CN104630300B - A kind of l-amino acid production method - Google Patents
A kind of l-amino acid production method Download PDFInfo
- Publication number
- CN104630300B CN104630300B CN201310566206.6A CN201310566206A CN104630300B CN 104630300 B CN104630300 B CN 104630300B CN 201310566206 A CN201310566206 A CN 201310566206A CN 104630300 B CN104630300 B CN 104630300B
- Authority
- CN
- China
- Prior art keywords
- amino acid
- ybas
- bacterium
- lysine
- threonine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of L amino acids productions methods.The invention firstly discloses a kind of expression or activity by increasing glutaminase YbaS in L amino acids production bacterium, the method for improving L amino acid (such as L lysines, L threonines, L tryptophans) yield.
Description
Technical field
The invention belongs to biotechnologies；More particularly it relates to a kind of l-amino acid production method.
Background technology
There can be more than 20 kinds with the amino acid that fermentation method produces in the world at present.Amino acid alpha-carbon atom is connected respectively with covalent bond
Connect hydrogen atom, carboxyl and amino and side chain.Side chain is different, and the property of amino acid is different.Amino acid is widely used in food, raises
Material, medical industry, including：Condensed food freshener (lysine, threonine, tryptophan is in wheat)；Monosodium glutamate and day
Winter propylhomoserin, phenylalanine and aspartic acid can be used for manufacturing dipeptide sweetener low in calories (α-aspartame)；First
The essential amino acids such as methyllanthionine can be used for manufacturing animal feed；A variety of mixed amino acids can pass through infusion treatment nutrition or generation
Thank to imbalance.
There are many production methods of amino acid, (is generated including direct fermentation, enzyme process using microbial cell or microorganism
Enzyme manufacture amino acid), extraction method (protein hydrolyzes, and extracts from hydrolyzate) etc..Traditional extraction method, enzyme process and change
Synthetic method is learned due to of high cost, the complex process of precursor, it is difficult to achieve the purpose that industrialized production.With carrier, by system
The structure of system and outer-gene recombinant technique it is increasingly perfect, amino acid bio engineering bacteria has been built with further development.
Invention content
The purpose of the present invention is to provide a kind of l-amino acid production methods.
In the first aspect of the present invention, a kind of method for the l-amino acid yield for improving l-amino acid production bacterium, institute are provided
The method of stating includes：Expression or the activity of glutaminase YbaS is improved in l-amino acid produces bacterium；For example, it is given birth in l-amino acid
It produces and (external source) glutaminase YbaS is overexpressed in bacterium；The bacterial strain is cultivated, so as to produce l-amino acid.
In a preference, the l-amino acid includes but is not limited to：L-lysine, L-Trp, L- Soviet Unions ammonia
Acid.
In another preferred example, the amino acid sequence of the glutaminase YbaS is：(a) GenBank accession number：
NP_415018.1；Or its congenerous variant, such as by (a) polypeptide by one or more (such as 1-20；Preferably 1-10；Compared with
Good ground 1-4；More preferably 1-3；More preferably 1-2) amino acid residue substitution or addition and formed, and with (a) polypeptide
The polypeptide of congenerous.
In another preferred example, the method includes：
(a) a kind of recombinant plasmid is provided, is contained in the recombinant plasmid comprising a recombinant expression cassettes, the recombinant expression cassettes：
Glutaminase YbaS encoding genes；With
(b) the recombinant plasmid transformed l-amino acid of (a) is produced into bacterium, so as to improve the expression of glutaminase YbaS or work
Property；
(c) (b) bacterial strain is cultivated, so as to produce l-amino acid.
In another preferred example, the l-amino acid is L-lysine, and L-lysine-producing bacteria is comprising pDCtet matter
The Escherichia coli of grain and pDCkan plasmids；Or
The l-amino acid is L-Trp, and L-Trp production bacterium is CIBTS2；Or
The l-amino acid is L-threonine, L-threonine produce bacterium comprising (external source) ppc, aspA, pntAB,
thrA*The Escherichia coli (preferably MG1655) of gene.
In another preferred example, l-amino acid production bacterium is MG1655.
In another aspect of this invention, the purposes of glutaminase YbaS is provided, for improving l-amino acid production bacterium
L-amino acid yield.
In a preference, the l-amino acid includes but is not limited to：L-lysine, L-Trp, L- Soviet Unions ammonia
Acid.
In another aspect of this invention, a kind of l-amino acid production bacterium of recombination, l-amino acid production bacterium are provided
Glutamine enzyme YbaS high is expressed or high activity.
In a preference, the glutaminase of external source is integrated in the genome of l-amino acid production bacterium
YbaS encoding genes.
In another aspect of this invention, a kind of kit for being used to produce l-amino acid is provided, is wrapped in the kit
Include the l-amino acid production bacterium of the recombination.
In a preference, further included in the kit：
L-amino acid produces the culture medium of bacterium；Or
Induced expression agent (such as IPTG).
