CN106046175B - Fusion protein for specifically detecting Salicylic Acid (SA) - Google Patents
Fusion protein for specifically detecting Salicylic Acid (SA) Download PDFInfo
- Publication number
- CN106046175B CN106046175B CN201610442983.3A CN201610442983A CN106046175B CN 106046175 B CN106046175 B CN 106046175B CN 201610442983 A CN201610442983 A CN 201610442983A CN 106046175 B CN106046175 B CN 106046175B
- Authority
- CN
- China
- Prior art keywords
- sequence
- fusion protein
- protein
- gene
- ubiquitin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/60—Fusion polypeptide containing spectroscopic/fluorescent detection, e.g. green fluorescent protein [GFP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/60—Vectors containing traps for, e.g. exons, promoters
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/36—Vector systems having a special element relevant for transcription being a transcription termination element
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Food Science & Technology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a fusion protein for specifically detecting Salicylic Acid (SA), wherein the fusion protein comprises protein coded by DNA sequence of ubiquitin-26 s proteasome degradation element region in NPR1 gene and fluorescent protein, wherein the fusion protein can be specifically induced and degraded by SA. The fusion protein is encoded or expressed by the gene of the ubiquitin-26 s proteasome degradation element of NPR1 and the fluorescent protein gene. By using the fusion protein, SA in plants can be detected.
Description
Technical Field
The invention relates to a fusion protein for reflecting salicylic acid level and change thereof in living plants and a carrier for expressing the fusion protein in the field of biotechnology.
Background
Salicylic Acid (SA) is a simple small-molecular phenolic compound ubiquitous in plants, and is a derivative of cinnamic acid, with the chemical name of "o-hydroxybenzoic acid". SA was first found in the leaves and bark of willow, and rafvae Piria named this active ingredient salicylic acid in 1838. Since SA is synthesized by plants themselves, has a low content, is transported in phloem, and plays an important regulatory role in growth and development processes such as plant thermogenesis, flowering, lateral bud germination, sex differentiation, and the like, it has been identified as a phytohormone.
The SA exists in a plant body mainly in a free state and a combined state, the combined state SA is formed by combining the free SA and glucose to form inactive salicylic acid-2-O- β -glucoside (SAG), exists in cells, and can prevent toxic effects of a large amount of free SA on plant cells.
The successive research shows that SA not only can regulate certain growth and development processes of plants, but also can activate important endogenous signal molecules of plant allergic reaction (HR) and Systemic Acquired Resistance (SAR), and is related to plant salt resistance, drought resistance, heat resistance, heavy metal stress and the like. In addition, SA is commonly used in agriculture for preserving flowers, delaying fruit ripening and improving the rate of good fruits. The relation between SA and plant stress resistance is always a research hotspot, and at present, it is clear that SA can be used as a signal molecule required by plant disease resistance to activate a plant defense protection mechanism and plays a key role in plant signal conduction and stress resistance.
At present, domestic reported methods for measuring SA comprise an ultraviolet spectrophotometry method, an ion chromatography method and a chromatography-mass spectrometry combined method, mainly used for measuring the SA content in wastewater, food and medicines, and few methods are used for extracting and measuring a plant sample. The foreign literature mainly adopts High Performance Liquid Chromatography (HPLC) to analyze the SA level in a plant sample, and the determination is influenced by many factors such as HPLC mobile phase, detector and the like, and more importantly, SA in living plants cannot be monitored in real time.
Real-time monitoring of salicylic acid levels in living plants is a necessary prerequisite for the intensive study of its action and disease-resistant mechanisms.
Disclosure of Invention
In order to solve the technical problems, the invention aims to provide a method for reflecting the salicylic acid level in a plant body in real time and a fusion protein and an expression vector special for detecting SA in the plant body.
In one aspect, the present invention provides a fusion protein comprising a protein encoded by a gene of ubiquitin-26 s proteasome degradation element of NPR1 and a protein encoded by a fluorescent protein gene. Or the fusion protein is coded by the gene of the ubiquitin-26 s proteasome degradation element of NPR1 and the fluorescent protein gene, and is expressed. The fusion protein can be specifically and specifically degraded by SA, on the contrary, the SA can not independently degrade the protein coded by the fluorescent protein gene or the protein coded by the ubiquitin-26 s proteasome degradation element of NPR1, namely, the protein coded by the ubiquitin gene of NPR1 or the protein coded by the fluorescent protein gene can not be degraded by the SA induction.
In some preferred modes, the fusion protein is expressed by transferring a plasmid vector into an expression vector. Preferably, the structure of the plasmid vector comprises, in order from left to right: T-DNA right border element sequence-35S promoter element sequence-first enzyme cutting site-target gene sequence-second enzyme cutting site-first connector sequence-fluorescent sequence-second connector sequence-cell nucleus localization protein (NLS) sequence-terminator sequence-35S promoter sequence-T-DNA left border sequence.
In another aspect, the present invention provides a plasmid vector for detecting the level of SA in a plant in real time by inoculating the plasmid vector into the plant, wherein the plasmid vector comprises the following structure from right to left: T-DNA right border element sequence-35S promoter element sequence-first enzyme cutting site-target gene sequence-second enzyme cutting site-first connector sequence-fluorescent sequence-second connector sequence-cell nucleus localization protein (NLS) sequence-terminator sequence-35S promoter sequence-T-DNA left border sequence.
On the other hand, the method for detecting the salicylic acid level in the plant body provided by the invention constructs a gene segment containing ubiquitin-26 s proteasome degradation elements of SA response protein NPR1 derived from tomatoes into a plant expression vector to form a vector capable of expressing the Venus YFP fusion protein induced and degraded by SA, and the recombinant vector is transferred into the expression vector (such as agrobacterium); infiltrating the agrobacterium with a plant; and observing the reaction of the fusion protein to the SA mediated fusion protein expression by adopting a fluorescence confocal microscope at 48 hours, and detecting the level of the plant salicylic acid by adopting the fluorescence confocal microscope. The plant expression vector comprises the following structures from right to left: T-DNA right border element sequence-35S promoter element sequence-first enzyme cutting site-target gene sequence-second enzyme cutting site-first connector sequence-fluorescent sequence-second connector sequence-cell nucleus localization protein (NLS) sequence-terminator sequence-35S promoter sequence-T-DNA left border sequence.
In some preferred embodiments of all the above embodiments, the T-DNA left border element sequence is SeqID No. 7.
In some preferred embodiments of all the above embodiments, the sequence of the right border element of the T-DNA is SeqID No. 8.
In some preferred embodiments of all the above embodiments, the 35S promoter element sequence is SeqID No. 9.
In some preferred embodiments of all the above embodiments, the first linker sequence is Seq ID No: 10.
In some preferred embodiments of all of the above embodiments, the fluorescent protein has the sequence shown as Seq ID No: 11.
In some preferred embodiments of all of the above embodiments, the second linker sequence is shown as Seq ID No: 12.
In some preferred embodiments of all the above embodiments, the sequence of nuclear localization protein (NLS) is SeqID No: 13.
In some preferred embodiments of all the above embodiments, the Bar sequence is shown as Seq ID No: 14.
In some preferred embodiments of all of the above embodiments, the terminator sequence is shown as Seq ID No: 15.
In some preferred forms of all the above embodiments, the first enzyme cleavage site is an AgeI cleavage site; the second enzyme cutting site is SpeI enzyme cutting site.
In some preferred embodiments of all the above embodiments, the gene of the ubiquitin-26 s proteasome degradation element of NPR1 is Seq ID No: 5. The amino acid sequence Seq ID No. 6 of the ubiquitin-26 s proteasome degradation element of NPR1 is shown.
The invention provides a construction method for preparing an expression vector for detecting the salicylic acid level in a plant body, which comprises the following steps:
1) obtaining a coding gene sequence of NPR1 degradation elements from tomatoes, carrying out PCR amplification by taking tomato cDNA as a template and a primer pair IKB-F1/IKB-R1, wherein the IKB-F1/IKB-R1 is Seq ID No.1 and the Seq ID No. 2; the amplified PCR product was purified and sequenced to obtain the full sequence with a length of 120bp (Seq ID No: 5).
2) Amplifying the coding gene of the NPR1 ubiquitin-26 s proteasome degradation element obtained in the step 1 by using a primer pair IKB-F2/IKB-R2 as a template; the primer pair IKB-F2 (with Age1 restriction site NPR1 ubiquitin-26 s proteasome degradation element 5 '-end amplification forward primer/IKB-F1 (with Spe1 restriction site NPR1 ubiquitin-26 s proteasome degradation element 3' -end amplification reverse primer) is Seq ID No:3, and is shown in Seq ID No: 3;
3) and (3) carrying out enzyme digestion on the amplified target fragment purified in the step (2) by adopting SpeI and AgeI, and connecting the amplified target fragment with pjp743 vector subjected to double enzyme digestion by SpeI and AgeI, wherein the connection system and the steps are as follows: reacting by using a 10 mu L system, wherein 10 XLigase Buffer is 1 mu L, the SpeI and AgeI double-enzyme digestion linearization cloning vector pjp743120ng, the NPR1 ubiquitin-26 s proteasome degradation element fragment is 120ng, the Ligase is 0.4 mu L, and finally, ddH is used2Adjusting the system to 10 mu L, and gently mixing the components; reacting at 16 deg.C for 30 min; immediately placing the reaction tube in an ice water bath after the reaction is finished, and cooling for 5 min; then transferring the ligation product into escherichia coli, selecting clones with full-length insertion, and screening out 1 clone with an NPR1 ubiquitin-26 s proteasome degradation element gene sequence by sequencing; extracting the clone containing NPR1 ubiquitin-26 s proteasome degradation element plasmid; it is introduced into agrobacterium strain GV3101 by electric shock method to become a (GV3101) strain which can express Venus YFP fusion protein of SA induced degradation.
Advantageous effects
The level of salicylic acid in plants can be determined by introducing an expression vector containing the NPR1 degradation element into plants and observing the expression level of GFP under a confocal microscope. When no SA is accumulated in the plant body, strong green fluorescence can be seen in cell nucleus; when SA accumulates in the plant, the yellow fluorescence in the nucleus is quenched. Compared with the traditional methods such as ultraviolet spectrophotometry, ion chromatography, liquid chromatography and the like, the method for detecting the salicylic acid level in the plant body by the expression vector is simple and convenient to operate, has good repeatability, can be effectively used for researching and analyzing the disease-resistant defense reaction of the salicylic acid in the plant, can detect the salicylic acid on a living plant in real time, does not use the traditional extraction treatment process, and can reflect the real-time dynamics of SA in the plant body more truly.
Drawings
FIG. 1 is a schematic diagram of construction of an expression vector containing NPR1 ubiquitin-26 s proteasome degradation element; wherein pjp748 is a carrier structure containing a correct ubiquitin-26 s proteasome degradation element of NPR1, and pjp749 is a schematic carrier structure containing a mutated ubiquitin-26 s proteasome degradation element of NPR 1.
FIG. 2 is a graph showing the results of the fluorescence change with different SA concentrations in Tassemia benthamiana leaves after the expression of the fusion protein containing NPR1 ubiquitin-26 s proteasome degradation element (top is labeled as confocal microscope channel, right side is SA concentration).
FIG. 3 is a partial result graph of fluorescence in Tassemia benthamiana leaves after fusion protein table containing mutated NPR1 ubiquitin-26 s proteasome degradation element, which does not change with SA (top labeled confocal microscopy channel, right side SA concentration).
Detailed Description
The examples provided herein were performed according to conventional experimental conditions, wherein the primer sequences used are shown in Table 1.
TABLE 1 amplification of coding gene sequence of NPR1 degradation element and vector construction primer
Description of primer sequences in 4:
seq ID No.1 information: NPR1 ubiquitin-26 s proteasome degradation element 5' -end amplification forward primer;
seq ID No.2 information: NPR1 ubiquitin-26 s proteasome degradation element 3' -end amplification reverse primer;
seq ID No.3 information: the amplification forward primer is provided with an Age1 enzyme cutting site NPR1 ubiquitin-26 s proteasome degradation element 5' -end;
seq ID No.4 information: the 3' -end amplification reverse primer is provided with a Spe1 enzyme cutting site NPR1 ubiquitin-26 s proteasome degradation element;
seq ID No.16 information: NPR1 ubiquitin-26 s proteasome degradation element 5' -end amplification forward primer with Age1 enzyme cutting site mutation.
Example 1: cloning and determination of NPR1 ubiquitin-26 s proteasome degradation element
The primer pair IKB-F1(Seq ID No:1)/IKB-R1(Seq ID No:2) and the sequence of the degradation element of the tomato NPR1 gene ubiquitin-26 s are amplified, and the PCR amplification system is as follows: mu.L DEPC water, 25. mu.L 2 XPCR Buffer for KOD FXNeo, 10. mu.L 2mM dNTPs, 1.5. mu.L each of upstream and downstream primers ((10. mu.M each of each), 2. mu.L cDNA template, 1. mu.L KOD FX Neo polymerase. the reaction conditions for each fragment of 50. mu.L. were 94 ℃ for 2min, 94 ℃ for 15s,60 ℃ for 30s,68 ℃ for 45s,35 cycles, 68 ℃ for 10 min. the amplified PCR product was purified and then sequenced to obtain the complete sequence with a length of 120bp (Seq ID No: 5).
Example 2: construction and detection of NPR1 ubiquitin-26 s proteasome degradation element YFP fusion protein and mutant vector thereof
Stator
The primer pair IKB-F2/IKB-R2 was designed according to the complete sequence obtained in example 1. Using the DNA of example 1 as a template, the amplification was carried out using the primer pair IKB-F2/IKB-R2. Cutting the purified amplified target fragment by using SpeI and AgeI, connecting the cut fragment with pjp743 vector cut by SpeI and AgeI, adopting 10 muL system to react, wherein 10 XLigase Buffer 1 muL, SpeI and AgeI double-cut linearized cloning vector pjp743120ng, NPR1 ubiquitin-26 s proteasome degradation element fragment 120ng, Ligase0.4 muL, and finally using ddH2Adjusting the system to 10 mu L, and gently mixing the components. The reaction mixture was left at 16 ℃ for 30 min. Immediately placing the reaction tube in ice water bath after the reaction is finished, cooling for 5min, and finally obtaining the transformation plasmid vector, wherein the structure of the vector is as shown in figure 1 (the sequence of the main structural unit forming the vector is shown in the figure and the gene sequence table). The ligation products were then transferred into E.coli Mach1 (purchased from all-grass gold), clones with full-length insertions were selected, and 1 clone with the correct gene sequence of the NPR1 ubiquitin-26 s proteasome degradation element was screened by sequencing. The plasmid containing the NPR1 ubiquitin-26 s proteasome degradation element was extracted, and the vector constructed by this strategy was named pjp748 (FIG. 1). It was introduced into Agrobacterium strain GV3101 by electroporation to form a (GV3101) strain that can express the Venus YFP fusion protein with SA-induced degradation. The amino acid sequence of the NPR1 ubiquitin-26 s proteasome degradation element is SEQ, NO: and 6.
By the same method, NPR1 ubiquitin-26 s proteasome degradation element mutation primer mIKB-F2 is designed. The method is shown in the following steps of shown in SEQ ID NO: the DNA shown in FIG. 17 was used as a template (mutant DNA) and amplified with a primer pair mIKB-F2/IKB-R2 (Table 1). The purified amplified target fragment is cut by SpeI and AgeI, and is connected with pjp743 vector which is cut by SpeI and AgeI, 10 muL system reaction is adopted, wherein 10 XLigase Buffer 1 muL, SpeI and AgeI are cut by double enzyme and linearized cloning vector pjp743120ng, NPR1 ubiquitin-26 s proteasome degradation element mutation fragment 120ng (shown in SEQ, NO: 17), Ligase0.4 muL, and ddH is finally used2Adjusting the system to 10 mu L, and gently mixing the components. The reaction mixture was left at 16 ℃ for 30 min. Immediately placing the reaction tube in ice water bath after the reaction is finished, cooling for 5min, and finally obtaining the transformation plasmid vector, wherein the structure of the vector is as shown in figure 1 (the sequence of the main structural unit forming the vector is shown in the figure and the gene sequence table). Then the ligation product was transferred into E.coli Mach1 (purchased from all-grass of King Ltd.), clones with full-length insertion were selected, 1 clone of the mutant NPR1 ubiquitin-26 s proteasome degradation element gene sequence was screened by sequencing, the clone plasmid was extracted, and the vector constructed by this strategy was named pjp749 (FIG. 1). This was introduced into Agrobacterium strain GV3101 by electroporation to form a strain of Venus YFP fusion protein (GV3101) which expresses a mutated SA-responsive element. The amino acid sequence of the mutant NPR1 ubiquitin-26 s proteasome degradation element is SEQ, NO: 18, respectively.
Example 4: transient expression of Venus YFP fusion proteins in response to SA-induced degradation
Two plasmid vectors pjp748 and pjp749 constructed in example 3 (wherein the pjp749 vector has the same structure as pjp748, and the inserted sequence of the degradation element of the NPR1 gene ubiquitin-26 s is mutant and does not respond to the effect of SA, FIG. 1) are respectively transformed by electric shock and introduced into Agrobacterium strain GV3101 (commercially available), and after colony PCR verification, single spots are picked and inoculated into LB medium (the basic components are: 1% peptone, 0.5% yeast extract and 1% sodium chloride) with Kan (50mg/L) and Rif (50mg/L) resistance for overnight shaking culture at 28 ℃; then 1: 100 were transferred to the same resistant LB medium and grown to logGrowth period (A)600The value is about 0.6-0.8), and the thalli are collected by centrifugation at 6000r/min for 5 min; with a final concentration of 10mM MgCl210mM MES (pH 5.6), 200uM acetosyringone (Ace) in sterile water, adjusting the bacterial liquid concentration to A600 of 1.0; standing at room temperature for more than 3 hours.
The agrobacterium liquid is sucked by a 1ml syringe (without a needle) for standby. 4-6 pieces of true-leaf Nicotiana benthamiana are selected, and bacterial liquid (agrobacterium strain GV3101 containing pjp748 and pjp749 plasmids) is slowly permeated and injected into the interstitial spaces of the tissues respectively on the back surfaces of the leaves. 6-8 plants are injected for each treatment, and the soaked plants are placed in the dark for 3-6 hours and then transferred to a greenhouse at 25 ℃ for culture (16 hours of light/8 hours of dark alternation).
Example 5: reaction of fusion proteins to SA
Tobacco lamina of example 4 injected at 12 hour intervals was sprayed with ddH (2mL/g lamina)2A1 mM SA solution of O, 10. mu.M, 100. mu.M was used to observe the reaction of the fusion protein to SA by fluorescence confocal microscopy for 48 hours. The observation shows that the NPR1 ubiquitin-26 s proteasome degradation element YFP fusion protein shows sensitivity to 10 mu M, 100 mu M and 1mM SA, the fluorescence intensity is obviously reduced, and the fluorescence intensity shows a weakening trend along with the increase of the SA concentration; NPR1 ubiquitin-26 s proteasome degradation element mutant YFP fusion protein pair ddH2No significant reaction was observed for O, 10. mu.M, 100. mu.M, 1mM SA (FIGS. 2 and 3). These results show that the constructed NPR1 ubiquitin-26 s proteasome degradation element YFP fusion protein has biological activity responding to SA, can reflect the SA level in plants in real time, and can be used for detecting the SA real-time change level in plants.
Example 6: expression and use of Venus YFP fusion protein responding to SA induced degradation
Plasmid vector:
pjp 748: the vector of example 4;
pjp 749: wherein the pjp749 vector has the same structure as pjp748 except that the inserted NPR1 ubiquitin-26 s proteasome degradation element gene fragment is mutant and does not respond to the action of SA, FIG. 1;
pjp750, 750: wherein the pjp750 vector has the same structure as pjp748 but only contains the gene of the sequence shown in Seq ID No. 5, and the fluorescent protein gene is a mutant gene or does not contain the fluorescent protein gene;
pjp751, 751: of these, pjp750 vector has the same structure as pjp748 but contains only the gene having the sequence shown by Seq ID No. 11 (fluorescent protein) but not the gene having the sequence shown by Seq ID No. 5.
Respectively, the plasmid vectors in the above 4 were transformed by electric shock into Agrobacterium strain GV3101 (commercially available), and after colony PCR verification, single spots were picked and inoculated into LB medium (basic components: 1% peptone, 0.5% yeast extract, 1% sodium chloride) containing Kan (50mg/L) and Rif (50mg/L) resistance at 28 ℃ for overnight shaking culture; then 1: 100 were transferred to LB medium of the same resistance and grown to logarithmic growth phase (A)600The value is about 0.6-0.8), and the thalli are collected by centrifugation at 6000r/min for 5 min; with MgCl at a final concentration of 10mM210mM MES (pH 5.6), 200uM Acetosyringone (AS) in sterile water, adjusting the bacterial liquid concentration to A600Is 1.0; standing at room temperature for more than 3 hours.
The above agrobacterium tumefaciens solution containing 4 self-supporting vectors was separately aspirated by a 1ml syringe (no needle) for use. 4-6 pieces of true tobacco leaves are selected, and bacterial liquid (agrobacterium strain GV3101 containing pjp748, pjp749, pjp750 and pjp751 plasmids) is slowly permeated and injected into the tissue gaps on the back surfaces of the leaves. 6-8 plants are injected for each treatment, and the soaked plants are placed in the dark for 3-6 hours and then transferred to a greenhouse at 25 ℃ for culture (16 hours of light/8 hours of dark alternation). The tobacco leaves of example 4 injected were sprayed with 100. mu.M of SA solution every 12 hours, and the reaction of the fusion protein to SA was observed by a fluorescence confocal microscope at 48 hours. The specific results are shown in the following table 1:
TABLE 1 results of in vitro SA exposure of different fusion proteins (48 hours)
From the above experimental results, it can be seen that only the fusion protein formed by NPR1 ubiquitin-26 s proteasome degradation element-fluorescent protein specifically shows the specific degradation in response to SA. Meanwhile, when only the NPR1 ubiquitin-26 s proteasome degradation element is present, fluorescence is not generated, and when only the fluorescent protein is present alone, the fluorescent protein is not degraded. The above results remained unchanged as the time of the contact reaction was extended (3 days or more). This seems to indicate that only the fusion protein of NPR1 ubiquitin-26 s proteasome degradation element and fluorescent protein gene can be specifically degraded by SA, and the others cannot. Further, the fusion protein of the present invention can be used to specifically indicate the presence or absence of SA.
At the same time, we performed the same experiment with an analogue of SA, or similar results (detailed description and data omitted).
Organization Applicant
----------------------
Street :
City :
State :
Country :
PostalCode :
PhoneNumber :
FaxNumber :
EmailAddress :
<110> OrganizationName agricultural scientific college in Zhejiang province
Application Project
-------------------
<120> Title a fusion protein for specifically detecting Salicylic Acid (SA)
<130>AppFileReference :
<140>CurrentAppNumber :
<141>CurrentFilingDate : _ - -
Sequence
--------
<213> OrganismName SA response element 5' -end amplification forward primer
<400>PreSequenceString :
atggatagta gaactgcttt ttcggattcc aatgatatta gtggaag 47
<212>Type : DNA
<211>Length : 47
SequenceName : 1
SequenceDescription :
Sequence
--------
<213> organic Name SA response element 3' -end amplification reverse primer
<400>PreSequenceString :
ttctgataga cgtttgaggg aattgacgtc tgccagtgaa gtttccgatt 50
<212>Type : DNA
<211>Length : 50
SequenceName : 2
SequenceDescription :
Sequence
--------
<213> organic Name with Age1 cleavage site SA response element 5' -end amplification forward primer
<400>PreSequenceString :
cggaccggta ccatggatag tagaactgct ttttcggatt ccaatgatat tagtggaag 59
<212>Type : DNA
<211>Length : 59
SequenceName : 3
SequenceDescription :
Sequence
--------
<213> OrganismName with Spe1 cleavage site SA response element 3' -end amplification reverse primer
<400>PreSequenceString :
cggactagtt tctgatagac gtttgaggga attgacgtct gccagtgaag tttccgatt 59
<212>Type : DNA
<211>Length : 59
SequenceName : 4
SequenceDescription :
Sequence
--------
<213> OrganismName Gene fragment of ubiquitin-26 s proteasome degradation element of SA response protein NPR1 of tomato
<400>PreSequenceString :
atggatagta gaactgcttt ttcggattcc aatgatatta gtggaagcag tagtatatgc 60
tgcatgaacg aatcggaaac ttcactggca gacgtcaatt ccctcaaacg tctatcagaa 120
<212>Type : DNA
<211>Length : 120
SequenceName : 5
SequenceDescription :
Sequence
--------
<213> amino acid sequence of ubiquitin-26 s proteasome degradation element of SA response protein NPR1 of tomato
<400>PreSequenceString :
MDSRTAFSDS NDISGSSSIC CMNESETSLA DVNSLKRLSE 40
<212>Type : PRT
<211>Length : 40
SequenceName : 6
SequenceDescription :
Sequence
--------
<213> OrganismName: LB (T-DNA left border)
<400>PreSequenceString :
tgtttacacc acaatatatc ctgccac 27
<212>Type : DNA
<211>Length : 27
SequenceName : 7
SequenceDescription :
Sequence
--------
<213> OrganismName: RB (T-DNA Right Border)
<400>PreSequenceString :
ggtttacccg ccaatatatc ctgtc 25
<212>Type : DNA
<211>Length : 25
SequenceName : 8
SequenceDescription :
Sequence
--------
<213> OrganismName 35S promoter sequence
<400>PreSequenceString :
ttaattaaga gctcgcatgc cctttcagaa agaatgctaa cccacagatg gttagagagg 60
cttacgcagc aggtctcatc aagacgatct acccgagcaa taatctccag gaaatcaaat 120
accttcccaa gaaggttaaa gatgcagtca aaagattcag gactaactgc atcaagaaca 180
cagagaaaga tatatttctc aagatcagaa gtactattcc agtatggacg attcaaggct 240
tgcttcacaa accaaggcaa gtaatagaga ttggagtctc taaaaaggta gttcccactg 300
aatcaaaggc catggagtca aagattcaaa tagaggacct aacagaactc cccgtaaaga 360
ctggcgaaca gttcatacag agtctcttac gactcaatga caagaagaaa atcttcgtca 420
acatggtgga gcacgacacg cttgtctact ccaaaaatat caaagataca gtctcagaag 480
accaaagggc aattgagact tttcaacaaa gggtaatatc cggaaacctc ctcggattcc 540
attgcccagc tatctgtcac tttattgtga agatagtgga aaaggaaggt ggctcctaca 600
aatgccatca ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc gacagtggtc 660
ccaaagatgg acccccaccc acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt 720
cttcaaagca agtggattga tgtgatatct ccactgacgt aagggatgac gcacaatccc 780
actatccttc gcaagaccct tcctctatat aaggaagttc atttcatttg gagagaacac 840
ggggac 846
<212>Type : DNA
<211>Length : 846
SequenceName : 9
SequenceDescription :
Sequence
--------
<213> organic name first Linker
<400>PreSequenceString :
gctgcgggtg ccggcgctgc cggtggcgct gcggcaggtg cggcc 45
<212>Type : DNA
<211>Length : 45
SequenceName : 10
SequenceDescription :
Sequence
--------
<213> OrganismName YFP fluorescent protein
<400>PreSequenceString :
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagct gatctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccctgggcta cggcctgcag tgcttcgccc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca ccgccgacaa gcagaagaac 480
ggcatcaagg ccaacttcaa gatccgccac aacatcgagg acggcggcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagct accagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaag 717
<212>Type : DNA
<211>Length : 717
SequenceName : 11
SequenceDescription :
Sequence
--------
<213> organic name second linker
<400>PreSequenceString :
gctgcggccg ctgccgctgc ggcagcggcc30
<212>Type : DNA
<211>Length : 30
SequenceName : 12
SequenceDescription :
Sequence
--------
<213> OrganismName: NLS (Nuclear localization protein)
<400>PreSequenceString :
atggcaggca gaagcggcgg cggaagagga ggaggaggag catcggctga tcttcactcc 60
gcggcaagat ccggtgattt agcagcagtt caatctatta tcagctctaa tcctttggct 120
gttaattcta gggataagca ttctcggact ccactacatt tagcagcatg ggcagggcac 180
aacgaggtag tgagctactt atgcaagaac aaagctgatg ttggtgctgc agcaggagat 240
gacatgggtg cgattcactt tgcttctcaa aaggggcatt tggaagttgt gagaacttta 300
ttatctgccg gtggttctgt gaagtctatc actcgcaagg gactcactcc tcttcactac 360
gctgctcaag gttctcactt tgaaatcgtc aagtacttgg ttaagaaagg agtaagcgtc 420
agagctacga ctaaggctgg gaagagtcca gctgatgttg cgggtaatgc agaaacgcaa 480
aatttccttg aagaatgtga agagcaagca aggaaagcta aggtgaacaa tgagaaaaag 540
acggaaatag tgaaaccaga gagttgtagc aatgaaggag atgtcaagga tctgaaaaga 600
aaggactctg aggatggaaa cgagggtgag gaagaagaag cttcttcgaa accgaaaaag 660
ccaaaagttg ctctttctca tcttcaggac actgacgaca cagaagctga tcaagaagaa 720
gagtaa 726
<212>Type : DNA
<211>Length : 726
SequenceName : 13
SequenceDescription :
Sequence
--------
<213> OrganismName Bar Gene
<400>PreSequenceString :
atgagcccag aacgacgccc ggccgacatc cgccgtgcca ccgaggcgga catgccggcg 60
gtctgcacca tcgtcaacca ctacatcgag acaagcacgg tcaacttccg taccgagccg 120
caggaaccgc aggagtggac ggacgacctc gtccgtctgc gggagcgcta tccctggctc 180
gtcgccgagg tggacggcga ggtcgccggc atcgcctacg cgggcccctg gaaggcacgc 240
aacgcctacg actggacggc cgagtcgacc gtgtacgtct ccccccgcca ccagcggacg 300
ggactgggct ccacgctcta cacccacctg ctgaagtccc tggaggcaca gggcttcaag 360
agcgtggtcg ctgtcatcgg gctgcccaac gacccgagcg tgcgcatgca cgaggcgctc 420
ggatatgccc cccgcggcat gctgcgggcg gccggcttca agcacgggaa ctggcatgac 480
gtgggtttct ggcagctgga cttcagcctg ccggtaccgc cccgtccggt cctgcccgtc 540
accgagatct ga 552
<212>Type : DNA
<211>Length : 552
SequenceName : 14
SequenceDescription :
Sequence
--------
<213> OrganismName: NOST (Nos terminator)
<400>PreSequenceString :
gaatttcccc gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc 60
cggtcttgcg atgattatca tataatttct gttgaattac gttaagcatg taataattaa 120
catgtaatgc atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata 180
catttaatac gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc 240
ggtgtcatct atgttactag atcgg 265
<212>Type : DNA
<211>Length : 265
SequenceName : 15
SequenceDescription :
Sequence
--------
<213> OrganismName amplification forward primer at 5' -end of SA response element with Age1 enzyme cutting site mutation
<400>PreSequenceString :
cggaccggta ccatggatag tagaactgct ttttcggatg acaatgatat tgatggaag 59
<212>Type : DNA
<211>Length : 59
SequenceName : 16
SequenceDescription :
Sequence
--------
<213> OrganismName Gene fragment of ubiquitin-26 s proteasome degradation element of mutant tomato NPR1
<400>PreSequenceString :
atggatagta gaactgcttt ttcggatgac aatgatattg atggaagcagtagtatatgc 60
tgcatgaacg aatcggaaac ttcactggca gacgtcaatt ccctcaaacg tctatcagaa 120
<212>Type : DNA
<211>Length : 120
SequenceName : 17
SequenceDescription :
Sequence
--------
<213> amino acid sequence of ubiquitin-26 s proteasome degradation element of mutated tomato NPR1
<400>PreSequenceString :
MDSRTAFSDD NDIDGSSSIC CMNESETSLA DVNSLKRLSE 40
<212>Type : PRT
<211>Length : 40
SequenceName : 18
SequenceDescription :
Claims (5)
1. A fusion protein for specifically detecting Salicylic Acid (SA), wherein the fusion protein comprises a protein coded by a DNA sequence of a ubiquitin-26 s proteasome degradation element region of an NPR1 gene and a protein coded by a fluorescent protein gene, wherein the fusion protein can be specifically degraded by the SA induction to reduce the fluorescence intensity, and the DNA sequence of the ubiquitin-26 s proteasome degradation element region of the NPR1 gene is shown as Seq ID No: 5.
2. The fusion protein of claim 1, wherein the fusion protein is encoded or expressed by the gene for ubiquitin-26 s proteasome degradation element of NPR1 and the fluorescent protein gene.
3. The fusion protein according to claim 1, wherein the fusion protein is specifically and specifically degraded by SA, but the fluorescence intensity is not reduced when the protein encoded by the gene of the ubiquitin-26 s proteasome degradation element of NPR1 alone or the protein encoded by the gene of the fluorescent protein alone is degraded by SA.
4. The fusion protein of claim 1, wherein the fusion protein is expressed by transferring a plasmid vector into an expression vector, wherein the structure of the plasmid vector comprises, in order from left to right: T-DNA right border element sequence-35S promoter element sequence-first enzyme cutting site-NPR 1 ubiquitin-26S proteasome degradation element-second enzyme cutting site-first linker sequence-fluorescent protein sequence-second linker sequence-nuclear localization protein (NLS) sequence-terminator sequence-35S promoter sequence-T-DNA left border sequence, wherein the expression vector is Agrobacterium which is inoculated into tobacco for expression.
5. The fusion protein according to any one of claims 1 to 4, wherein the gene sequence encoded by the fluorescent protein is Seq ID No. 11.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610442983.3A CN106046175B (en) | 2016-06-16 | 2016-06-16 | Fusion protein for specifically detecting Salicylic Acid (SA) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610442983.3A CN106046175B (en) | 2016-06-16 | 2016-06-16 | Fusion protein for specifically detecting Salicylic Acid (SA) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106046175A CN106046175A (en) | 2016-10-26 |
| CN106046175B true CN106046175B (en) | 2020-03-13 |
Family
ID=57168531
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610442983.3A Active CN106046175B (en) | 2016-06-16 | 2016-06-16 | Fusion protein for specifically detecting Salicylic Acid (SA) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106046175B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103842819A (en) * | 2011-06-01 | 2014-06-04 | 拜奥麦迪逊公司 | Non-fret botulinum assay |
| EP2772548A1 (en) * | 2013-02-27 | 2014-09-03 | Universität Ulm | A fluorescent reporter for determining molecular interactions |
| CN104395753A (en) * | 2012-04-19 | 2015-03-04 | 李心予 | Method and system of detecting dioxin-like compounds |
-
2016
- 2016-06-16 CN CN201610442983.3A patent/CN106046175B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103842819A (en) * | 2011-06-01 | 2014-06-04 | 拜奥麦迪逊公司 | Non-fret botulinum assay |
| CN104395753A (en) * | 2012-04-19 | 2015-03-04 | 李心予 | Method and system of detecting dioxin-like compounds |
| EP2772548A1 (en) * | 2013-02-27 | 2014-09-03 | Universität Ulm | A fluorescent reporter for determining molecular interactions |
Non-Patent Citations (3)
| Title |
|---|
| In situ detection of salicylic acid binding sites in plant tissues;Liu JW，等;《Luminescence》;20150228;第30卷(第1期);全文 * |
| 植物体内水杨酸分析方法的探讨及其应用;张卫，等;《生态毒理学报》;20091215;第4卷(第6期);全文 * |
| 水杨酸测定方法现状分析;段沅杏,等;《云南化工》;20101215;第37卷(第6期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106046175A (en) | 2016-10-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2844754B1 (en) | Targeted modification of malate dehydrogenase | |
| Porcel et al. | BvCOLD1: A novel aquaporin from sugar beet (Beta vulgaris L.) involved in boron homeostasis and abiotic stress | |
| CN113087780B (en) | Litchi disease-resistant gene LcLTP, and encoded protein and application thereof | |
| Zhou et al. | LaALMT1 mediates malate release from phosphorus‐deficient white lupin root tips and metal root to shoot translocation | |
| JPH05508555A (en) | Novel invertase gene and its use | |
| Zhang et al. | The transcription factor WRKY75 regulates the development of adventitious roots, lateral buds and callus by modulating hydrogen peroxide content in poplar | |
| US7622636B2 (en) | Dehydrin gene from Avicennia marina responsible for conferring salt tolerance in plants | |
| CN111621504B (en) | Stress-resistant gene BjuIBS of tumorous stem mustard and application thereof | |
| CN106046175B (en) | Fusion protein for specifically detecting Salicylic Acid (SA) | |
| JP7429896B2 (en) | Method for producing plant acid invertase activator, plant acid invertase activator, and method for activating plant acid invertase | |
| CN111217899B (en) | Transcription factor PpbHLH1 involved in synthesis and regulation of linalool from peach trees and application thereof | |
| CN105969795B (en) | It is a kind of for the plant expression vector of salicylic acid level and its application in real-time detection plant | |
| US6545202B2 (en) | Transgenic plant transformed with a translationally controlled tumor protein (TCTP) gene | |
| US20220403396A1 (en) | Methods and compositions for dna base editing | |
| Zhang et al. | Molecular cloning and functional characterization of CmFT (FLOWERING LOCUS T) from Cucumis melo L. | |
| TW201231659A (en) | Glycosyltransferase promoter from a medicinal herb on gene regulation and application | |
| WO2024080067A1 (en) | Genome editing method and composition for genome editing | |
| CN110857317B (en) | Brassica napus NAC47 transcription factor and preparation method and application thereof | |
| Hayden | Characterization of senescence regulated gene expression in Anthurium | |
| Carlow | Analysis of the Vitis C-Repeat Binding Factor (CBF) genes and their potential roles in both the CBF and stomatal development pathways | |
| WO2023250384A2 (en) | Crispr-cas effector polypeptides and methods of use thereof | |
| CN117965464A (en) | Hydroxy cinnamoyl spermidine biosynthesis and transport gene cluster and application thereof | |
| CN114921426A (en) | Amino acid transporter CsAaP7.2 and coding gene and application thereof | |
| WO2011142430A1 (en) | Method for producing plant body granted freeze-tolerance, and utilization thereof | |
| CN112251447A (en) | Cloning and application of salt mustard salt induced expression gene TsHKT1 and 2 promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |