CN108559738A - A kind of system and method for plant RNA modification and editor - Google Patents

Abstract

The invention discloses a kind of system and methods of plant RNA modification and editor, using with transmethylase recombinant nucleic acid enzyme dCas13a RsmB and dPspCas13b RsmB and cytimidine C carried out to RNA with adenine deaminase active recombinant nucleic acid enzyme dPspCas13b hADAR (E488Q/T375G) methylate modification and the specific conversion of adenine A to hypoxanthine I, have the characteristics that high efficiency and specificity, be it is a kind of efficiently quickly RNA modification and editing system.

Description

A kind of system and method for plant RNA modification and editor

Technical field

The present invention relates to gene engineering technology field more particularly to a kind of plant RNA modification and editor system and method, It is fast with dPspCas13b-RsmB and with gland more particularly to the recombinant nucleic acid enzyme dCas13a-RsmB with transmethylase is used The recombinant nucleic acid enzyme dPspCas13b-hADAR (E488Q/T375G) of purine deaminase active methylates to RNA progress cytimidine C and repaiies The specificity conversion of decorations and adenine A to hypoxanthine I.

Background technology

The effect of gene editing tool is very important in the research process of science of heredity, the CRISPR found in recent years Gene editing technology with its high specificity, targeting is good, applicability is wide the features such as become vast researcher research and develop Hot spot.Genomic DNA knock out using CRISPR systems and then the method for studying gene function is very convenient and high Effect.CRISPR systems can not only carry out knocking out for genomic DNA can also be by merging the Cas protein sequences being mutated and urging The albumen for changing function realizes various target gene edit operations, such as merges the fixed point editor that deaminase realizes A-I and C-U.

Above a variety of editor's modification modes carry out all on DNA level, and RNA is transmitted as important hereditary information Medium is constantly subjected to prodigious limitation to its research, until Zhang Feng had found Sharpe cilium bacterium in 2016 (Leptotrichiashahii) there are a kind of novel CRISPR effect proteins Cas13a (C2c2) in.Cas13a has RNA The RNA enzyme activity of mediation, this is found to be provides a kind of new tool Abudayyeh in rna level change hereditary information, O.O.,J.S.Gootenberg,S.Konermann,J.Joung,I.M.Slaymaker,D.B.Cox,S.Shmakov, K.S.Makarova,E.Semenova,L.Minakhin,K.Severinov,A.Regev,E.S.Lander,E.V.Koonin and F.Zhang(2016)."C2c2is a single-component programmable RNA-guided RNA- targeting CRISPR effector."Science.).2017 professors Nian Zhangfeng are found that PspCas13b again, PspCas13b is a kind of more efficient nuclease more more stable than Cas13a.The cutting that PspCas13b can not only carry out RNA may be used also By the protein fusion of dPspCas13b (PspCas13b of inactivation) and different function, to realize the editor of various targeted rnas, Fixed point editor such as by merging hADAR realization A-I on rna level in zooblast.But current rna editing system It is only used in zooblast, the RNA fixed point edit effects in botanical system have no knowledge about.

RNA has more than 100 and plants different chemical modification forms so far as important inhereditary material in plant It is found.RNA methylates one of the important content of (RNA methylation) as epigenetics research, refers to being happened at Methylate modification phenomenon, 6-methyladenine (N6-methyladenosine, m6A) and the 5- first of different location in RNA molecule Base cytimidine (C5-methylcytidine, m5C) is modified after most common two kinds of rna transcriptions in eucaryote.RNA methyl Change and plays an important role in controlling gene expression, editor, stability and degradation etc..Relative to DNA methylation, RNA methyl Change is more complicated, and type is various, and is prevalent in various advanced bios.So far, there are no can artificially target to repair The system for adoring RNA.

Therefore, a kind of efficiently quick rna editing modification system is badly in need of in this field.

Invention content

In view of above-mentioned defect existing in the prior art, the purpose of the present invention is to propose to a kind of modification of plant RNA and editors System and method.

To achieve the goals above, present invention employs following technical solutions：

A kind of system of plant RNA modification and editor, includes the recombination with RNA modification and editting function of targeted rna The gRNA of nuclease and its targeted rna.

Further, the recombinant nucleic acid enzyme is by the nuclease dCas13a without cleavage activity of targeted rna (DeadCas13a, Cas13a are also referred to as C2c2) and dPspCas13b respectively with methyl transferase domains and adenine deaminase Merged, the recombinant nucleic acid enzyme dCas13a-RsmB with methyl transferase activity and dPspCas13b-RsmB of formation and With the active recombinant nucleic acid enzyme dPspCas13b-hADAR of adenine deaminase.

A kind of method of plant RNA modification and editor, using the plant RNA modification and editing system, by corresponding work( The enzyme of energy is directed on corresponding RNA, realizes modification and the editor of plant RNA.

Further, methylating and adenine alkali for cytosine base is carried out at target site using the recombinant nucleic acid enzyme The deamination of base, it is final to realize that the m5C of plant RNA methylates modification and A is converted to I.

Further, the method for modifying of the plant RNA includes establishing RNAm5C to methylate the vitro expression systems of modification； The vitro expression systems carry out the expression of external albumen using prokaryotic expression system, obtain with His and Msb labels The fusion protein of dCas13a-RsmB and dPspCas13b-RsmB, and establish methylating in vitro reaction system.

Further, the method for modifying of the plant RNA includes establishing RNAm5C to methylate the internal expression system of modification； The internal expression system is utilized respectively the expression of AtU6 promoters driving gRNA, and dCas13a- is driven using 35S promoter The expression of RsmB and dPspCas13b-RsmB carries out pointed decoration experiment in plant.

Further, the edit methods of the plant RNA include the reporting system for the dGFP for establishing premature translation termination, Identification for its fixed point editor.

Further, the edit methods of the plant RNA are the Premature stop codon by being catalyzed on the RNA of dGFP A base transitions at the sites TAG for hypoxanthine I, during translation I will with C base pairings, to make termination codon Sub- TAG reverts to TGG, and GFP albumen is normally translated；Transient expression is carried out in plant, it is glimmering by the green for observing GFP Light, to judge the effect of RNA fixed point editors.

The present invention protrusion effect be：

The system and method for a kind of plant RNA modification and editor of the present invention, uses the recombinant nuclear with transmethylase Sour enzyme dCas13a-RsmB is with dPspCas13b-RsmB and with the active recombinant nucleic acid enzyme of adenine deaminase DPspCas13b-hADAR (E488Q/T375G) carries out cytimidine C to RNA and methylates modification and adenine A to hypoxanthine I's Specificity conversion, has the characteristics that high efficiency and specificity, is that a kind of efficient quick RNA is modified and editing system.

Description of the drawings

Figure 1A is the dCas13a-RsmB methylating in vitro protein purification used carriers and embodiment 2 of the embodiment of the present invention 1 The carrier schematic diagram that surely turns of arabidopsis；

Figure 1B is the SDS-PAGE glue of the dCas13a-RsmB fusion protein coomassie brilliant blue stainings of the embodiment of the present invention 1 Figure；

Fig. 1 C are the dCas13a-RsmB methylating in vitro result figures of the embodiment of the present invention 1；

Fig. 2A is the conserved domain structural schematic diagram of the arabidopsis transmethylase TRM4B albumen of the embodiment of the present invention 2；

Fig. 2 B are the carrier structure schematic diagram for subcellular localization of the embodiment of the present invention 2；

Fig. 2 C are the TRM4B subcellular localization result figures of the embodiment of the present invention 2；

Fig. 3 A are for 3dPspCas13b-RsmB of embodiment of the present invention methylating in vitro protein purification used carriers and for intending The carrier schematic diagram that southern mustard surely turns；

Fig. 3 B are the SDS-PAGE of the dPspCas13b-RsmB fusion protein coomassie brilliant blue stainings of the embodiment of the present invention 3 Glue figure；

Fig. 3 C are the dCas13b-RsmB methylating in vitro result figures of the embodiment of the present invention 3；

Fig. 4 is the target site sequence to methylate in the dCas13a-RsmB bodies of the embodiment of the present invention 2 and the positions gRNA；

Fig. 5 is the schematic diagram of dPspCas13b-hADAR tobacco RNA A to the I base editors of the embodiment of the present invention 4；

Fig. 6 is dPspCas13b-hADAR protoplasts of Arabidopsis thaliana broken by ultrasonic RNA A to the I base editors' of the embodiment of the present invention 5 Schematic diagram.

Specific implementation mode

Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete Site preparation describes, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.

A kind of method of plant RNA modification and editor of the present invention, includes the following steps：

1. be transformed pET28a procaryotic cell expression carriers, structure have Msb hyper acidics protein hydrolysate (Zou, Z., L.Cao, P.Zhou,Y.Su,Y.Sun and W.Li(2008)."Hyper-acidic protein fusion partners improve solubility and assist correct folding of recombinant proteins expressed in Escherichia coli."J Biotechnol 135(4):333-339.) the prokaryotic cell table of label Up to carrier

From DH5 α the DNA sequence dna of Msb is obtained with PCR amplification and by PCR by His labels and TEV protease enzyme site It is added separately to the N-terminal and C-terminal of Msb, NcoI and BamHI double digestions PCR product and pET28a carriers is then used, finally uses T4DNA Ligase connects to obtain pET28a-Msb procaryotic cell expression carriers.

The gene order of NcoI-His-Msb-TEV-BamHI is as shown in SEQ ID NO.1.

2. transformation inactivation nuclease dCas13a and dPspCas13b (Δ 984-1090), structure has methyl transfer activity Fusion protein dCas13a-RsmB and dPspCas13b-RsmB to prokaryotic expression carrier pET28a-Msb on

From GENEWIZ companies synthesis by vegetable codon optimize dCas13a (Komor, A.C., Y.B.Kim, M.S.Packer,J.A.Zuris and D.R.Liu(2016)."Programmable editing of a target base In genomic DNA without double-stranded DNA cleavage. " Nature.) and dPspCas13b (Cox,D.B.T.,J.S.Gootenberg,O.O.Abudayyeh,B.Franklin,M.J.Kellner,J.Joung and F.Zhang(2017)."RNA editing with CRISPR-Cas13."Science 358(6366):1019-1027.) sequence Row

The gene order of dCas13a is as shown in SEQ ID NO.2.

The gene order of dPspCas13b is as shown in SEQ ID NO.3.

The sequence of dCas13a and dPspCas13b are obtained with PCR amplification, is then connected by BamHI and HindIII double digestions Enter and obtains pET28a-Msb-dCas13a and pET28a-Msb-dPspCas13b on pET28a-Msb prokaryotic expression carriers.

PCR amplification obtains the RsmB structural domains of TRM4B from arabidopsis thaliana genomic dna, is passed through later with HindIII digestions RsmB is connected into carrier pET28a-Msb-dCas13a and pET28a-Msb-dPspCas13b and obtains protokaryon by the method for homologous recombination Expression vector pET28a-Msb-dCas13a-RsmB and pET28a-Msb-dPspCas13b-RsmB.RsmB structural domains lead to respectively Cross XTEN (Komor, A.C., Y.B.Kim, M.S.Packer, J.A.Zuris and D.R.Liu (2016) " Programmable editing of atarget base in genomic DNA without double-stranded DNA cleavage. " Nature.) and HIV NEX (Cox, D.B.T., J.S.Gootenberg, O.O.Abudayyeh, B.Franklin,M.J.Kellner,J.Joung and F.Zhang(2017)."RNA editing with CRISPR- Cas13."Science 358(6366):1019-1027.) it is connected to the C-terminal of dCas13a and dPspCas13b.

XTEN catenation sequences are as follows：

tctggatctgagactcctggaacttctgagtctgctactcctgagtct

HIV NEX catenation sequences are as follows：

ggatcacttcaattgcctccacttgaaagattgacattgggatct

The gene order of RsmB structural domains is as shown in SEQ ID NO.4.It is specific as follows：

Note：Overstriking marks out HindIII restriction enzyme site AAGCTT in the position protogene group come, and former sequence is passed through PCR It is mutated into AAACTT and eliminates the sites HindIII but without changing albumen coded sequence.

3. procaryotic cell expression purified fusion albumen dCas13a-RsmB and dPspCas13b-RsmB

The carrier pET28a-Msb-dCas13a-RsmB and pET28a-Msb-dPspCas13b-RsmB that build are transferred to In Rosetta (DE3) Competent cell.The bacterium solution that 12ml is incubated overnight is inoculated into 6 liters of LB culture mediums.At 37 DEG C It is 0.4 that cell density, which is grown to, to OD600, and then temperature is down to 16 DEG C.When cell density to OD600 is 0.8, IPTG is added To a concentration of 250 μM.Culture 16 hours after, harvest bacterium solution and be resuspended in lysis buffer (50mM Tris-HCl pH 8.0, 0.5M NaCl, 10mM imidazoles, 5% glycerine, 1%Trixton X-100,1mM PMSF, 7.15mM BME) in, it is broken by ultrasound Fragmentation solution and ultracentrifugation clarified lysates.Use Ni-NTA His resinsDetach soluble fusion protein. Eluent containing fusion protein is applied to 5ml HiTrap Q HP (GE Health) in AKTA systems (GE Health). The fusion protein of purifying is dense in storage buffer solution (20mM Tris-HCl pH7.5,0.5M NaCl, 5% glycerine, 2mM DTT) It is reduced to 1mg/ml.

4. synthesis targeted rna and crRNA in vitro

The DNA sequence dna of the targeted rna and crRNA for in-vitro transcription is obtained first with PCR.

The gene order of targeted rna is as shown in SEQ ID NO.5.It is specific as follows：

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA17 sequences of dCas13a are as follows：

ccaccccaatatcgaaggggactaaaactagattgctgttctaccaagtaatccat

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA18 sequences of dCas13a are as follows：

ccaccccaatatcgaaggggactaaaaccatgcctgcaggtcgagtagattgctgt

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA27 sequences of dCas13a are as follows：

ccaccccaatatcgaaggggactaaaacgaaacagctatgaccatgattacgccaa

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA31 sequences of dCas13a are as follows：

ccaccccaatatcgaaggggactaaaacataaacacaggaaacagctatgaccatg

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA33 sequences of dCas13a are as follows：

ccaccccaatatcgaaggggactaaaacagcggataaacacaggaaacagctatga

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA17 sequences of dPspCas13b are as follows：

tgcaggtcgagtagattgctgttctaccaagtaatccatatttctagagggttgtggaaggtccagttttgaggggc tattacaac

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA18 sequences of dPspCas13b are as follows：

cgccaagcttgcatgcctgcaggtcgagtagattgctgttctaccaagtagttgtggaaggtccagttttgaggggc tattacaac

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA27 sequences of dPspCas13b are as follows：

gataaacacaggaaacagctatgaccatgattacgccaagcttgcatgccgttgtggaaggtccagttttgaggggc tattacaac

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA31 sequences of dPspCas13b are as follows：

attgtgagcggataaacacaggaaacagctatgaccatgattacgccaaggttgtggaaggtccagttttgaggggc tattacaac

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

The gRNA33 sequences of dPspCas13b are as follows：

gtggaattgtgagcggataaacacaggaaacagctatgaccatgattacggttgtggaaggtccagttttgaggggc tattacaac

Note：The sequence of overstriking mark is T7 promoter sequences, is used for the in-vitro transcription of T7 RNA polymerases.

Targeted rna and crRNA HiScribe^TMT7Quick High Yield RNA Synthesis Kit (NEB) are closed At then with RNA Clean＆Concentrator (ZYMO RESEARCH) purifying.

5. methylating in vitro

First is carried out with the fusion protein of 1XCutsmart buffer solutions, 80 μM of SAM, 8pM ssRNA, 5pM crRNA, 20pM Glycosylation reaction 1 hour passes through RNA Clean＆Concentrator (ZYMO RESEARCH) purifying RNA.

6. bisulf iotate-treated RNA (David, R., A.Burgess, B.Parker, J.Li, K.Pulsford, T.Sibbritt,T.Preiss and I.R.Searle(2017)."Transcriptome-wide Mapping of RNA 5-Methylcytosine in Arabidopsis mRNAs and non-coding RNAs."Plant Cell.)

Configure bisulfite solution：40% sodium hydrogensulfite, 0.6mM hydroquinones, pH5.1.Add 100 μ L sulfurous acid In hydrogen salt solution to RNA to be treated, 75 DEG C are handled 4 hours, with Micro Bio-Spin 6chromatography Columns desalinations 2 times.The 1MHCl of 100 μ L is added in the RNA after desalting processing, pH9.0 DEG C 75 is handled 1 hour.Finally With RNA Clean＆Concentrator (ZYMO RESEARCH) purifying RNA.

7. extracting RNA with Trizol

It is added in the Trizol to sample of 1ml, stands 5 minutes, 200 μ l chloroforms are added, acutely shake 15s.It is stored at room temperature 5 Minute, 12000g, 4 DEG C centrifuge 15 minutes.It takes supernatant that 500 μ l isopropanols are added, is stored at room temperature 5 minutes, centrifuge 10 minutes.With 75% ethyl alcohol is washed one time, and super-clean bench dries up ethyl alcohol, and suitable water dissolution RNA is added.

8.RT-PCR and Sanger sequencings detect the efficiency that methylates

By RNA TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit reverse transcription obtains cRNA, then is expanded with high fidelity enzyme to obtain DNA sequence dna.The DNA that amplification is obtained is used Gel Extraction Kit purifying, is then building up on carrier by pEASY-Blunt Zero Cloning Kit and is used Sanger sequencings 30 clones of detection.

Sequence for RT-PCR and the primer sequence BS-FP of amplification is as follows：

ttagtgaatttgagtttggt

Sequence for RT-PCR and the primer sequence BS-RP of amplification is as follows：

ctttatacttccaactcata

Sequence for RT-PCR and the primer sequence BS-S3FP of amplification is as follows：

attttgattatttaatgagg

Sequence for RT-PCR and the primer sequence BS-S3FP of amplification is as follows：

tcattctttatctcaaactt

9. pCambia1300AtU6-35S-dCas13a-RsmB carrier of the structure for arabidopsis stable conversion

By for transcribing gRNA promoter terminator and dCas13a gRNA frame sequences be inserted into pCambia1300 Between the sites HindIII and XmaI.

The gene order of AtU6 is as shown in SEQ ID NO.6.

DCas13a gRNA frame sequences are as follows：

ccaccccaatatcgaaggggactaaaac

Note：Overstriking mark is containing there are two the sequences in the sites BsaI, for being inserted into spacer.

Terminator sequence is as follows：

tttttttgttttttatgtct

Between 35S promoter for expressing dCas13a-RsmB and NOS terminator are inserted into XmaI and EcoRI, 35S is opened The sites NcoI and BamHI are inserted between mover and NOS terminator.

The gene order of 35S promoter sequence is as shown in SEQ ID NO.7.

The gene order of NOS terminator is as shown in SEQ ID NO.8.

With the dCas13a- that insertion is expanded from pET28a-Msb-dCas13a-RsmB after NcoI and BamHI double digestions RsmB sequences, and NLS nuclear localization signals are added respectively in the N-terminal of dCas13a-RsmB and C-terminal.

The gene order of NLS-dCas13a-RsmB-NLS is as shown in SEQ ID NO.9.It is specific as follows：

Note：Overstriking, which marks out, to be N-terminal and the NLS nuclear localization signal sequences of C-terminal.

10. pCambia1300AtU6-35S-dPspCas13b-RsmB carrier of the structure for arabidopsis stable conversion

The gRNA frame sequences of dPspCas13b are obtained with PCR amplification, and pass through the method for HindIII and XmaI double digestions Replace the gRNA frame sequences of dCas13a.

DPspCas13b frame sequences are as follows：

gttgtggaaggtccagttttgaggggctattacaac

Note：Overstriking mark is containing there are two the sequences in the sites BsaI, for being inserted into spacer.

It is expanded from pET28a-Msb-dPspCas13b-RsmB with insertion after NcoI and BamHI double digestions DPspCas13b-RsmB sequences, and added in C-terminal plus Flag-NLS nuclear localization signals in the N-terminal of dPspCas13b-RsmB NLS nuclear localization signals.

The gene order of Flag-NLS-dPspCas13b-RsmB-NLS is as shown in SEQ ID NO.10.It is specific as follows：

Note：Overstriking marks out the NLS nuclear localization signal sequences of the next Flag-NLS nuclear localization sequences and C-terminal for being N-terminal.

11. the vector construction for the positioning of TRM4B protein subcellulars

Between 35S promoter and NOS terminator are inserted into HindIII the and EcoRI restriction enzyme sites of pCambia1300,35S There are NcoI and SpeI restriction enzyme sites among promoter and NOS terminator.GFP sequences are passed through into homologous recombination after being cut with SpeI Method be inserted into, with the method for homologous recombination by the sequence of the TRM4B obtained from arabidopsis thaliana genomic dna after being cut with NcoI It is inserted into.

The gene order of GFP is as shown in SEQ ID NO.11.

The gene order of TRM4B is as shown in SEQ ID NO.12.

12. being inserted into spacer sequences in skeleton carrier

It is chosen on purpose RNA and synthesizes complementary primer after corresponding sequence (forward and reverse primer adds connect accordingly respectively Header sequence), on the skeleton carrier after being connected to BsaI digestions with T4DNA ligases after annealing.

DCas13a gRNA-S1 sequences are as follows：

ttccacacctctttccacccatctcttt

DCas13a gRNA-S2 sequences are as follows：

cttcctcagctgggggttccacacctct

DCas13a gRNA-S3 sequences are as follows：

aggaggtagtgcagcttcctcagctggg

DPspCas13b gRNA-S1 sequences are as follows：

tcagctgggggttccacacctctttccacccatctctttaggttatcgtc

DPspCas13b gRNA-S2 sequences are as follows：

aggtagtgcagcttcctcagctgggggttccacacctctttccacccatc

DPspCas13b gRNA-S3 sequences are as follows：

gacgttggaggaggaggtagtgcagcttcctcagctgggggttccacacc

DPspCas13b gRNA10 sequences are as follows：

gcactgcacgccgtaggtgaaggtggtcacgagggtgggccagggcacgg

DPspCas13b gRNA15 sequences are as follows：

gcacgccgtaggtgaaggtggtcacgagggtgggccagggcacgggcagc

DPspCas13b gRNA20 sequences are as follows：

ccgtaggtgaaggtggtcacgagggtgggccagggcacgggcagcttgcc

DPspCas13b gRNA25 sequences are as follows：

ggtgaaggtggtcacgagggtgggccagggcacgggcagcttgccggtgg

DPspCas13b gRNA30 sequences are as follows：

aggtggtcacgagggtgggccagggcacgggcagcttgccggtggtgcag

DPspCas13b gRNA35 sequences are as follows：

gtcacgagggtgggccagggcacgggcagcttgccggtggtgcagatgaa

DPspCas13b gRNA40 sequences are as follows：

gagggtgggccagggcacgggcagcttgccggtggtgcagatgaacttca

DPspCas13b gRNA45 sequences are as follows：

tgggccagggcacgggcagcttgccggtggtgcagatgaacttcagggtc

13. building dPspCas13b-hADAR carriers

It will successively be inserted after carrier pCambia1300AtU6-35S-dPspCas13b-RsmB XhoI and EcoRI digestions The sequence for entering dPspCas13b and NOS, is separated between dPspCas13b and NOS with BamHI.Synthesize vegetable codon optimization The sequence (Cox, Gootenberg et al.2017) of hADAR, then with the method for using homologous recombination after BamHI cut vector HADAR is inserted between dPspCas13b and NOS.

Obtain carrier pCambia1300AtU6-35S-dPspCas13b-hADAR.

It will be inserted after carrier pCambia1300AtU6-35S-dPspCas13b-hADAR HindIII and EcoRI cuttings Enter and obtains the carrier pUC19AtU6-35S- used in protoplast transformation between the sites HindIII and EcoRI of pUC19 dPspCas13b-hADAR。

The gene order of hADAR is as shown in SEQ ID NO.13.

The design of 14.dGFP reporting systems

35S promoter and NOS terminator sequence, 35S promoter are inserted between the SbfI and EcoRI of pCambia1300 The sites BamHI are added between sequence and NOS terminator sequence.DGFP is inserted into 35S with homologous recombination after being cut with BamHI Between promoter sequence and NOS terminator sequence.

The gene order of dGFP is as shown in SEQ ID NO.14.It is specific as follows：

Note：The place of overstriking mark is that original bases G is become A by PCR so that originally encodes the close of W amino acid Numeral becomes for terminator codon, to obtain dGFP sequences.

15. the preparation and conversion of protoplasts of Arabidopsis thaliana broken by ultrasonic

The tender Arabidopsis leaf of children is taken, blade is cut to 0.5mm-1mm sizes using blade.It immerses in 10ml enzymolysis liquids, mixes It is even, light culture 2h-3h, until protoplast is disintegrated down from blade completely.After enzymolysis, microscopy digests result.Use 200 10ml in mesh stainless steel screen filtration protoplast to new centrifuge tube.100 × g 4 DEG C, centrifuges 2min, collects protoplast. Protoplast is resuspended in the W5 fluid nutrient mediums being pre-chilled in equal volume, 100 × g centrifuges 2min, collects protoplast, is repeated 2 times. Protoplast is resuspended in the W5 liquid being pre-chilled in equal volume, ice bath 30min.100 × g centrifuges 2min, collects protoplast, is resuspended Protoplast is in 1/10 volume MMg.A small amount of resuspension protoplast microscopy is taken, remaining is for converting.

Each 10 μ l Plasmid DNA is added in 2ml centrifuge tubes, 120 μ l PEG/ are added in 100 μ l protoplasts after mixing well Ca2+ solution.It is placed at room temperature for 15min.500 μ l W5 are added after reaction, mix well.100 × g centrifuges 2min, collects former Raw plastid, removes supernatant.700 μ l W5 solution are added, 100 × g centrifuges 2min, collects protoplast, is repeated once.It is resuspended former Protoplast is transferred in the tissue culture plate with 1% BSA rinses, 23 DEG C of dark culturings 16 by raw plastid in 1ml W5 A hour observes fluorescence signal.

16. tobacco transient expression

Corresponding carrier is transferred to Agrobacterium GV3101,28 DEG C of dark culturings two days, picking monoclonal is in 5ml LB resistances In culture medium (50mg/L kanamycins, 25mg/L rifampins), 28 DEG C, 240rpm is cultivated 16 hours, with 1：100 ratio switching Into new 5ml LB resistance culture bases, 28 degree, 240rpm overnight incubations to OD600=3.4000rpm, 10min collect thalline, With 10mM MES pH 5.6,10mM MgCl2,10 μm of acetosyringone solution hang thalline, adjust OD600 20 to 1.Wen Jing After setting 2-3 hours, Agrobacterium is injected into 4 weeks or so the good Tobacco Leafs of growth conditions with the 1ml injector for medical purpose without syringe needle The piece back side.Sampling observation fluorescence signal after culture 36-48 hours.

17. transformation of Arabidopsis thaliana and positive seedling screening

Corresponding carrier is transferred in Agrobacterium GV3101, the healthy and strong arabidopsis for having opened flower is chosen and is lost with flower-dipping method Pass conversion.Normal growth collects T1 for seed after one month, then screened on the 1/2MS tablets of the hygromycin containing 50mg/L positive Seedling is transplanted in soil.

1 dCas13a-RsmB methylating in vitro of embodiment

First, it constructs expression vector and purifies and obtained fusion protein dCas13a-RsmB, dCas13a-RsmB's Expression is driven using T7 promoters, and has added Msb labels with Enhanced expressing in N-terminal, has His labels for melting in N-terminal and C-terminal The purifying (Figure 1A and Figure 1B) of hop protein.Then methylating in vitro experiment has been carried out, sodium hydrogensulfite is used in combination to handle external first RNA after base.By sanger be sequenced to have obtained dCas13a-RsmB methylating in vitro as a result, be utilized 5 gRNA come The different location of targeted rna is targeted, used 5 gRNA can make targeted rna methylate, but be different gRNA first The position of base and efficiency are all different (Fig. 1 C).Although methylating in vitro it is less efficient be 3.33% to 6.67% between, DCas13a-RsmB can be methylated really with cytimidine on mediate rna.In addition the site of dCas13a-RsmB methylating in vitro More than cytosine base being limited in inside gRNA binding sites, around gRNA binding sites having also discovered many has occurred first The cytimidine of base, be similarly to CRISPR mediation DNA methylation (Liu, X.S., H.Wu, X.Ji, Y.Stelzer, X.Wu, S.Czauderna,J.Shu,D.Dadon,R.A.Young and R.Jaenisch(2016)."Editing DNA Methylation in the Mammalian Genome."Cell 167(1):233-247e217.).And dCas13a- RsmB's methylates with certain site preference, for example other four gRNA other than gRNA27 can be mediated DCas13a-RsmB is to C79, C83, C87 and C91.C96 can be methylated by gRNA17, gRNA18 and gRNA31 simultaneously.In vitro It methylates and shows that only certain specific sites can be methylated by the gRNA dCas13a-RsmB mediated, this is the same as existing research Match (David, R., A.Burgess, B.Parker, J.Li, K.Pulsford, T.Sibbritt, T.Preiss and I.R.Searle(2017)."Transcriptome-wide Mapping of RNA 5-Methylcytosine in ArabidopsismRNAs and non-coding RNAs."Plant Cell.).And the binding site of gRNA is to methylating Efficiency has a great impact, as only there are one the discoveries of the cytimidine in site to methylate by gRNA27.

It methylates in 2 dCas13a-RsmB bodies of embodiment

The modification that methylates of progress RNA in vivo after the cytosine methylation of RNA, will be successfully attempted in vitro.For The methylating of the internal targeted rna of realization, has done the subcellular localization of arabidopsis transmethylase TRM4B first.Shown in Fig. 2A, Only there are one conservative structural domain RsmB by TRM4B, so being all to use RsmB rather than overall length in the experiment that methylates in vivo afterwards TRM4B carry out the experiment that methylates.Tobacco instantaneous conversion the result shows that TRM4B is located in plant in nucleus (Fig. 2 B and Fig. 2 C) is imported dCas13a-RsmB carefully using nuclear localization signal so in order to successfully be methylated in vivo In karyon.Then the expression for utilizing AtU6 drivings gRNA, the expression (Figure 1A and Fig. 4) of dCas13a-RsmB is driven using 35S. The mRNA of MAG5 is the targeted rna of TRM4B in arabidopsis body, and TRM4B can methylate the specific site of MAG5 genes (David,R.,A.Burgess,B.Parker,J.Li,K.Pulsford,T.Sibbritt,T.Preiss and I.R.Searle(2017)."Transcriptome-wide Mapping of RNA 5-Methylcytosine in Arabidopsis mRNAs and non-coding RNAs."Plant Cell.).Target MAG5mRNA's so constructing Carrier and successful conversion the mutant trm4b-1 of TRM4B and genetically modified plants are obtained.It is had detected in T1 generations The methylation level of MAG5mRNA.The result shows that dCas13a-RsmB really can be by the specific site first of targeted rna in vivo Base, in 3 gRNA sequences of trial, a transgenosis line of gRNA_S3 can methylate 10% C111. Although the vivo results of dCas13a-RsmB show that it is the feasible efficiency ratio to methylate to carry out methylating for target site in vivo It is relatively low.

3 dPspCas13b-RsmB methylating in vitro of embodiment

The cytimidine on targeted rna although dCas13a-RsmB can methylate, the less efficient (figure to methylate 1C).In order to improve the efficiency that methylates, the load of dPspCas13b-RsmB fusion proteins is constructed with the dPspCas13b newly reported Body and purifying have obtained fusion protein (Fig. 3 A and Fig. 3 B) and have been same methylating in vitro experiment, dPspCas13b- The expression of RsmB is driven using T7 promoters, and has added Msb labels with Enhanced expressing in N-terminal, has His labels in N-terminal and C-terminal Purifying for fusion protein.The methylating in vitro efficiency of dPspCas13b-RsmB is most of obviously than dCas13a-RsmB high The efficiency that methylates reached 6.67% or more, the highest efficiency that methylates is 23.3%.As dCas13a-RsmB, first Base is apparently higher than elsewhere in the efficiency in some sites and some sites are under the mediation of multiple gRNA to occur Methylate (Fig. 3 C), and 5 gRNA are utilized to target the different location of targeted rna.5 gRNA used can make targeting RNA methylates, but is different position that gRNA methylates and efficiency is all different, compared with dCas13a-RsmB Methylating for dPspCas13b-RsmB is more efficient.And most methylate is happened at targeting in dCas13a-RsmB The centre position of RNA, and most methylate is happened at the N-terminal of targeted rna pair in dPspCas13b-RsmB.So can With think targeted rna methylate efficiency mainly with gRNA pairs of binding site in relation to and the methyl of a certain specific targeted rna Change pattern and gRNA relationships are not very big.

The editor of adenine A to I in embodiment 4dPspCas13b-hADAR tobaccos

DPspCas13b-hADAR by the A on RNA it is reported that can become I, so having carried out the alkali of A to I in tobacco Base editor trial (Cox, D.B.T., J.S.Gootenberg, O.O.Abudayyeh, B.Franklin, M.J.Kellner, J.Joung and F.Zhang(2017)."RNA editing with CRISPR-Cas13."Science 358(6366): 1019-1027).One in the mRNA of GFP is encoded the codon of W amino acid by the reporting system for constructing a dGFP first It is substituted for terminator codon, so the mRNA of dGFP can be carried out normally transcribing but can not be translated.It then will report The blade that announcement system and the carrier for expressing gRNA and dPspCas13b-hADAR inject tobacco simultaneously is tested.Experimental result table Bright, A bases can be compiled as I bases by dPspCas13b-hADAR really, to successfully that the green florescent signal of GFP is extensive Multiple, one has shared 8 different gRNA to restore dGFP green florescent signals (Fig. 5) in tobacco A to I base editors test.

The editor of adenine A to I in embodiment 5dPspCas13b-hADAR protoplasts of Arabidopsis thaliana broken by ultrasonic

DGFP successfully compiled in tobacco after GFP sees green florescent signal, in protoplasts of Arabidopsis thaliana broken by ultrasonic into Capable same dGFP edits experiment, and successfully realizes the editor of dGFP to GFP, used and tobacco in it is same GRNA and similar result (Fig. 6) is obtained.Similar in tobacco as a result, only part cell has green florescent signal, It is considered that this is relatively low caused by expression dGFP reporting systems and dPspCas13b-hADAR and two carriers of gRNA with having used Transformation efficiency it is related.

The foregoing is only a preferred embodiment of the present invention, but scope of protection of the present invention is not limited thereto, Any one skilled in the art in the technical scope disclosed by the present invention, according to the technique and scheme of the present invention and its Inventive concept is subject to equivalent substitution or change, should be covered by the protection scope of the present invention.

Sequence table

<110>University Of Nanchang

<120>A kind of system and method for plant RNA modification and editor

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 431

<212> DNA

<213>Artificial sequence ()

<400> 1

ccatggagca tcaccatcac catcaccatc accatcacac catgtacgca acgcttgaag 60

aagccattga cgctgcacgc gaagaatttc ttgcagacaa ccccggcatc gacgccgaag 120

atgcgaatgt gcaacagttc aatgcccaaa aatacgtttt gcaggacggc gacatcatgt 180

ggcaagttga gttttttgcc gacgaagggg aagaaggtga atgtttacct atgcttagcg 240

gtgaagccgc gcaaagtgtt tttgatggcg actatgatga gatagagata cgccaggagt 300

ggcaggaaga gaatacatta catgaatggg acgaggggga atttcagctt gagccaccgc 360

tggataccga ggaaggacgc gcagcagctg atgagtggga tgaacgtgaa aacctgtatt 420

ttcagggatc c 431

<210> 2

<211> 4164

<212> DNA

<213>Artificial sequence ()

<400> 2

ggaaatcttt tcggacataa aagatggtac gaagtgagag ataagaagga tttcaagatt 60

aagagaaagg ttaaggttaa gaggaattac gatggaaaca agtacattct taatatcaat 120

gagaataaca ataaggaaaa aattgataat aataagttca ttaggaaata catcaactat 180

aaaaaaaacg ataatatcct taaggaattt actagaaagt tccatgcagg taacattctt 240

tttaaattaa aaggtaaaga gggaattatc aggatcgaaa ataacgatga ttttcttgag 300

actgaggagg tggtgttgta catcgaggca tatggtaagt cagaaaaatt aaaggcattg 360

ggaatcacaa agaaaaagat catcgacgag gctatcaggc aaggaattac taaggatgat 420

aagaaaatcg agattaaaag gcaggagaac gaggaagaga tcgaaatcga tattagagac 480

gagtatacaa acaagacact taatgattgt tctatcatcc ttagaatcat tgaaaatgat 540

gaacttgaaa ctaagaagtc aatctatgag atctttaaga acattaacat gtcattgtat 600

aagattatcg agaagatcat cgagaacgag actgagaagg tgttcgagaa tagatattac 660

gaagagcatc ttagggagaa attgttgaaa gacgataaaa ttgatgttat tttgacaaat 720

ttcatggaaa ttagagagaa aattaagtct aacttggaaa ttcttggttt cgttaagttc 780

tacttgaatg ttggaggtga caaaaagaaa tctaagaata agaaaatgtt ggttgaaaag 840

attcttaaca tcaatgttga ccttacagtt gaagacattg ctgatttcgt tattaaggaa 900

ttggaatttt ggaacattac taagagaatc gaaaaagtta aaaaagttaa caatgaattt 960

ttggaaaaaa gaaggaatag gacttacatc aagtcatatg ttcttttgga taagcatgag 1020

aaatttaaga tcgaaagaga gaacaagaaa gataaaattg tgaagttttt tgttgagaac 1080

attaagaaca actctatcaa agagaaaatt gagaagattc ttgctgagtt taaaatcgac 1140

gagttgatca aaaagttgga aaaagagttg aagaagggaa actgtgatac tgaaattttc 1200

ggaattttca aaaaacatta caaagttaac ttcgattcta agaaattctc taagaagtct 1260

gatgaggaga aggagcttta caaaatcatc tatagatacc ttaagggaag gattgaaaag 1320

atccttgtta atgagcagaa ggttagattg aagaagatgg agaagattga aatcgagaaa 1380

atccttaatg agtcaatcct ttcagagaag atccttaaga gggttaagca gtacactctt 1440

gagcatatta tgtatcttgg taaattgaga cataatgata tcgatatgac tactgtgaac 1500

actgatgatt tctcaagatt gcatgcaaag gaggagcttg acttggagtt gattactttt 1560

ttcgcttcta ctaatatgga gttgaacaag attttttccc gtgaaaacat caacaacgac 1620

gagaacatcg acttcttcgg tggagacagg gagaaaaact acgttttgga taagaagatt 1680

ttgaactcta agattaagat tatcagagat ttggatttca tcgataacaa gaacaatatc 1740

actaataatt ttattagaaa gttcactaaa attggaacta atgaagcaaa ccgtatttta 1800

cacgctattt ctaaggagag agatcttcag ggaactcaag acgattataa taaggtgatt 1860

aacattatcc aaaatttgaa gatctctgat gaagaggttt ctaaagctct taatttggat 1920

gtggtgttca aggataagaa gaatatcatt actaaaatca acgatatcaa aatttcagag 1980

gagaataaca acgatattaa atacttgcct tctttctcta aggttttgcc agaaattctt 2040

aacctttata gaaataaccc taagaatgag ccattcgata caattgagac agaaaagatt 2100

gttcttaacg cacttattta tgttaacaag gagttgtata agaaattaat tcttgaggat 2160

gaccttgaag agaatgaatc aaaaaatatc ttccttcagg agttgaaaaa gactcttggt 2220

aacattgatg aaattgatga gaacatcatt gagaattatt acaaaaatgc tcagatttca 2280

gcttctaagg gtaataacaa ggctattaaa aaatatcaaa agaaggttat cgaatgctac 2340

atcggttatc ttagaaaaaa ttatgaggaa cttttcgact tttctgactt caaaatgaac 2400

atccaagaaa tcaagaagca aatcaaggat attaacgaca ataagactta cgagagaatt 2460

actgttaaga catctgacaa gactatcgtt atcaatgatg atttcgaata catcatttct 2520

attttcgcac ttcttaattc taatgctgtt atcaataaaa tcaggaatag gttcttcgct 2580

acttcagtgt ggcttaacac atctgagtac cagaatatca tcgatatcct tgatgagatc 2640

atgcagctta atactttgag aaatgaatgt attacagaga actggaactt gaatcttgag 2700

gagttcattc aaaagatgaa ggagatcgag aaggattttg atgattttaa aattcagact 2760

aagaaggaaa tttttaacaa ctattacgag gatatcaaaa acaatattct tacagagttt 2820

aaggatgata ttaacggttg tgatgttctt gaaaagaaat tagagaagat tgttattttt 2880

gatgacgaaa ctaaatttga aattgacaaa aagtctaata ttcttcaaga cgagcagaga 2940

aagttgtcta atatcaataa gaaggacttg aagaagaaag tggatcagta tattaaagat 3000

aaggatcaag aaatcaaatc taaaatcctt tgtaggatca tcttcaactc tgactttttg 3060

aagaagtata aaaaggagat cgataatttg attgaagata tggaatctga aaatgagaac 3120

aagtttcagg aaatctacta tcctaaagag agaaaaaacg aattgtacat ctataagaaa 3180

aacctttttt tgaatattgg taatccaaat tttgataaaa tctacggact tatttctaac 3240

gacattaaga tggcagatgc taagttcctt tttaatatcg atggaaagaa tatcagaaaa 3300

aataaaatct ctgaaatcga cgctattctt aagaacttga acgacaaatt gaacggatat 3360

tctaaggagt ataaggaaaa gtacattaaa aaattgaagg aaaatgatga tttttttgca 3420

aagaacatcc aaaacaaaaa ttacaagtct tttgagaagg attataacag agtgtctgaa 3480

tataaaaaaa tcagggatct tgtggaattt aactatttga ataaaattga atcttacctt 3540

attgatatca actggaaatt agctatccag atggcaagat tcgagaggga catgcactac 3600

atcgtgaacg gacttaggga acttggtatt atcaaattgt ctggatacaa cacaggtatc 3660

tcccgtgcat accctaagag gaatggatct gatggattct acacaacaac tgcttactat 3720

aagttctttg atgaggaatc atataaaaag ttcgagaaga tttgctacgg tttcggtatc 3780

gatctttctg aaaattctga gatcaacaag cctgagaacg aatctattag aaactacatc 3840

tctcattttt atatcgtgag aaatccattc gctgattatt ctatcgctga gcaaatcgat 3900

agagtttcaa atcttttgtc ttactctact aggtataaca actctacata cgcttctgtt 3960

ttcgaagttt ttaagaagga cgttaacctt gattatgatg aacttaagaa aaagttcaag 4020

ttgattggaa ataacgatat cttggagaga ttgatgaaac caaagaaagt ttctgttttg 4080

gaacttgagt cttataactc tgattacatc aaaaacctta ttattgaact tttgacaaag 4140

attgagaata ctaatgatac tctt 4164

<210> 3

<211> 2949

<212> DNA

<213>Artificial sequence ()

<400> 3

atgaatattc cagctttggt tgaaaaccaa aagaaatatt ttggaactta ctcagttatg 60

gctatgttga atgcacaaac tgttcttgat catattcaga aggttgcaga catagagggt 120

gagcagaacg agaacaatga gaacctttgg ttccatccag ttatgtcaca tctttacaat 180

gctaaaaatg gttatgataa gcagccagaa aaaactatgt ttattattga gagacttcaa 240

tcatactttc ctttccttaa gattatggct gaaaaccaga gagaatactc taatggaaag 300

tataagcaaa acagagttga ggttaattca aatgacatat ttgaggtttt gaagagagct 360

ttcggtgttt tgaaaatgta tagagacttg actaatgctt ataaaacata tgaggaaaag 420

ttgaacgacg gatgtgagtt ccttacttct actgagcagc cactttctgg tatgattaac 480

aactattaca ctgttgcttt gagaaatatg aatgaaagat atggttataa aacagaggac 540

cttgctttta ttcaagacaa gagatttaag tttgttaaag atgcttatgg taaaaagaag 600

tcacaagtta acactggttt cttcctttca ttgcaagact ataacggaga tactcaaaaa 660

aagttgcatt tgtctggtgt gggaatagca ttgcttattt gccttttttt ggataagcaa 720

tacattaata tttttttgtc tagattgcct atattttcat cttataatgc tcagtctgaa 780

gaaaggagga ttattattag atcatttgga ataaactcta ttaaattgcc taaagatagg 840

attcattctg aaaagtctaa taagtcagtt gcaatggata tgttgaacga agtgaagagg 900

tgccccgatg aactttttac tactttgtca gctgaaaaac aatctaggtt taggattatt 960

tctgatgatc ataatgaagt tcttatgaag cgttcttctg ataggtttgt tccacttctt 1020

cttcaatata tagactacgg aaagttgttt gaccacatta ggttccacgt taacatggga 1080

aaacttagat atttgttgaa ggctgataag acatgtattg acggtcaaac tagggttagg 1140

gttattgagc agccattgaa cggattcggt agacttgagg aggcagagac tatgaggaag 1200

caagaaaacg gaactttcgg aaattctggt attaggatta gggattttga aaatatgaag 1260

agggatgacg ctaacccagc taactaccca tatattgttg atacatacac acattacatt 1320

cttgagaata acaaggttga gatgtttatt aatgataagg aggactctgc tccattgctt 1380

ccagtgattg aagatgatag atacgttgtt aagactatac cttcatgtag aatgtctact 1440

cttgagattc ccgctatggc ttttcatatg tttctttttg gttctaagaa aacagaaaag 1500

ttgattgttg acgttcataa tagatataag agattgttcc aagctatgca gaaggaggag 1560

gtgacagctg agaacattgc atctttcgga atagcagagt ctgatttgcc tcagaaaatt 1620

ttggatctta tttctggaaa tgcacacggt aaggacgtgg acgctttcat taggttgaca 1680

gttgatgata tgcttactga cactgagaga agaattaaga ggtttaaaga tgataggaaa 1740

tcaattaggt ctgctgacaa caaaatggga aaaaggggat tcaagcaaat ttctactgga 1800

aagttggcag actttttggc taaagacata gttttgtttc aaccatctgt taatgatgga 1860

gagaacaaga ttactggtct taactatcgt attatgcaat ctgctattgc tgtgtacgac 1920

tctggtgacg attacgaggc aaagcaacag ttcaaattaa tgtttgaaaa ggctagattg 1980

attggaaagg gaactactga gcctcaccct ttcttgtata aagtgtttgc aaggtcaatt 2040

cccgctaatg ctgttgagtt ctacgaaagg tatcttattg aaagaaaatt ttatcttact 2100

ggtctttcta atgaaattaa aaagggtaat agagtggacg tgccattcat taggagggac 2160

cagaacaagt ggaaaactcc cgctatgaaa actcttggaa gaatttactc tgaggacctt 2220

ccagttgagc ttcctaggca aatgtttgac aacgagatta aatctcatct taagtcattg 2280

cctcaaatgg agggtattga tttcaataat gcaaatgtga cttatcttat tgctgaatac 2340

atgaaaaggg ttttggatga cgatttccag acattttatc aatggaatag gaattataga 2400

tatatggata tgcttaaggg agagtacgat cgtaagggtt ctcttcagca ctgcttcact 2460

tctgtggagg aaagggaggg tttgtggaag gagagggctt ctaggacaga aaggtatcgt 2520

aagcaagcct ctaataagat aagatctaat cgtcagatga ggaacgcatc atcagaggaa 2580

attgagacta ttcttgataa aagactttct aattcaagga acgaatatca aaaatctgag 2640

aaggttatta gaagatatcg tgttcaagat gcattgcttt tcttgcttgc taaaaagact 2700

ttgacagaat tggctgactt tgatggagaa aggtttaagt tgaaagagat aatgccagac 2760

gcagagaagg gaattttgtc tgaaattatg cctatgtcat ttacatttga gaaaggtgga 2820

aagaagtaca ctattacatc tgagggaatg aaacttaaaa attacggaga ttttttcgtt 2880

cttgcatctg ataagagaat tggtaatttg cttgagttgg ttggttctga tattgtttca 2940

aaggaagat 2949

<210> 4

<211> 993

<212> DNA

<213>Artificial sequence ()

<400> 4

ttcgaggaat attacaagaa acaagggata gtgaaagctg aagagtggga tttgttcatg 60

gagattcttc gtaagccttt acctgctgcg tttagggtta actccaatgg ccaattttgc 120

gatgagatta tatcgatctt ggagaatgac tttatgaaat cacttcaggc tgaggccata 180

gaaggtggtg aattggaggc tattaagccc ttgccttggt atccaaagaa tctcgcttgg 240

cattctaatt tttctcgaaa ggagataaga aaaaatcaga cacttgagag gtttcatgag 300

tttctgaagt tagaaaatga agttggaaat attactaggc aggaagctgt tagcatggta 360

cctcctctct tcctagacgt acatccagat catttcgtac ttgacatgtg tgctgcaccg 420

ggttccaaaa catttcagct gcttgagatt atacatgaag catcagaacc aggatctctt 480

cctaatggat tggtggtggc taatgatgtt gattttaaaa gatctaacct tctcattcac 540

caaacaaaga gaatgtgcac atccaacttg atagtgacaa atcatgaagg gcaacagttt 600

cctggttgcc gtttgaacaa atcccgagct tctgagaaag gaataagtga aaatatgcct 660

attaatcaac ttgcctttga ccgtgttcta tgcgatgttc cgtgcagtgg tgatggtaca 720

ctgcgcaagg ctccagatat ctggcgcaaa tggaactctg gtatgggcaa tggacttcat 780

agccttcaga ttattcttgc tatgagaggt ttatctctgt tgaaagttgg tgggaagatg 840

atatactcaa cctgctcaat gaacccagtg gaggatgaag ctgttgttgc tgagattcta 900

aggaggtgtg gagactctgt tgaactttta gatgtttccg ataaacttcc tgaacttata 960

cgaagaccag gacttaaggc atggaaggtg cgt 993

<210> 5

<211> 190

<212> DNA

<213>Artificial sequence ()

<400> 5

taatacgact cactataggg ccagtgaatt cgagctcggt acccggggat cctctagaaa 60

tatggattac ttggtagaac agcaatctac tcgacctgca ggcatgaagc ttggcgtaat 120

catggtcata gctgtttcct gtgtttatcc gctcacaatt ccacacaaca tacgagccgg 180

aagcataaag 190

<210> 6

<211> 293

<212> DNA

<213>Artificial sequence ()

<400> 6

cattcggagt ttttgtatct tgtttcatag tttgtcccag gattagaatg attaggcatc 60

gaaccttcaa gaatttgatt gaataaaaca tcttcattct taagatatga agataatctt 120

caaaaggccc ctgggaatct gaaagaagag aagcaggccc atttatatgg gaaagaacaa 180

tagtatttct tatataggcc catttaagtt gaaaacaatc ttcaaaagtc ccacatcgct 240

tagataagaa aacgaagctg agtttatata cagctagagt cgaagtagtg att 293

<210> 7

<211> 883

<212> DNA

<213>Artificial sequence ()

<400> 7

tcaacatggt ggagcacgac acacttgtct actccaaaaa tatcaaagat acagtctcag 60

aagaccaaag ggcaattgag acttttcaac aaagggtaat atccggaaac ctcctcggat 120

tccattgccc agctatctgt cactttattg tgaagatagt ggaaaaggaa ggtggctcct 180

acaaatgcca tcattgcgat aaaggaaagg ccatcgttga agatgcctct gccgacagtg 240

gtcccaaaga tggaccccca cccacgagga gcatcgtgga aaaagaagac gttccaacca 300

cgtcttcaaa gcaagtggat tgatgtgata acatggtgga gcacgacaca cttgtctact 360

ccaaaaatat caaagataca gtctcagaag accaaagggc aattgagact tttcaacaaa 420

gggtgatatc cggaaacctc ctcggattcc attgcccagc tatctgtcac tttattgtga 480

agatagtgga aaaggaaggt ggctcctaca aatgccatca ttgcgataaa ggaaaggcca 540

tcgttgaaga tgcctctgcc gacagtggtc ccaaagatgg acccccaccc acgaggagca 600

tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca agtggattga tgtgatatct 660

ccactgacgt aagggatgac gcacaatccc actatccttc gcaagaccct tcctctatat 720

aaggaagttc atttcatttg gagaggacct cgacctcaac acaacatata caaaacaaac 780

gaatctcaag caatcaagca ttctacttct attgcagcaa tttaaatcat ttcttttaaa 840

gcaaaagcaa ttttctgaaa attttcacca tttacgaacg ata 883

<210> 8

<211> 284

<212> DNA

<213>Artificial sequence ()

<400> 8

tgattgatcg atagagctcg aatttccccg atcgttcaaa catttggcaa taaagtttct 60

taagattgaa tcctgttgcc ggtcttgcga tgattatcat ataatttctg ttgaattacg 120

ttaagcatgt aataattaac atgtaatgca tgacgttatt tatgagatgg gtttttatga 180

ttagagtccc gcaattatac atttaatacg cgatagaaaa caaaatatag cgcgcaaact 240

aggataaatt atcgcgcgcg gtgtcatcta tgttactaga tcgg 284

<210> 9

<211> 5301

<212> DNA

<213>Artificial sequence ()

<400> 9

gccccaaaga agaagcggaa ggtcggtatc cacggagtcc cagcagccgg aaatcttttc 60

ggacataaaa gatggtacga agtgagagat aagaaggatt tcaagattaa gagaaaggtt 120

aaggttaaga ggaattacga tggaaacaag tacattctta atatcaatga gaataacaat 180

aaggaaaaaa ttgataataa taagttcatt aggaaataca tcaactataa aaaaaacgat 240

aatatcctta aggaatttac tagaaagttc catgcaggta acattctttt taaattaaaa 300

ggtaaagagg gaattatcag gatcgaaaat aacgatgatt ttcttgagac tgaggaggtg 360

gtgttgtaca tcgaggcata tggtaagtca gaaaaattaa aggcattggg aatcacaaag 420

aaaaagatca tcgacgaggc tatcaggcaa ggaattacta aggatgataa gaaaatcgag 480

attaaaaggc aggagaacga ggaagagatc gaaatcgata ttagagacga gtatacaaac 540

aagacactta atgattgttc tatcatcctt agaatcattg aaaatgatga acttgaaact 600

aagaagtcaa tctatgagat ctttaagaac attaacatgt cattgtataa gattatcgag 660

aagatcatcg agaacgagac tgagaaggtg ttcgagaata gatattacga agagcatctt 720

agggagaaat tgttgaaaga cgataaaatt gatgttattt tgacaaattt catggaaatt 780

agagagaaaa ttaagtctaa cttggaaatt cttggtttcg ttaagttcta cttgaatgtt 840

ggaggtgaca aaaagaaatc taagaataag aaaatgttgg ttgaaaagat tcttaacatc 900

aatgttgacc ttacagttga agacattgct gatttcgtta ttaaggaatt ggaattttgg 960

aacattacta agagaatcga aaaagttaaa aaagttaaca atgaattttt ggaaaaaaga 1020

aggaatagga cttacatcaa gtcatatgtt cttttggata agcatgagaa atttaagatc 1080

gaaagagaga acaagaaaga taaaattgtg aagttttttg ttgagaacat taagaacaac 1140

tctatcaaag agaaaattga gaagattctt gctgagttta aaatcgacga gttgatcaaa 1200

aagttggaaa aagagttgaa gaagggaaac tgtgatactg aaattttcgg aattttcaaa 1260

aaacattaca aagttaactt cgattctaag aaattctcta agaagtctga tgaggagaag 1320

gagctttaca aaatcatcta tagatacctt aagggaagga ttgaaaagat ccttgttaat 1380

gagcagaagg ttagattgaa gaagatggag aagattgaaa tcgagaaaat ccttaatgag 1440

tcaatccttt cagagaagat ccttaagagg gttaagcagt acactcttga gcatattatg 1500

tatcttggta aattgagaca taatgatatc gatatgacta ctgtgaacac tgatgatttc 1560

tcaagattgc atgcaaagga ggagcttgac ttggagttga ttactttttt cgcttctact 1620

aatatggagt tgaacaagat tttttcccgt gaaaacatca acaacgacga gaacatcgac 1680

ttcttcggtg gagacaggga gaaaaactac gttttggata agaagatttt gaactctaag 1740

attaagatta tcagagattt ggatttcatc gataacaaga acaatatcac taataatttt 1800

attagaaagt tcactaaaat tggaactaat gaagcaaacc gtattttaca cgctatttct 1860

aaggagagag atcttcaggg aactcaagac gattataata aggtgattaa cattatccaa 1920

aatttgaaga tctctgatga agaggtttct aaagctctta atttggatgt ggtgttcaag 1980

gataagaaga atatcattac taaaatcaac gatatcaaaa tttcagagga gaataacaac 2040

gatattaaat acttgccttc tttctctaag gttttgccag aaattcttaa cctttataga 2100

aataacccta agaatgagcc attcgataca attgagacag aaaagattgt tcttaacgca 2160

cttatttatg ttaacaagga gttgtataag aaattaattc ttgaggatga ccttgaagag 2220

aatgaatcaa aaaatatctt ccttcaggag ttgaaaaaga ctcttggtaa cattgatgaa 2280

attgatgaga acatcattga gaattattac aaaaatgctc agatttcagc ttctaagggt 2340

aataacaagg ctattaaaaa atatcaaaag aaggttatcg aatgctacat cggttatctt 2400

agaaaaaatt atgaggaact tttcgacttt tctgacttca aaatgaacat ccaagaaatc 2460

aagaagcaaa tcaaggatat taacgacaat aagacttacg agagaattac tgttaagaca 2520

tctgacaaga ctatcgttat caatgatgat ttcgaataca tcatttctat tttcgcactt 2580

cttaattcta atgctgttat caataaaatc aggaataggt tcttcgctac ttcagtgtgg 2640

cttaacacat ctgagtacca gaatatcatc gatatccttg atgagatcat gcagcttaat 2700

actttgagaa atgaatgtat tacagagaac tggaacttga atcttgagga gttcattcaa 2760

aagatgaagg agatcgagaa ggattttgat gattttaaaa ttcagactaa gaaggaaatt 2820

tttaacaact attacgagga tatcaaaaac aatattctta cagagtttaa ggatgatatt 2880

aacggttgtg atgttcttga aaagaaatta gagaagattg ttatttttga tgacgaaact 2940

aaatttgaaa ttgacaaaaa gtctaatatt cttcaagacg agcagagaaa gttgtctaat 3000

atcaataaga aggacttgaa gaagaaagtg gatcagtata ttaaagataa ggatcaagaa 3060

atcaaatcta aaatcctttg taggatcatc ttcaactctg actttttgaa gaagtataaa 3120

aaggagatcg ataatttgat tgaagatatg gaatctgaaa atgagaacaa gtttcaggaa 3180

atctactatc ctaaagagag aaaaaacgaa ttgtacatct ataagaaaaa cctttttttg 3240

aatattggta atccaaattt tgataaaatc tacggactta tttctaacga cattaagatg 3300

gcagatgcta agttcctttt taatatcgat ggaaagaata tcagaaaaaa taaaatctct 3360

gaaatcgacg ctattcttaa gaacttgaac gacaaattga acggatattc taaggagtat 3420

aaggaaaagt acattaaaaa attgaaggaa aatgatgatt tttttgcaaa gaacatccaa 3480

aacaaaaatt acaagtcttt tgagaaggat tataacagag tgtctgaata taaaaaaatc 3540

agggatcttg tggaatttaa ctatttgaat aaaattgaat cttaccttat tgatatcaac 3600

tggaaattag ctatccagat ggcaagattc gagagggaca tgcactacat cgtgaacgga 3660

cttagggaac ttggtattat caaattgtct ggatacaaca caggtatctc ccgtgcatac 3720

cctaagagga atggatctga tggattctac acaacaactg cttactataa gttctttgat 3780

gaggaatcat ataaaaagtt cgagaagatt tgctacggtt tcggtatcga tctttctgaa 3840

aattctgaga tcaacaagcc tgagaacgaa tctattagaa actacatctc tcatttttat 3900

atcgtgagaa atccattcgc tgattattct atcgctgagc aaatcgatag agtttcaaat 3960

cttttgtctt actctactag gtataacaac tctacatacg cttctgtttt cgaagttttt 4020

aagaaggacg ttaaccttga ttatgatgaa cttaagaaaa agttcaagtt gattggaaat 4080

aacgatatct tggagagatt gatgaaacca aagaaagttt ctgttttgga acttgagtct 4140

tataactctg attacatcaa aaaccttatt attgaacttt tgacaaagat tgagaatact 4200

aatgatactc tttctggatc tgagactcct ggaacttctg agtctgctac tcctgagtct 4260

ttcgaggaat attacaagaa acaagggata gtgaaagctg aagagtggga tttgttcatg 4320

gagattcttc gtaagccttt acctgctgcg tttagggtta actccaatgg ccaattttgc 4380

gatgagatta tatcgatctt ggagaatgac tttatgaaat cacttcaggc tgaggccata 4440

gaaggtggtg aattggaggc tattaagccc ttgccttggt atccaaagaa tctcgcttgg 4500

cattctaatt tttctcgaaa ggagataaga aaaaatcaga cacttgagag gtttcatgag 4560

tttctgaagt tagaaaatga agttggaaat attactaggc aggaagctgt tagcatggta 4620

cctcctctct tcctagacgt acatccagat catttcgtac ttgacatgtg tgctgcaccg 4680

ggttccaaaa catttcagct gcttgagatt atacatgaag catcagaacc aggatctctt 4740

cctaatggat tggtggtggc taatgatgtt gattttaaaa gatctaacct tctcattcac 4800

caaacaaaga gaatgtgcac atccaacttg atagtgacaa atcatgaagg gcaacagttt 4860

cctggttgcc gtttgaacaa atcccgagct tctgagaaag gaataagtga aaatatgcct 4920

attaatcaac ttgcctttga ccgtgttcta tgcgatgttc cgtgcagtgg tgatggtaca 4980

ctgcgcaagg ctccagatat ctggcgcaaa tggaactctg gtatgggcaa tggacttcat 5040

agccttcaga ttattcttgc tatgagaggt ttatctctgt tgaaagttgg tgggaagatg 5100

atatactcaa cctgctcaat gaacccagtg gaggatgaag ctgttgttgc tgagattcta 5160

aggaggtgtg gagactctgt tgaactttta gatgtttccg ataaacttcc tgaacttata 5220

cgaagaccag gacttaaggc atggaaggtg cgtaaaaggc cggcggccac gaaaaaggcc 5280

ggccaggcaa aaaagaaaaa g 5301

<210> 10

<211> 4152

<212> DNA

<213>Artificial sequence ()

<400> 10

atggactata aggaccacga cggagactac aaggatcatg atattgatta caaagacgat 60

gacgataagg ccccaaagaa gaagcggaag gtcggtatcc acggagtccc agcagccaat 120

attccagctt tggttgaaaa ccaaaagaaa tattttggaa cttactcagt tatggctatg 180

ttgaatgcac aaactgttct tgatcatatt cagaaggttg cagacataga gggtgagcag 240

aacgagaaca atgagaacct ttggttccat ccagttatgt cacatcttta caatgctaaa 300

aatggttatg ataagcagcc agaaaaaact atgtttatta ttgagagact tcaatcatac 360

tttcctttcc ttaagattat ggctgaaaac cagagagaat actctaatgg aaagtataag 420

caaaacagag ttgaggttaa ttcaaatgac atatttgagg ttttgaagag agctttcggt 480

gttttgaaaa tgtatagaga cttgactaat gcttataaaa catatgagga aaagttgaac 540

gacggatgtg agttccttac ttctactgag cagccacttt ctggtatgat taacaactat 600

tacactgttg ctttgagaaa tatgaatgaa agatatggtt ataaaacaga ggaccttgct 660

tttattcaag acaagagatt taagtttgtt aaagatgctt atggtaaaaa gaagtcacaa 720

gttaacactg gtttcttcct ttcattgcaa gactataacg gagatactca aaaaaagttg 780

catttgtctg gtgtgggaat agcattgctt atttgccttt ttttggataa gcaatacatt 840

aatatttttt tgtctagatt gcctatattt tcatcttata atgctcagtc tgaagaaagg 900

aggattatta ttagatcatt tggaataaac tctattaaat tgcctaaaga taggattcat 960

tctgaaaagt ctaataagtc agttgcaatg gatatgttga acgaagtgaa gaggtgcccc 1020

gatgaacttt ttactacttt gtcagctgaa aaacaatcta ggtttaggat tatttctgat 1080

gatcataatg aagttcttat gaagcgttct tctgataggt ttgttccact tcttcttcaa 1140

tatatagact acggaaagtt gtttgaccac attaggttcc acgttaacat gggaaaactt 1200

agatatttgt tgaaggctga taagacatgt attgacggtc aaactagggt tagggttatt 1260

gagcagccat tgaacggatt cggtagactt gaggaggcag agactatgag gaagcaagaa 1320

aacggaactt tcggaaattc tggtattagg attagggatt ttgaaaatat gaagagggat 1380

gacgctaacc cagctaacta cccatatatt gttgatacat acacacatta cattcttgag 1440

aataacaagg ttgagatgtt tattaatgat aaggaggact ctgctccatt gcttccagtg 1500

attgaagatg atagatacgt tgttaagact ataccttcat gtagaatgtc tactcttgag 1560

attcccgcta tggcttttca tatgtttctt tttggttcta agaaaacaga aaagttgatt 1620

gttgacgttc ataatagata taagagattg ttccaagcta tgcagaagga ggaggtgaca 1680

gctgagaaca ttgcatcttt cggaatagca gagtctgatt tgcctcagaa aattttggat 1740

cttatttctg gaaatgcaca cggtaaggac gtggacgctt tcattaggtt gacagttgat 1800

gatatgctta ctgacactga gagaagaatt aagaggttta aagatgatag gaaatcaatt 1860

aggtctgctg acaacaaaat gggaaaaagg ggattcaagc aaatttctac tggaaagttg 1920

gcagactttt tggctaaaga catagttttg tttcaaccat ctgttaatga tggagagaac 1980

aagattactg gtcttaacta tcgtattatg caatctgcta ttgctgtgta cgactctggt 2040

gacgattacg aggcaaagca acagttcaaa ttaatgtttg aaaaggctag attgattgga 2100

aagggaacta ctgagcctca ccctttcttg tataaagtgt ttgcaaggtc aattcccgct 2160

aatgctgttg agttctacga aaggtatctt attgaaagaa aattttatct tactggtctt 2220

tctaatgaaa ttaaaaaggg taatagagtg gacgtgccat tcattaggag ggaccagaac 2280

aagtggaaaa ctcccgctat gaaaactctt ggaagaattt actctgagga ccttccagtt 2340

gagcttccta ggcaaatgtt tgacaacgag attaaatctc atcttaagtc attgcctcaa 2400

atggagggta ttgatttcaa taatgcaaat gtgacttatc ttattgctga atacatgaaa 2460

agggttttgg atgacgattt ccagacattt tatcaatgga ataggaatta tagatatatg 2520

gatatgctta agggagagta cgatcgtaag ggttctcttc agcactgctt cacttctgtg 2580

gaggaaaggg agggtttgtg gaaggagagg gcttctagga cagaaaggta tcgtaagcaa 2640

gcctctaata agataagatc taatcgtcag atgaggaacg catcatcaga ggaaattgag 2700

actattcttg ataaaagact ttctaattca aggaacgaat atcaaaaatc tgagaaggtt 2760

attagaagat atcgtgttca agatgcattg cttttcttgc ttgctaaaaa gactttgaca 2820

gaattggctg actttgatgg agaaaggttt aagttgaaag agataatgcc agacgcagag 2880

aagggaattt tgtctgaaat tatgcctatg tcatttacat ttgagaaagg tggaaagaag 2940

tacactatta catctgaggg aatgaaactt aaaaattacg gagatttttt cgttcttgca 3000

tctgataaga gaattggtaa tttgcttgag ttggttggtt ctgatattgt ttcaaaggaa 3060

gattctggat ctgagactcc tggaacttct gagtctgcta ctcctgagtc tttcgaggaa 3120

tattacaaga aacaagggat agtgaaagct gaagagtggg atttgttcat ggagattctt 3180

cgtaagcctt tacctgctgc gtttagggtt aactccaatg gccaattttg cgatgagatt 3240

atatcgatct tggagaatga ctttatgaaa tcacttcagg ctgaggccat agaaggtggt 3300

gaattggagg ctattaagcc cttgccttgg tatccaaaga atctcgcttg gcattctaat 3360

ttttctcgaa aggagataag aaaaaatcag acacttgaga ggtttcatga gtttctgaag 3420

ttagaaaatg aagttggaaa tattactagg caggaagctg ttagcatggt acctcctctc 3480

ttcctagacg tacatccaga tcatttcgta cttgacatgt gtgctgcacc gggttccaaa 3540

acatttcagc tgcttgagat tatacatgaa gcatcagaac caggatctct tcctaatgga 3600

ttggtggtgg ctaatgatgt tgattttaaa agatctaacc ttctcattca ccaaacaaag 3660

agaatgtgca catccaactt gatagtgaca aatcatgaag ggcaacagtt tcctggttgc 3720

cgtttgaaca aatcccgagc ttctgagaaa ggaataagtg aaaatatgcc tattaatcaa 3780

cttgcctttg accgtgttct atgcgatgtt ccgtgcagtg gtgatggtac actgcgcaag 3840

gctccagata tctggcgcaa atggaactct ggtatgggca atggacttca tagccttcag 3900

attattcttg ctatgagagg tttatctctg ttgaaagttg gtgggaagat gatatactca 3960

acctgctcaa tgaacccagt ggaggatgaa gctgttgttg ctgagattct aaggaggtgt 4020

ggagactctg ttgaactttt agatgtttcc gataaacttc ctgaacttat acgaagacca 4080

ggacttaagg catggaaggt gcgtaaaagg ccggcggcca cgaaaaaggc cggccaggca 4140

aaaaagaaaa ag 4152

<210> 11

<211> 717

<212> DNA

<213>Artificial sequence ()

<400> 11

gtgagcaagg gcgaggagct gttcaccggg gtggtgccca tcctggtcga gctggacggc 60

gacgtaaacg gccacaagtt cagcgtgtcc ggcgagggcg agggcgatgc cacctacggc 120

aagctgaccc tgaagttcat ctgcaccacc ggcaagctgc ccgtgccctg gcccaccctc 180

gtgaccacct tcacctacgg cgtgcagtgc ttcagccgct accccgacca catgaagcag 240

cacgacttct tcaagtccgc catgcccgaa ggctacgtcc aggagcgcac catcttcttc 300

aaggacgacg gcaactacaa gacccgcgcc gaggtgaagt tcgagggcga caccctggtg 360

aaccgcatcg agctgaaggg catcgacttc aaggaggacg gcaacatcct ggggcacaag 420

ctggagtaca actacaacag ccacaacgtc tatatcatgg ccgacaagca gaagaacggc 480

atcaaggtga acttcaagat ccgccacaac atcgaggacg gcagcgtgca gctcgccgac 540

cactaccagc agaacacccc catcggcgac ggccccgtgc tgctgcccga caaccactac 600

ctgagcaccc agtccgccct gagcaaagac cccaacgaga agcgcgatca catggtcctg 660

ctggagttcg tgaccgccgc cgggatcact cacggcatgg acgagctgta caagtga 717

<210> 12

<211> 2424

<212> DNA

<213>Artificial sequence ()

<400> 12

atgggaagag gaggaagaca tagaggtcgt actcagagaa aagatttcaa agaaagcaga 60

gagaatgttt ggaaacgacc caaatccgat gcttccgttg atggttccga caacgccgta 120

ccggaacaaa aacccacttg ggaacctatt gtcactgtta accctaactt cgaggaatat 180

tacaagaaac aagggatagt gaaagctgaa gagtgggatt tgttcatgga gattcttcgt 240

aagcctttac ctgctgcgtt tagggttaac tccaatggcc aattttgcga tgagattata 300

tcgatcttgg agaatgactt tatgaaatca cttcaggctg aggccataga aggtggtgaa 360

ttggaggcta ttaagccctt gccttggtat ccaaagaatc tcgcttggca ttctaatttt 420

tctcgaaagg agataagaaa aaatcagaca cttgagaggt ttcatgagtt tctgaagtta 480

gaaaatgaag ttggaaatat tactaggcag gaagctgtta gcatggtacc tcctctcttc 540

ctagacgtac atccagatca tttcgtactt gacatgtgtg ctgcaccggg ttccaaaaca 600

tttcagctgc ttgagattat acatgaagca tcagaaccag gatctcttcc taatggattg 660

gtggtggcta atgatgttga ttttaaaaga tctaaccttc tcattcacca aacaaagaga 720

atgtgcacat ccaacttgat agtgacaaat catgaagggc aacagtttcc tggttgccgt 780

ttgaacaaat cccgagcttc tgagaaagga ataagtgaaa atatgcctat taatcaactt 840

gcctttgacc gtgttctatg cgatgttccg tgcagtggtg atggtacact gcgcaaggct 900

ccagatatct ggcgcaaatg gaactctggt atgggcaatg gacttcatag ccttcagatt 960

attcttgcta tgagaggttt atctctgttg aaagttggtg ggaagatgat atactcaacc 1020

tgctcaatga acccagtgga ggatgaagct gttgttgctg agattctaag gaggtgtgga 1080

gactctgttg aacttttaga tgtttccgat aagcttcctg aacttatacg aagaccagga 1140

cttaaggcat ggaaggtgcg tgataaaggt gggtggttta cttcttacaa agatgttcca 1200

caaaaccgga gaggtggagt tcttgtgagc atgtttcctt ctgggaaata cctcaaggac 1260

tcaactgaaa ccacggaaaa gaacgagaat ggtgatgtta atggctgtga ggatggactc 1320

aaagaaacag atatttctgt ggtggatgct actcctgaag aacaagctga ggaagtctct 1380

gatcttccac ttgaacgttg catgaggata atacctcatg atcagaacac cggagccttc 1440

ttcattgcgg tccttcaaaa aaaatctccc ttaccagaat ttcaggagaa accaaatacg 1500

aaaaggaact caactgctaa gtctactgac tcgacagaaa agtctccgag taaagaatct 1560

gttgttacag tggatgctgg tgtaccagat gagagtgcag tggagaaagt tattgaagca 1620

gattcaaaca ttgagaaaaa tgatagcttg gagcctgaga agaaaatcac agaaggagaa 1680

agcatcacgg aagataaaga ggccaattcg agtaatgcgg gaggcaagag aaaagtaccg 1740

atgcaaggga agtggaaagg ctttgaccca gttgttttcg tgaaagatga aacagtaatc 1800

aatggcatca aggaattcta cggtatcaaa gatgaatcat ttccattaca tggtcatctc 1860

gtggcaagaa acaccgacac aagcagcgtt aagaggattt actatgtttc aaaatcagtt 1920

aaggaagttc ttcagttgaa ttttgcagtc gggcagcagc ttaagatcgc ttctgttggc 1980

ctcaaaatgt ttgagagaca atcggcaaaa gaaggttcaa gcacgctgtg cccattccgt 2040

atatcatccg agggactacc tgtgattctt ccatacatta ccaaacaagt actttatact 2100

ccaatggcag acttcaaact tctcctgcaa gacaaatcaa tcaagtttca cgattttgtc 2160

aatccacagt tggcccagaa agcaactgac cttgttatgg gaagctgcgt ggtgattctc 2220

agcgatggtg aagtaccggt gaaagcggat gcatcaacaa ttgccatcag ttgctggaga 2280

gggaaggcta gtttggctgt tatggccact gtcgcagatt gccaggagct gctagagaga 2340

tttgccgaga aaacaccaaa aacagaaggt ggttcggtaa atggaagcaa cggcgattcg 2400

gacggtccac tagctatgga gact 2424

<210> 13

<211> 1155

<212> DNA

<213>Artificial sequence ()

<400> 13

cagcttcatt tgccacaggt tcttgctgat gctgtgtcta ggcttgtgtt gggtaagttt 60

ggtgatttga cagataattt ctcttcacct cacgctagga gaaaagtgct tgctggagtg 120

gtgatgacta ctggaactga cgtgaaggac gcaaaggtga tttctgtttc tactggtggt 180

aagtgcatta acggagagta catgtcagat aggggattgg ctcttaatga ttgtcatgct 240

gaaattattt ctagaagatc tttgcttagg ttcttgtata cacagttgga actttatctt 300

aataataagg acgatcaaaa aaggtctatt tttcagaagt ctgagagggg aggttttcgt 360

cttaaggaaa acgttcagtt tcacttgtat atttctactt caccatgtgg tgacgctagg 420

attttttcac cacacgagcc tattcttgag gagcccgctg atagacaccc aaatcgtaag 480

gctaggggac agcttaggac taaaattgaa tctggacaag gaactattcc agttagatct 540

aatgcatcaa ttcagacttg ggatggtgtg ttgcaaggtg agaggctttt gactatgtca 600

tgctcagaca agatagctag gtggaacgtg gtgggtattc aaggttcttt gttgtctatt 660

tttgttgaac caatttattt ttcttctatt attttgggat ctctttatca tggtgatcat 720

ctttctaggg ctatgtatca aagaatttct aatattgaag atttgccacc actttatact 780

cttaataagc ctcttctttc tggaatttca aacgctgagg ctaggcaacc cggtaaggct 840

ccaaacttct ctgtgaactg gactgtggga gattcagcta tagaggtgat taacgcaact 900

actggtaagg atgagcttgg tagggcttct aggttgtgca agcacgcatt gtactgtagg 960

tggatgaggg ttcacggtaa ggttccatct cacttgttga ggtctaagat tacaaaacct 1020

aacgtttacc acgagtcaaa gttggctgct aaggagtacc aagctgcaaa ggcaaggctt 1080

ttcactgcat tcattaaggc tggtcttgga gcttgggtgg agaagccaac tgaacaagat 1140

cagttttctt tgaca 1155

<210> 14

<211> 718

<212> DNA

<213>Artificial sequence ()

<400> 14

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctagcccacc 180

ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct gtacaagt 718

Claims (8)

1. a kind of system of plant RNA modification and editor, it is characterised in that：There is RNA modifications and editor's work(including targeted rna The recombinant nucleic acid enzyme of energy and its gRNA of targeted rna.

2. the system of a kind of plant RNA modification and editor according to claim 1, it is characterised in that：The recombinant nucleic acid Enzyme be by the nuclease dCas13a and dPspCas13b without cleavage activity of targeted rna respectively with methyl transferase domains and Adenine deaminase is merged, the recombinant nucleic acid enzyme dCas13a-RsmB with methyl transferase activity of formation with DPspCas13b-RsmB and have the active recombinant nucleic acid enzyme dPspCas13b-hADAR of adenine deaminase.

3. a kind of method of plant RNA modification and editor, it is characterised in that：It is repaiied using plant RNA as claimed in claim 1 or 2 Decorations and editing system, the enzyme of corresponding function is directed on corresponding RNA, realizes modification and the editor of plant RNA.

4. the method for a kind of plant RNA modification and editor as claimed in claim 3, it is characterised in that：Utilize the recombinant nuclear Sour enzyme carries out the deamination of cytosine base to methylate with adenine base at target site, the final m5C first for realizing plant RNA Baseization is modified and A is converted to I.

5. the method for a kind of plant RNA modification and editor as claimed in claim 4, it is characterised in that：The plant RNA is repaiied Decorations method includes establishing RNAm5C to methylate the vitro expression systems of modification；The vitro expression systems utilize prokaryotic expression system The expression of external albumen is carried out, the fusion egg of the dCas13a-RsmB with His and Msb labels and dPspCas13b-RsmB is obtained In vain, and methylating in vitro reaction system is established.

6. the method for a kind of plant RNA modification and editor as claimed in claim 4, it is characterised in that：The plant RNA is repaiied Decorations method includes establishing RNAm5C to methylate the internal expression system of modification；The internal expression system is utilized respectively AtU6 startups The expression of son driving gRNA, the expression of dCas13a-RsmB and dPspCas13b-RsmB is driven using 35S promoter, in plant Pointed decoration experiment is carried out in vivo.

7. the method for a kind of plant RNA modification and editor as claimed in claim 4, it is characterised in that：The volume of the plant RNA The method of collecting includes the reporting system for the dGFP for establishing premature translation termination, the identification for its fixed point editor.

8. the method for a kind of plant RNA modification and editor as claimed in claim 7, it is characterised in that：The volume of the plant RNA Volume method is by the A base transitions at the sites Premature stop codon TAG that are catalyzed on the RNA of dGFP for hypoxanthine I, I will be with C base pairings during translation, and to make terminator codon TAG revert to TGG, GFP albumen is normally turned over It translates；Transient expression is carried out in plant, by observing the green fluorescence of GFP, to judge the effect of RNA fixed point editors.