The other aspects of the present invention are apparent to those skilled in the art due to this disclosure
's.
Description of the drawings
Fig. 1, pTrc-ybaS restriction enzyme mapping.1：PTrc-ybaS utilizes EcoRV digestions, obtains about 1.3kb/4.1kb segments；
M：marker.
Fig. 2, pTrc-yabS plasmid map.
Fig. 3, pThr plasmids Plasmids collection of illustrative plates.
Specific embodiment
The present inventor passes through in-depth study, discloses for the first time a kind of by increasing glutamine in producing bacterium in l-amino acid
The expression of enzyme YbaS or activity, the method for improving l-amino acid (such as L-lysine, L-threonine, L-Trp) yield.It is described
Method is remarkably improved the yield of l-amino acid.
As used herein, " external source " or " heterologous " refers to for cell, the glutaminase YbaS
Encoding gene is not from itself, but is built and be inserted by recombination method.
" l-amino acid produces bacterium " refers under appropriate condition of culture, can recombinantly express production l-amino acid
Bacterial strain, preferably the bacterial strain is Escherichia coli.Some l-amino acids production bacterial strain, these bacterium have been had been built up in the prior art
Strain can be applied in the present invention.Also, those skilled in the art understand conventional l-amino acid such as L-lysine, L- color ammonia
Acid, L-threonine produce the construction method of bacterial strain.
For production access of the l-amino acid in Escherichia coli, those skilled in the art have the understanding of certain level.
Therefore, it is known how " l-amino acid produces bacterium " is selected, for example, in EP1253195, EP1477564, it was recently reported that some
L-amino acid produces the structure of bacterium.
As the preferred embodiment of the present invention, l-amino acid production bacterium is Escherichia coli, preferably the large intestine bar
Following one or more genes are weakened or express reduction in bacterium：A. the adhE genes of alcohol dehydrogenase are encoded；B. second is encoded
The ackA genes of acid kinase；C. the pta genes of phosphate acetyltransferase are encoded；D. the ldhA genes of encoding lactate dehydrogenase；e.
Encode the focA genes of formate transporter；F. the pflB genes of encoding pyruvate acid formate lyase；G. encoding pyruvate acid oxidase
The poxB genes of enzyme；H. the thrA genes of codes for aspartate kinase I/ homoserine dehydrogenases I bifunctional enzymes；I. Kosé is encoded
The thrB genes of histidine kinase；J. the ldcC genes of lysine decarboxylase are encoded；Or the cadA bases of h. coding lysine decarboxylases
Cause.
As the preferred embodiment of the present invention, in the L-lysine-producing bacteria (Escherichia coli) selected from following one or
Multiple genes are enhanced or are overexpressed：A. the dapA genes for the dihydrodi pyridine synzyme that Coded Discharge lysine feedback inhibits；
B. the dapB genes of dihydrodi pyridine dicarboxylic acids reductase are encoded；C. the ddh genes of diaminopimelate dehydrogenase are encoded；D. it compiles
The dapD of the code tetrahydropyridine dicarboxylic acids succinyl enzyme and dapE of coding succinyl diaminopimelic acid deacylase；E. asparagus fern is encoded
The asd genes of propylhomoserin-semialdehyde dehydrogenase；F. the ppc genes of Orynebacterium carboxylase；Or g. coding niacinamide usp glands
The pntAB genes of purine dinucleotides transhydrogenase.
As the preferred embodiment of the present invention, the L-lysine-producing bacteria is comprising pDCtet plasmids and pDCkan
The Escherichia coli of plasmid.When producing L-Trp, L-Trp production bacterium is CIBTS2.When production L-threonine
When, L-threonine production bacterium is ppc, aspA, pntAB, the thrA for including external source*Gene (coding SEQ ID NO:24
Polypeptide) Escherichia coli (preferably MG1655).ppc、aspA、pntAB、thrA*Bases such as (thrA rite-directed mutagenesis G433R)
Because being gene well known in the art.
NCBI has been disclosed that the sequence of " glutaminase YbaS ", such as its sequence can be found in GenBank accession number NP_
It is 415018.1 shown.
The nucleotide full length sequence or its segment of " encoding gene of glutaminase YbaS " of the present invention can usually be used
PCR amplification method, recombination method or artificial synthesized method obtain.It, can be according to related core disclosed in this invention for PCR amplification method
Nucleotide sequence, especially open reading frame sequence design primer, and with commercially available cDNA libraries or by those skilled in the art
CDNA libraries prepared by the conventional method known expand as template and obtain related sequence.
In order to increase the l-amino acid yield of l-amino acid production bacterium, the present inventor is extensively studied, has found suitable
Together in the gene improved, and construct corresponding construction.
Therefore, the present invention provides a kind of construction, the construction includes：The encoding gene of glutaminase YbaS
Expression cassette.The expression cassette has all elements needed for gene expression (including promoter, coding DNA and terminator
Deng), so as to completely give expression to corresponding albumen.
In general, the construction is located on expression vector.Therefore, the invention also includes a kind of carriers, it contains described
Construction.The expression vector is usually also containing replication orgin and/or marker gene etc..Those skilled in the art is known
Method can be used to building the required expression vector of the present invention.These methods include recombinant DNA technology in vi, DNA synthetic technologys,
In vivo recombination technology etc..The DNA sequence dna can be effectively connected in the appropriate promoter in expression vector, mRNA to be instructed to close
Into.Expression vector further includes the ribosome bind site and transcription terminator of translation initiation.
In addition, expression vector preferably includes one or more selected markers, conversion is selected to provide
The phenotypic character of host cell, such as the ampicillin, apramycin, kalamycin resistance of prokaryotic cell culture.
Comprising above-mentioned appropriate polynucleotide sequence and the carrier of appropriate promoter or control sequence, can be used for
Convert appropriate host.In the method for the invention, the host is l-amino acid production bacterium.
It can be carried out, such as calcium phosphate with routine techniques well known to those skilled in the art with recombinant DNA conversion host cell
Coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging etc..It as a preferred mode, can electricity consumption
The method of conversion carries out.
The invention further relates to for producing the kit of l-amino acid, the kit includes：The l-amino acid of recombination
Produce bacterium, wherein glutaminase YbaS high expression or high activity.The recombinant cell or cell is placed in appropriate container
In.
As the preferred embodiment of the present invention, further included in the kit and produce glutathione for subsequent chemical reaction
Other chemical compositions, including but not limited to：Cysteine, glycine, glutamic acid or its salt (such as sodium salt), inorganic salts and ATP；
Preferably, the inorganic salts include：Seven aqueous magnesium chlorides, acetyl phosphate dilithium salt.
As the preferred embodiment of the present invention, operation instructions are further included in the kit, illustrate various chemical reagent
Or expression vector or the concentration of cell or product of cell lysis, usage and dosage.
With reference to specific embodiment, the present invention is further explained.It should be understood that these embodiments are merely to illustrate the present invention
Rather than it limits the scope of the invention.Test method without specific conditions in the following example, usually according to conventional strip
Part such as J. Pehanorm Brookers etc. are write, Molecular Cloning:A Laboratory guide, the third edition, Science Press, condition described in 2002 or
According to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and number are calculated by weight.
Embodiment 1, structure pTrc-ybaS plasmids
(1) using ybaS-F/ybaS-R as primer, MG1655 (CGSC6300) (is purchased from Coli Genetic Stock
Center) genome be template, PCR amplification ybaS ORF segments, about 1kb；
ybaS-F：5’GCGGTCTCCATGTTAGATGCAAACAAATTACAG3’(SEQ ID NO:1)；
ybaS-R：5’GCCTCGAGTCAGCCCTTAAACACGTTATAGC3’(SEQ ID NO:2)；
(2) ybaS ORF segments utilize BsaI/XhoI digestions, are inserted into pTrcHis2B carriers and (are obtained from Chinese Academy of Sciences Shanghai to plant
Object physiological ecological research institute) NcoI/XhoI sites, the plasmid of structure is named as pTrc-yabS, plasmid map such as Fig. 2.Structure
Good pTrc-ybaS segments can utilize EcoRV digestion verifications, the result is shown in Figure 1.
Embodiment 2, pTrc-ybaS are transferred to L-lysine-producing bacteria strain (MG1655/pDCkan/pDCtet) test
(1) MG1655/pDCkan/pDCtet is constructed as below：By pDCtet (US20120107882A1) and pDCkan
(US20120107882A1) it is transferred in MG1655 (purchased from Coli Genetic Stock Center).Between, by pTrc-
YbaS plasmids are transferred in MG1655/pDCkan/pDCtet competent cells, obtain MG1655/pDCkan/pDCtet/pTrc-
ybaS；
(2) it is put down respectively from MG1655/pDCkan/pDCtet (control), MG1655/pDCkan/pDCtet/pTrc-ybaS
Picking single bacterium colony on plate is inoculated in 4ml and receives mycin (50 μ g/ml) and/or ammonia benzyl mycin containing tetracycline (15 μ g/ml) and/or card
In (100 μ g/ml) LB test tubes, 37 DEG C, 200rpm cultures about 10h；
(3) bacterium solution is transferred in 50ml fermentation mediums with 10% inoculum concentration, while adds final concentration of 0.1mM's
IPTG is induced；After shake flask fermentation 48h, the dense (OD to bacterium600) be measured, while centrifuged under the conditions of zymotic fluid 12000rpm
10min carries out HPLC measure to the lysine content in supernatant, the results are shown in Table 2.
Fermentative medium formula such as table 1.
Table 1
| Yeast extract | 5g/L |
| (NH4)2SO4 | 16g/L |
| KPH2PO4 | 1g/L |
| MgSO4·7H2O | 1g/L |
| FeSO4·7H2O | 0.01g/L |
| MnSO4·5H2O | 0.01g/L |
| L-Met | 0.5g/L |
| L-Thr | 0.1g/L |
| L-Ile | 0.05g/L |
| CaCO3 | 20g/L |
| Glucose | 40g/L |
HPLC detection methods are as follows：
Chromatographic condition：Agilent XDB-C8 (150mm) neutrality pillar, Detection wavelength 334nm, column temperature：35℃.
Derivating agent is configured：
0.3430g o-phthalaldehyde+5ml absolute ethyl alcohol+0.1472gN- acetyl-L cysteines are taken, with 0.05mol/L boron
Acid buffer (PH=9.5) is fixed molten to 50ml, is protected from light spare.
Mobile phase A：A certain amount of sodium acetate is weighed, is made into the buffer solution 1000ml of 0.05mol/L.
Mobile phase B：Methanol.
Derivative program：
Draw0.0ul from Vial91；
Draw6.0ul from Vial92；
Draw0.0ul from Vial91；
Draw3.0ul from Vial94；
Draw0.0ul from Vial92；
Mix9.0ul in air rept2times in200ul/min；
Draw4.0ul from Vial93；
Draw0.0ul from Vial91；
Draw2.0ul from Sample；
Draw0.0ul from Vial91；
Mix15.0ul in air rept6times in200ul/min；
Wait2.0min；
Inject；
Wherein No. 91 are distilled water, and No. 92 are borate buffer (ph=9.5), and No. 93 are derivating agent, and No. 94 are distilled water.
Gradient elution program：
Data acquisition time 18min.
Table 2 is overexpressed ybaS to thalline L-lysine bacterial strain MG1655/pDCkan/pDCtet influences
| Strain name | OD600 | L-lysine (g/L) |
| MG1655/pDCkan/pDCtet | 6.77 | 0.2 |
| MG1655/pDCkan/pDCtet/pTrc-ybaS | 8.72 | 2.28 |
As can be seen from Table 2, the yield for being overexpressed the thalline production L-lysine of ybaS dramatically increases, increase by 10 times or more.It crosses
Expression ybaS has facilitation to the growing multiplication of thalline.
PTrc-yabS is transferred in tryptophan-producing Strain CIBTS2 and tests by embodiment 3
(1) pTrc-ybaS plasmids are transferred to tryptophan-producing Strain CIBTS2 (referring to CN 201010598350.4) impressions
In state cell, CIBTS2/pTrc-ybaS is obtained；
(2) 4ml is inoculated in containing tetracycline from picking single bacterium colony on CIBTS2 (control), CIBTS2/ybaS tablets respectively
In the test tube of (15 μ g/ml) and/or ammonia benzyl mycin (100 μ g/ml) LB culture mediums, 37 DEG C, 200rpm is incubated overnight；
(3) and then by 1% inoculum concentration it being seeded in 25ml shake-flask seed culture mediums, 37 DEG C, 220rpm is cultivated 24 hours,
It is then forwarded in 25ml Medium of shaking flask fermentation in 20% ratio, while the IPTG for adding final concentration of 0.1mM is induced
37 DEG C, 220rpm is cultivated 28 hours.
Zymotic fluid is centrifuged 10min by fermentation ends under the conditions of 12000rpm, and the tryptophane in supernatant is carried out
HPLC measures (the results are shown in Table 5), and the determination condition of HPLC is as follows：
HPLC (Agilent technologies, 1100), pillar：ZORBAX SB-C18 (4.6 × 250mm), mobile phase
Composition, water：Acetonitrile=92:8 (v/v), flow velocity are 1ml/min, in view of tryptophan has an absorption maximum at 226nm, therefore Detection wavelength
226nm。
Shake-flask seed culture medium formula such as table 3.Fermentation medium such as table 4.
Table 3
| Title | Dosage (g/L) |
| Glucose | 28 |
| KH2PO4 | 10 |
| K2HPO4 | 24 |
| MgSO4·7H2O | 1.0 |
| (NH4)2SO4 | 5 |
Table 4
| Title | Dosage (g/L) |
| Glucose | 35 |
| KH2PO4 | 7.5 |
| MgSO4·7H2O | 0.02 |
| Citric acid | 2.0 |
| (NH4)2SO4 | 25 |
| Na2SO4 | 1 |
| MnSO4 | 0.2 |
| FeSO4·7H2O | 0.16 |
| ZnCl2 | 0.002 |
| CoCl2·6H2O | 0.002 |
| CuSO4·5H2O | 0.00003 |
| CaCO3 | 20 |
Table 5 is overexpressed ybaS to the influence of thalline L-Trp bacterial strain
| Strain name | OD600 | L-Trp (g/L) |
| CIBTS2 | 9.07 | 1.083 |
| CIBTS2/pTrc-ybaS | 9.32 | 1.212 |
By table 5 as it can be seen that being overexpressed the yield of the L-Trp production bacterium production L-Trp of ybaS increases, increase about 1.12
Times.Be overexpressed ybaS has certain promotion to the growing multiplication of thalline.
PTrc-yabS is transferred in threonine producing strain and tests by embodiment 4
1st, L-threonine-producing strain is built
(1) pMWK is built
Using pPIC3.5K (Invitrogen) carriers as template, Kandn/Kanup is primer, PCR amplification Kan segments, about
0.9kb；PMW118 carriers (being purchased from Nippon Gene) are recycled 2.7kb segments and are mended using ApaLI/EcoO1109I double digestions
It is flat；Above-mentioned segment connection is coated on containing kanamycins (50ug/ml) LB tablets, and transformant is verified using KanF/M13F-47, energy
500bp segment persons are obtained, direction is as correctly connected into, obtains pMWK plasmids.
Kandn：5’CCAACCAATTAACCAATTCTGATTAG3’(SEQ ID NO:3)；
Kanup：5’CCTGCAGGGGGGGGGGGAAAGCCACGTTGTGTC3’(SEQ ID NO:4)；
kanF：5’TCGGAATCGCAGACCGATAC3’(SEQ ID NO:5)；
M13F-47：5’CGCCAGGGTTTTCCCAGTCACGAC3’(SEQ ID NO:6).
(2) pMW-ppc is built
Using MG1655 genomes as template, ppcdn/ppcup is primer, PCR amplification ppc segments, about 3kb, ppc segments profit
With AflII digestion filling-in；PBR322 carriers (being purchased from TAKARA) utilize EcoO109I digestions filling-in and dephosphorization；Two segments connect,
It is coated on containing on ampicillin (100ug/ml) LB tablets, transformant is verified using ampR/ppcF, obtains 500bp segments then
To be correctly connected into direction, it is named as pBR-ppc.
PBR-ppc utilizes SmaI/ScaI digestions, recycles 3.6kb segments；The SmaI sites of pMW118 carriers are inserted into, are turned
Beggar is verified using ppcF/M13F-47, obtains pMW-ppc plasmids.
ppcdn：5’GGAATTCCTTAAGGATATCTGAAGGTATATTCAGAATTTG3’(SEQ ID NO:7)；
ppcup：5’AGGAAGCTTAAGCCCGGGTCGACCGGTCGACCGGCGATTTTTTAACATTTCCATAAGT3’
(SEQ ID NO:8)；
ampR：5’CGTGCACCCAACTGATCTTC3’(SEQ ID NO:9)；
ppcF：5’ATCTGCCGTGGATTGCAGAG3’(SEQ ID NO:10).
(3) pMW-aspA is built
Using MG1655 genomes as template, aspAup/aspAdn is primer, PCR amplification aspA segments, about 2.1kb；aspA
Segment is inserted into the SmaI sites of pMW118 carriers, is coated on the mycin of benzyl containing ammonia (100ug/ml) LB tablets, and transformant utilizes
AspAR/M13R-48 primers are verified, are amplified about 500bp segments, are as striven for, obtain pMW-aspA plasmids.
aspAup：5′-TGATCAGCGAAACACTTTTA-3′(SEQ ID NO:11)；
aspAdn：5′-CAGCAAAACTATGATGAGTTCTAC-3′(SEQ ID NO:12)；
aspAR：5′-CATCAGCTGGAACTTCCCTGG-3′(SEQ ID NO:13).
(4) pMW-pntAB is built
Using MG1655 genomes as template, pntABdn/pntABup is primer, PCR amplification pntAB segments, about 3.2kb,
PntAB segments are inserted into the HindIII/BamHI sites of pMW118 carriers using HindIII/BamHI, and it is mould to be coated on benzyl containing ammonia
Plain (100ug/ml) LB plate screenings, transformant verify that it is just that can amplify about 400bp segments using pntB-F/M13F-47
Really, pMW-pntAB plasmids are obtained.
pntABdn：5’AGAAGCTTTCTCAATAAAGAGTGACGG3’(SEQ ID NO:14)；
pntABup：5’AACCCGGGATCCAGATCACAGGCATAATTTTCAG3’(SEQ ID NO:15)；
pntB-F：5’GAACGTATTGCTGGCTGAAG3’(SEQ ID NO:16).
(5) pMW-ppc-aspA is built
PMW118-aspA plasmids obtain 2kb segments first with SacI digestions and filling-in, then with HindIII digestions；
PMW118-ppc plasmids obtain 6kb segments first with XbaI enzyme cutting and filling-in, then with HindIII digestions；Two segments connect, and apply
It being distributed on the mycin of benzyl containing ammonia (100ug/ml) LB tablets, transformant is verified using aspAR/ppcF, can amplify 1.5kb segments,
Obtain pMW-ppc-aspA plasmids.
(6) pMW-ppc-aspA-pntAB is built
PMW118-ppc-aspA plasmids recycle HindIII digestions, recycle about 9kb pieces first with XbaI enzyme cutting and filling-in
Section；PMW-pntAB plasmids utilize HindIII/SmaI digestions, recycle about 3.2kb segments；Two segments connect, and are coated on benzyl containing ammonia
On mycin (100ug/ml) LB tablets, pMW-ppc-aspA-pntAB plasmids are obtained.
(7) pMWK-ppc-aspA-pntAB is built
PMW-ppc-aspA-pntAB plasmids utilize HindIII/SmaI digestions, recycling about 9kb segments and filling-in；PMWK matter
Grain utilizes EcoRI digestions and filling-in, dephosphorization；Two segments connect, and are coated on containing on kanamycins (50ug/ml) LB tablets, convert
Son is verified using pntB-F/M13F-47, can amplify about 400bp segments to get to pMWK-ppc-aspA-pntAB plasmids.
pntB-F：5’GAACGTATTGCTGGCTGAAG3’(SEQ ID NO:17).
(8) pMW-Pthr is built
Using MG1655 genomes as template, Pthr-F/Pthr-R is primer, PCR amplification Pthr segments, about 300bp, Pthr
Segment utilizes XbaI/SacI digestions, is inserted into the XbaI/SacI sites of pMW118, obtains pMW-Pthr plasmids.
Pthr-F：5’GGGAGCTCTACGCGAACGAGCCATGACATTG3’(SEQ ID NO:18)；
Pthr-R：5’GGACTCTAGAGTCTTTATCTGTCTGTGCGCTATGCC3’(SEQ ID NO:19).
(9)pMW-Pthr-thrA*Structure
Using MG1655 genomes as template, thrA-F/thrA-R2 is primer, PCR amplification thrA-1 segments, about 1.3kb；
Simultaneously using MG1655 genomes as template, thrA-F2/thrA-R is primer, PCR amplification thrA-2 segments, about 1.2kb；With
ThrA-1/thrA-2 segments be template, fusion PCR amplifications thrA*Segment, about 2.5kb are to get to G433R mutant fragments
thrA*(“*" represent to mutate), thrA*Segment utilizes XbaI enzyme cutting；PMW-Pthr plasmids first use HindII digestion filling-in, then
Use XbaI enzyme cutting；Two segments connect, and obtain pMW-Pthr-thrA*Plasmid；
thrA-F：5’GACTCTAGAGTCCGACCAAAGGTAACGAGGTAACAAC3’(SEQ ID NO:20)；
thrA-R2：5’GTTCAGAAGATCTCTGAGCAATGG3’(SEQ ID NO:21)；
thrA-F2：5’CCATTGCTCAGAGATCTTCTGAAC3’(SEQ ID NO:22)；
thrA-R：5’CCTCTAGAACTAGTCCTAGGTTTAAACGCGGCCGCTTAGACTCCTAACTTCCATGAGA3’
(SEQ ID NO:23)。
(10) pThr is built
pMW-Pthr-thrA*Plasmid utilizes SacI/SpeI digestions, and glue recycling 2.9kb segments are inserted into pMWK-ppc-
The SacI/XbaI sites of aspA-pntAB obtain pThr plasmids, plasmid map such as Fig. 3.
2nd, L-threonine-producing strain ferments
(1) pThr and/or pTrc-ybaS plasmids are transferred in MG1655 competent cells, obtain MG1655/pThr
(control), MG1655/pThr/pTrc-ybaS bacterial strains, the picking single bacterium colony from tablet are inoculated in 4ml (50 μ g/ containing kanamycins
Ml) and/or in the LB test tubes of ammonia benzyl mycin (100 μ g/ml), 37 DEG C are incubated overnight；
(2) will be incubated overnight bacterium solution takes 1ml switchings mould in 50ml kanamycins containing LB (50 μ g/ml) and/or ammonia benzyl respectively
In plain (100 μ g/ml)+20g/L (final concentration) glucose, while 0.1mM IPTG inductions are added, under the conditions of 37 DEG C, 200r/m trainings
48h is supported, fermentation ends measure bacterium is dense, while bacterium solution centrifuging and taking supernatant is taken to carry out HPLC measure to threonine content, the results are shown in Table
7。
HPLC detection methods are as follows：
Chromatographic condition：Agilent XDB-C8 (150mm) neutrality pillar, Detection wavelength 334nm, column temperature：35℃.
Derivating agent is configured：0.3430g o-phthalaldehyde+5ml absolute ethyl alcohol+0.1472gN- acetyl-L cysteines are taken, are used
0.05mol/L borate buffers (PH=9.5) are fixed molten to 50ml, are protected from light spare.
Mobile phase A：A certain amount of sodium acetate is weighed, is made into the buffer solution 1000ml of 0.05mol/L.
Mobile phase B：Methanol
Derivative program：
Draw0.0ul from Vial91；
Draw6.0ul from Vial92；
Draw0.0ul from Vial91；
Draw3.0ul from Vial94；
Draw0.0ul from Vial92；
Mix9.0ul in air rept2times in200ul/min；
Draw4.0ul from Vial93；
Draw0.0ul from Vial91；
Draw2.0ul from Sample；
Draw0.0ul from Vial91；
Mix15.0ul in air rept6times in200ul/min；
Wait2.0min；
Inject；
Wherein No. 91 are distilled water, and No. 92 are borate buffer (ph=9.5), and No. 93 are derivating agent, and No. 94 are distilled water.
Gradient elution program：
Data acquisition time 18min.
Shake-flask seed culture medium such as table 6.
Table 6
| Title | Dosage (g/L) |
| Glucose | 20 |
| Peptone (OXOID) | 10 |
| Yeast extract (OXOID) | 5 |
| Sodium chloride | 10 |
| pH | 7.0 |
Table 7 is overexpressed ybaS to the influence of thalline L-threonine-producing strain
| Strain name | OD600 | L-threonine (g/L) |
| MG1655/pThr | 3.42 | 0.046 |
| MG1655/pThr/pTrc-ybaS | 4.14 | 0.052 |
By table 7 as it can be seen that being overexpressed the yield of the L-threonine production bacterium production L-threonine of ybaS increases, increase about 1.13
Times.Be overexpressed ybaS has certain promotion to the growing multiplication of thalline.
All references mentioned in the present invention is incorporated herein by reference, independent just as each document
It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can
To be made various changes or modifications to the present invention, such equivalent forms equally fall within the model that the application the appended claims are limited
It encloses.
Claims (6)
- A kind of 1. method for improving l-amino acid yield, which is characterized in that the method includes：It is carried in l-amino acid produces bacterium The expression of high glutaminase YbaS or activity；The bacterial strain is cultivated, so as to produce l-amino acid；The l-amino acid includes： L-lysine, L-Trp, L-threonine.
- 2. the method as described in claim 1, which is characterized in that the method includes：(a) a kind of recombinant plasmid is provided, is contained in the recombinant plasmid comprising a recombinant expression cassettes, the recombinant expression cassettes：Paddy ammonia Amidase YbaS encoding genes；With(b) the recombinant plasmid transformed l-amino acid of (a) is produced into bacterium, so as to improve the expression of glutaminase YbaS or activity；(c) (b) bacterial strain is cultivated, so as to produce l-amino acid.
- 3. method as claimed in claim 2, which is characterized in that the l-amino acid is L-lysine, and L-lysine produces Bacterium is Escherichia coli；OrThe l-amino acid is L-Trp, and L-Trp production bacterium is CIBTS2；OrThe l-amino acid is L-threonine, and L-threonine production bacterium is comprising ppc, aspA, pntAB, Pthr, thrA* base The Escherichia coli of cause.
- 4. method as claimed in claim 3, which is characterized in that the L-lysine-producing bacteria be comprising pDCtet plasmids and The Escherichia coli of pDCkan plasmids.
- 5. method as described in any one of claims 1-3, which is characterized in that the l-amino acid production bacterium is MG1655.
- 6. the purposes of glutaminase YbaS, which is characterized in that for improving l-amino acid yield, the l-amino acid packet It includes：L-lysine, L-Trp, L-threonine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310566206.6A CN104630300B (en) | 2013-11-13 | 2013-11-13 | A kind of l-amino acid production method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310566206.6A CN104630300B (en) | 2013-11-13 | 2013-11-13 | A kind of l-amino acid production method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104630300A CN104630300A (en) | 2015-05-20 |
| CN104630300B true CN104630300B (en) | 2018-06-22 |
Family
ID=53209544
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310566206.6A Active CN104630300B (en) | 2013-11-13 | 2013-11-13 | A kind of l-amino acid production method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104630300B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105647912A (en) * | 2014-12-01 | 2016-06-08 | 清华大学 | Acid resistance expression cassette and screening method thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1502689A (en) * | 2002-11-26 | 2004-06-09 | ֮����ʽ���� | Method for prodcing L-glutamine and L-glutamine producing bacterium |
| CN1898392A (en) * | 2003-12-24 | 2007-01-17 | 德古萨股份公司 | Process for preparing l-amino acids using strains of the enterobacteriaceae family |
| CN1910274A (en) * | 2004-01-23 | 2007-02-07 | 德古萨股份公司 | Process for the preparation of l-amino acids using strains of the enterobacteriaceae family |
| CN101235401A (en) * | 2007-02-02 | 2008-08-06 | 上海祥韦思化学品有限公司 | Fermentation method for preparing L-amino acid |
| CN102140431A (en) * | 2010-12-21 | 2011-08-03 | 大成生化科技(松原)有限公司 | L-tryptophan gene engineering bacterium, method for constructing same and method for fermenting and producing L-tryptophan by using same |
| CN102741420A (en) * | 2008-05-22 | 2012-10-17 | 味之素株式会社 | Method for production of L-amino acid |
-
2013
- 2013-11-13 CN CN201310566206.6A patent/CN104630300B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1502689A (en) * | 2002-11-26 | 2004-06-09 | ֮����ʽ���� | Method for prodcing L-glutamine and L-glutamine producing bacterium |
| CN1898392A (en) * | 2003-12-24 | 2007-01-17 | 德古萨股份公司 | Process for preparing l-amino acids using strains of the enterobacteriaceae family |
| CN1910274A (en) * | 2004-01-23 | 2007-02-07 | 德古萨股份公司 | Process for the preparation of l-amino acids using strains of the enterobacteriaceae family |
| CN101235401A (en) * | 2007-02-02 | 2008-08-06 | 上海祥韦思化学品有限公司 | Fermentation method for preparing L-amino acid |
| CN102741420A (en) * | 2008-05-22 | 2012-10-17 | 味之素株式会社 | Method for production of L-amino acid |
| CN102140431A (en) * | 2010-12-21 | 2011-08-03 | 大成生化科技(松原)有限公司 | L-tryptophan gene engineering bacterium, method for constructing same and method for fermenting and producing L-tryptophan by using same |
Non-Patent Citations (4)
| Title |
|---|
| L-glutamine provides acid resistance for Escherichia coli through enzymatic release of ammonia;Peilong Lu et al.,;《Cell Research》;20130122;第23卷;635-644 * |
| L-苏氨酸发酵过程中乙酸的控制;胡丹等;《发酵科技通讯》;20121031;第41卷;4-8 * |
| 代谢副产物乙酸对L-色氨酸发酵的影响;程立坤等;《微生物学通报》;20100220;第37卷(第2期);166-173 * |
| 重组大肠杆菌高密度发酵过程中乙酸的控制;薛文娇等;《陕西农业科学》;20111231;46-49 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104630300A (en) | 2015-05-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6961819B2 (en) | Recombinant bacteria that produce L-lysine, its construction method and L-lysine production method | |
| CN104862329B (en) | L-threonine genetic engineering produces bacterium | |
| ES2399943T3 (en) | Procedure to produce isobutanol | |
| CN103981203B (en) | 5 amino-laevulic acid superior strains and its preparation method and application | |
| TWI583790B (en) | A microorganism of genus corynebacterium having an ability to produce l-arginine and a method for producing l-arginine using the same | |
| JP2021500914A5 (en) | ||
| BRPI0903495B1 (en) | mutant microorganisms capable of producing putrescine and method for producing putrescine using the same | |
| CN111019878B (en) | Recombinant escherichia coli with improved L-threonine yield as well as construction method and application thereof | |
| JP2004261150A (en) | Method for producing objective material | |
| JPS6279788A (en) | Production of amino acid | |
| JP2001136991A (en) | Method for producing l-amino acid by fermentation method | |
| CN104878034B (en) | L-lysine genetic engineering produces bacterium | |
| CN110272857B (en) | Beta-alanine producing strain and its preparation method and use | |
| JP5227789B2 (en) | Method for fermentative production of L-amino acids | |
| JP6431205B2 (en) | Novel lysine decarboxylase and method for producing cadaverine using the same | |
| WO2022174597A1 (en) | Genetically engineered bacterium for producing l-sarcosine, construction method therefor and use thereof | |
| CN109321590A (en) | Utilize the genetic engineering bacterium and its construction method of acetic acid production Pfansteihl and application | |
| CN109294966A (en) | A kind of the Corynebacterium glutamicum recombinant bacterium and its construction method of high yield L-Leu | |
| CN104928226A (en) | Recombined corynebacterium glutamicum and application of corynebacterium glutamicum to 5-aminolevulinic acid production | |
| CN109182283A (en) | The amino acid dehydrogenase of NADH dependence and its application in raising lysine production | |
| Haselkorn et al. | The Rhodobacter capsulatus genome | |
| RU2288265C2 (en) | Method for preparing l-threonine | |
| JP2000189169A (en) | L-glutamate productive bacterium and production of l- glutamic acid | |
| CN104630300B (en) | A kind of l-amino acid production method | |
| JP2000106869A (en) | L-glutamic acid-producing bacterium and production of l-glutamic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200525 Address after: 200032 building 4, No. 300 Fenglin Road, Xuhui District, Shanghai Co-patentee after: SHANGHAI RESEARCH AND DEVELOPMENT CENTER OF INDUSTRIAL BIOTECHNOLOGY Patentee after: Center for excellence and innovation in molecular plant science, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Co-patentee before: SHANGHAI RESEARCH AND DEVELOPMENT CENTER OF INDUSTRIAL BIOTECHNOLOGY Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |