell, wherein this albumen is positioned at yeast cell membranous part position, and Fig. 7 b is the drought-enduring Function Identification of yeast, and visible transgenic yeast performance improves patience to arid, and this is consistent with the result of transgenic arabidopsis; Fig. 8 is for showing epicyte protein TIP5; 1 Subcellular Localization in protoplasts of Arabidopsis thaliana broken by ultrasonic, Fig. 8 (A) is pJITI66-GFP-TIP5; 1 in the Subcellular Localization of protoplasts of Arabidopsis thaliana broken by ultrasonic, and it is positioned cytolemma, and Fig. 8 (B) is pJITI66-GFP empty vector control, and green fluorescence is distributed in whole cell.Detected result also finds that it is positioned at cytolemma position, and this and the location of yeast cell are consistent (detailed process are with reference to Liu Xiaoqing etc., 2013, plant biotechnology reports).

Embodiment 3 reticulon SIP1 verifies

SEQ ID NO.6：AT A A G C T T T T C G A A ATGGTTGGTGCTATAAAAGCAGCGA；

SEQ ID NO.7：GC CGGATCCG TCATGCTTTCTTCTGTTTTACTTC；

With another reticulon SIP1 of this laboratory clone; 3 is example, according to sIP1; 3the sequences Design forward primer SEQ ID NO.6 of gene and reverse primer SEQ ID NO.7, two primers respectively with hind IIIwith bamHIrestriction enzyme site, utilize then be building up to enzyme cut after pYES2-GFP carrier in, then be transformed in yeast saccharomyces cerevisiae by the method that Lithium Acetate mediates, gene clone and yeast conversion and Function Identification method are with embodiment 2.

The main Agrobacterium-mediated Transformation method with reference to Horsch et al of tobacco genetic transforming method:

1) preparation of Agrobacterium bacterium liquid; By carry build carry p53 plant expression vector Agrobacterium inoculation in YEB liquid medium (containing 100 μ g/ml Kan and 50 μ g/ml Rif), be 0.6-0.8 in 28 DEG C of shaking table shaking culture to OD600, with MS salts solution, thalline suspended;

2) aseptically process of tobacco leaf: the tobacco young leaflet tablet getting greenhouse-grown, rinses surface impurity under flowing water, soaks 30s, 2.5% clorox process 10min in Bechtop with after distilled water flushing one time in 70% ethanol; For subsequent use after aseptic water washing 3 times;

3) cut tobacco leaf edge and master pulse with knife blade, then blade is cut into 0.5cm2 size;

4) blade cut is soaked in I0-I5min in Agrobacterium bacterium liquid;

5) the tobacco leaf 3-4 time that soaked of aseptic water washing, blade surface bacterium liquid blots by aseptic filter paper, is inoculated in MS substratum in 25 DEG C of light culture 72h;

6) the blade renewed vaccination after Dual culture is cultivated to containing in antibiotic division culture medium (MS+2.0mg/L 6-BA+0.5mg/L NAA+50mg/L Kan+500 mg/L cef);

7) until resistant buds cluster grow to 2-3cm time, cut budlet and proceed to root induction in root media (MS+50mg/L Kan+500 mg/L cef);

8) root to be induced reaches about 2cm and can transplant, and obtains regeneration plant.

Yeast clone is carried out to the qualification of fluorescence microscope and the resistance to reverse function of this gene, result as shown in figs. 9-11, finds that it is positioned endoplasmic reticulum position, and can reduce the salt tolerance of yeast.

Fig. 9 is reticulon sIP1; 3the fluorescence microscope result schematic diagram expressed in yeast cell, wherein SIP-FGP is that pYES2-GFP carrier of the present invention merges sIP1; 3the endoplasmic reticulum location of gene in yeast cell, GFP is pYES2-GFP empty vector control of the present invention, and it is distributed in whole yeast cell.

Figure 10 is the yeast qualification result of resistance to reverse function schematic diagram, visible sIP1; 3the allos yeast expression of gene reduces the salt tolerance of yeast; Figure 11 is reticulon sIP1; 3the resistance to reverse function qualification of transgene tobacco, in figure, WT is wild-type tobacco, and OE1-3 is for turning sIP1; 33 different transgenic lines of gene, find that this gene of process LAN is, the salt tolerance of tobacco reduces, and this is consistent with the result of Yeast system functional verification.

SEQUENCE LISTING

 

<110> Jiangsu Province Agriculture Science Institute

 

<120> Yeast expression carrier

 

<130> 7

 

<160> 7

 

<170> PatentIn version 3.3

 

<210> 1

<211> 40

<212> DNA

<213> synthetic

 

<400> 1

aagcttccac catggcgtgc aggtcgactc tagaggatcc 40

 

 

<210> 2

<211> 720

<212> DNA

<213> synthetic

 

<400> 2

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

 

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

 

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

 

ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

 

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

 

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

 

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

 

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

 

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

 

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

 

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

 

ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacaagtaa 720

 

 

<210> 3

<211> 295

<212> DNA

<213> synthetic

 

<400> 3

cctcgatcga gttgagagtg aatatgagac tctaattgga taccgagggg aatttatgga 60

 

acgtcagtgg agcatttttg acaagaaata tttgctagct gatagtgacc ttaggcgact 120

 

tttgaacgcg caataatggt ttctgacgta tgtgcttagc tcattaaact ccagaaaccc 180

 

gcggctcagt ggctccttca acgttgcggt tctgtcagtt ccaaacgtaa aacggcttgt 240

 

cccgcgtcat cggcgggggt cataacgtga ctcccttaat tctccgctca tgatc 295

 

 

<210> 4

<211> 30

<212> DNA

<213> synthetic

 

<400> 4

ataagctttt cgaaatgggt ggcattgcat 30

 

 

<210> 5

<211> 26

<212> DNA

<213> synthetic

 

<400> 5

cgcggatccg aaattcactg gaaaga 26

 

 

<210> 6

<211> 39

<212> DNA

<213> synthetic

 

<400> 6

ataagctttt cgaaatggtt ggtgctataa aagcagcga 39

 

 

<210> 7

<211> 34

<212> DNA

<213> synthetic

 

<400> 7

gccggatccg tcatgctttc ttctgtttta cttc 34

 

 

Claims (2)

1. a Yeast expression carrier, is characterized in that, this carrier utilizes hindIIIwith ecoRIrespectively double digestion is carried out to transient expression vector pJITI66-GFP and carrier pYES2, reclaims enzyme and cut object fragment, obtain after connecting with T4DNA ligase enzyme;

Described Yeast expression carrier comprises available hindIII, salIwith bamHIenzyme cut multiple clone site and NOS terminator.

2. the Yeast expression carrier pYES2-GFP obtained by claim 1 method.