JP2000106869A - L-glutamic acid-producing bacterium and production of l-glutamic acid - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing L-glutamic acid efficiently at a low cost through obtaining L-glutamic acid-producing bacteria having the high ability to produce L-glutamic acid. SOLUTION: This method for producing L-glutamic acid comprises culturing in a medium such microorganisms as to belong to the genus Klebsiella, Erwinia or Pantoea and have the ability to produce L-glutamic acid and obtain the L-glutamic acid thus produced from the resulting culture solution; wherein the strain to be used is preferably such one as to decline or lack in the activity of an enzyme catalyzing the reaction for producing compounds other than L- glutamic acid through branching from the L-glutamic acid biosynthesis route, or be raised in the activity of an enzyme catalyzing the L-glutamic acid biosynthesis.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel L-glutamic acid-producing bacterium and a method for producing L-glutamic acid by a fermentation method using the same. L-glutamic acid is a food,
It is an important amino acid for pharmaceuticals.

[0002]

2. Description of the Related Art Conventionally, L-glutamic acid is mainly produced by a fermentation method using a so-called coryneform L-glutamic acid-producing bacterium belonging to the genus Brevibacterium, Corynebacterium or Microbacterium, or a mutant thereof. (Amino Acid Fermentation, Academic Press, 19
5-215, 1986). As a method for producing L-glutamic acid by fermentation using other strains, methods using microorganisms such as Bacillus, Streptomyces, Penicillium (US Pat. No. 3,220,929), Pseudomonas, Arthro A method using microorganisms such as Bacter, Serratia, Candida (US Pat.
563,857) and a method using a mutant strain of Escherichia coli (Japanese Patent Application Laid-Open No. 5-244970).

[0003] Although the productivity of L-glutamic acid has been considerably increased due to the improvement of the breeding and production methods of the microorganisms as described above, in order to respond to a further increase in demand in the future, a more inexpensive and efficient method is required. There is a need for the development of a method for producing L-glutamic acid.

[0004]

An object of the present invention is to find a novel L-glutamic acid-producing bacterium having a high L-glutamic acid-producing ability and to develop an inexpensive and efficient method for producing L-glutamic acid. is there.

[0005]

Means for Solving the Problems In order to solve the above problems, the present inventors have extensively searched and studied microorganisms different from conventional microorganisms and capable of producing L-glutamic acid. As a result, it has been found that a derivative derived from a microorganism belonging to the genus Klebsiella or the genus Erwinia has a high L-glutamic acid-producing ability, and the present invention has been completed.

That is, the present invention is as follows. (1) A microorganism belonging to the genus Klebsiella, the genus Erwinia or the genus Pantoea, and having an ability to produce L-glutamic acid. (2) The microorganism of (1) belonging to Klebsiella planticola or Pantoea agglomerans. (3) The microorganism according to (1) or (2), wherein the activity of an enzyme that catalyzes a biosynthesis reaction of L-glutamic acid is enhanced. (4) The enzymes that catalyze the biosynthesis reaction of L-glutamic acid include citrate synthase (hereinafter abbreviated as “CS”), phosphoenol pyruvate carboxylase (hereinafter “P
The microorganism according to (3), which is selected from EPC) and glutamate dehydrogenase (hereinafter abbreviated as "GDH"). (5) The microorganism according to (4), wherein the enzymes that catalyze the biosynthesis reaction of L-glutamic acid are all CS, PEPC, and GDH. (6) L-glutamic acid is synthesized from L-glutamic acid biosynthetic pathway
The microorganism according to any one of (1) to (5), wherein the activity of an enzyme that catalyzes a reaction for producing a compound other than glutamic acid is reduced or deficient. (7) L-glutamic acid is diverged from the biosynthetic pathway to
An enzyme that catalyzes a reaction for producing a compound other than glutamic acid is α-ketoglutarate dehydrogenase (hereinafter “αK
GDH "). (8) The microorganism of any of (1) to (7) is cultured in a liquid medium, L-glutamic acid is produced and accumulated in the medium, and the L-glutamic acid is collected from the medium. Manufacturing method.

[0007]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.
Microorganisms belonging to the genus Klebsiella, Erwinia or Pantoea used in the present invention include the following.

[0008] Klebsiella planticola
ella planticola) Klebsiella terrigena (K. terrigena) Erwinia herbicola (currently classified as Pantoea agglomerans) E. ananas (E. ananas) E. cacticida (E. cacticida) (E. chrysanthemi) E. mallotivora (E. mallotivora) E. persicinus (E. persicinus) E. psidii (E. psidii) Er. (E. rubrifaciens) Erwinia salicis (E. salicis) Erwinia uredovora (E. uredovora) Pantoea agglomerans (Pantoea agglomerans) Pantoea dispersa (P. dispersa)

More preferably, the following strains can be mentioned. Klebsiella Planticola AJ13399 Ervinia Herbicola IAM1595 (Pantair Agglomerans AJ2666)

[0010] Klebsiella Planticola AJ1
3399 was granted the accession number FERM P-
Deposit No. 16646, transferred to the International Deposit under the Budapest Treaty on January 11, 1999, and
ERM BP-6616 has been granted. Microorganisms that had been classified as Erwinia herbicola are now classified as Pantoea agglomerans. Therefore, Ervinia Herbicola IAM1595 was named Pantoea Agglomerans AJ2666, and was deposited on February 25, 1999 as an international deposit based on the Budapest Treaty with the Institute of Biotechnology, Ministry of Industry and Industry, under the accession number FERM BP- 6660 is provided.

Klebsiella Planticola AJ1
The 3399 strain is a strain isolated from the soil in Sapporo, Hokkaido. The physiological properties of AJ13399 are described below.

(1) Cell shape: Bacillus (2) Motility: None (3) Spores: None (4) Colony morphology on LabM nutrient agar: circular
The surface is smooth, creamy, smooth, raised and shiny. (5) Glucose OF test: Fermentation ability positive (6) Gram staining: negative (7) Behavior against oxygen: facultative anaerobic (8) Catalase: positive (9) Oxidase: negative (10) Urease: positive

(11) cytochrome oxidase: negative (12) β-galactosidase: positive (13) arginine dehydratase: negative (14) ornithine decarboxylase: negative (15) lysine decarboxylase: positive (16) tryptophan deaminase: negative (17) ) Foges-Proscowell test: positive (18) Indole formation: positive (19) Hydrogen sulfide generation in TSI medium: negative

(21) M-hydroxybenzene acid assimilation: negative (22) Gelatin liquefaction: negative (23) Production of acid from sugar Glucose: positive mannitol: positive Rhamnose: positive arabinose: positive sucrose: positive sorbitol : Positive inositol: Positive melibiose: Positive Amygdalin: Positive Adonitol-Peptone-Water: Positive Cellobiose-Peptone-Water: Positive Durucitol-Peptone-Water: Negative Raffinose-Peptone-Water: Positive (24) ℃ cannot grow

From these mycological properties, AJ13399
Was determined to be Klebsiella Planticola.

Bergey's Manual of Determinative Bacte
In the ninth edition of riology, there is no Erwinia harbicola, and microorganisms that were conventionally classified as Erwinia harbicola are classified as Pantoea agglomerans. As described above, the genus Erwinia and the genus Pantoea are very closely related, and in the present invention, any of the genus Erwinia and the genus Pantoea can be used.

The metabolism of sugar by bacteria belonging to the genus Klebsiella, Erwinia or Pantoea is carried out via the Emden-Meyerhof pathway, and pyruvate produced in the pathway is subjected to the tricarboxylic acid cycle under aerobic conditions. Is oxidized. L-glutamic acid is biosynthesized by GDH or glutamine synthetase / glutamic acid synthase from α-ketoglutarate, which is an intermediate in the tricarboxylic acid cycle. Thus, the L-glutamic acid biosynthetic pathway is common in these microorganisms, and in the present invention, microorganisms belonging to the genus Klebsiella, Ervinia or Pantoea form a single concept. Therefore, microorganisms belonging to the genus Klebsiella, Erwinia or Pantoea other than the above-mentioned species or strains are also included in the present invention.

The microorganism of the present invention is a microorganism belonging to the genus Klebsiella, Erwinia or Pantoea as described above, and is a microorganism having an ability to produce L-glutamic acid. Here, “has the ability to produce L-glutamic acid” means that it has the ability to accumulate L-glutamic acid in the medium when cultured. This L-glutamic acid-producing ability may be a property of a wild strain,
It may be a property imparted or enhanced by breeding. Among microorganisms belonging to the genus Klebsiella, the genus Erwinia or the genus Pantoea, the microorganisms having an ability to produce L-glutamic acid include, for example, microorganisms having an enhanced activity of an enzyme that catalyzes the biosynthesis reaction of L-glutamic acid, or microorganisms having an increased activity of L-glutamic acid. Microorganisms in which the activity of an enzyme that catalyzes a reaction that produces a compound other than L-glutamic acid by branching off from the synthesis pathway is reduced or deleted are exemplified. Also,
The activity of the enzyme that catalyzes the biosynthesis reaction of L-glutamic acid is increased, and the activity of the enzyme that catalyzes the reaction that produces a compound other than L-glutamic acid by branching off from the biosynthesis pathway of L-glutamic acid is reduced or defective. Microorganisms are also included.

The enzymes that catalyze the biosynthesis of L-glutamic acid include GDH, glutamine synthetase, glutamate synthase, isocitrate dehydrogenase,
Aconitate hydratase, CS, PEPC, pyruvate dehydrogenase, pyruvate kinase, enolase, phosphoglyceromutase, phosphoglycerate kinase, glyceraldehyde-3-phosphate dehydrogenase, triosephosphate isomerase, fructosebisphosphate aldolase, phosphofructokinase , Glucose phosphate isomerase and the like. Among these enzymes, one, two or three of CS, PEPC and GDH are preferred. Further, in the microorganism of the present invention, it is preferable that the activities of all three enzymes, CS, PEPC and GDH, are enhanced.
The increase in the activity of the target enzyme in the cells and the degree of the increase are confirmed by measuring the enzyme activity of the microbial cell extract or purified fraction and comparing it with the wild-type or parent strain. be able to.

Microorganisms belonging to the genus Klebsiella, Erwinia or Pantoea and having enhanced activity of an enzyme that catalyzes the biosynthesis reaction of L-glutamic acid include, for example, those microorganisms which are used as a starting parent strain and which encode these enzymes. The gene can be obtained as a mutant strain in which a gene is mutated or as a genetically modified strain.

In order to enhance CS, PEPC or GDH activity, a gene encoding CS, PEPC or GDH is cloned on an appropriate plasmid, and the obtained plasmid is used to transform the starting parent strain as a host. I just need. The copy number of the gene encoding CS, PEPC or GDH (hereinafter, abbreviated as "gltA gene", "ppc gene", and "gdhA gene" in this order) in the cells of the transformed strain is increased. CS,
PEPC or GDH activity is increased.

The cloned gltA gene, pp
The c gene and the gdhA gene are introduced into the starting parent strain alone or in any combination of two or three. When introducing two or three types of genes, two or three types of genes may be cloned on one type of plasmid and introduced into a host, or two or three types of compatible plasmids may be introduced. Cloned separately and introduced into a host.

The above-mentioned plasmid is not particularly limited as long as it is a plasmid autonomously replicable in the cells of microorganisms belonging to the genus Klebsiella, Erwinia or Pantoea, but, for example, pUC19, pUC18, pBR322, pHSG299, pHS
G298, pHSG399, pHSG398, RSF1010, pMW119, pMW118, p
MW219, pMW218 and the like. Other phage DNA
Vectors are also available.

Transformation can be performed, for example, by the method of DMMorrison (Methods in Enzymology 68, 326 (1979)) or a method of treating recipient cells with calcium chloride to increase DNA permeability (Mandel, M. and Higa, A ., J. Mol. Biol., 53, 159
(1970)).

[0025] Enhancing CS, PEPC or GDH activity can be accomplished by the gltA gene, the ppc gene or the gdhA gene.
The gene can also be achieved by allowing multiple copies of the gene to be present on the chromosomal DNA of the starting parent strain as a host. To introduce multiple copies of the gltA gene, the ppc gene, or the gdhA gene on the chromosomal DNA of a microorganism belonging to the genus Klebsiella, Erwinia or Pantoea,
Sequences present in multiple copies on chromosomal DNA, such as repetitive DNA and inverted repeats present at the end of transposable elements, can be used. Alternatively, the gltA gene,
It is also possible to mount the ppc gene or the gdhA gene on a transposon, transfer it, and introduce multiple copies on chromosomal DNA. G in the cells of the transformed strain
The copy number of the ltA, ppc, or gdhA gene is increased, resulting in CS, PEPC or GD
H activity is increased.

The gltA gene that increases copy number, p
The organism serving as a source of the pc gene or the gdhA gene may be any organism having CS, PEPC or GDH activity. Bacteria that are prokaryotes, such as Enterobacter, Klebsiella,
Erwinia, Pantoea, Serratia, Escherichia, Corynebacterium, Brevibacterium,
Bacteria belonging to the genus Bacillus are preferred. A specific example is Escherichia coli. The gltA gene, the ppc gene, and the gdhA gene can be obtained from chromosomal DNA of a microorganism as described above.

The gltA gene, ppc gene, and g
The dhA gene is CS, PEPC or GDH, respectively.
It can be obtained by isolating a DNA fragment that complements the auxotrophy from the chromosomal DNA of the microorganism using a mutant strain lacking the activity. The nucleotide sequences of these genes of Escherichia bacteria and those of Corynebacterium bacteria have already been determined (Bi
Chemistry, Vol. 22, 5243-5249
1983; Biochem. , Vol. 95, 9
09-916, 1984; Gene, 27, 1
93-199, 1984; Microbilog
y, 140, 1817-1828, 1994;
Mol. Gen. Genet. 218, 330-
339, 1989; Molecular Micr
obiology, Vol. 6, pp. 317-326, 199
2 years), it is possible to synthesize primers based on the respective nucleotide sequences and obtain them by PCR using chromosomal DNA as a template.

The CS, PEPC or GDH activity can be enhanced by enhancing the expression of the gltA gene, the ppc gene or the gdhA gene in addition to the gene amplification described above. For example, expression is enhanced by replacing the promoter of the gltA gene, ppc gene, or gdhA gene with another stronger promoter. For example, lac promoter, trp promoter, trc promoter, ta
c promoter, P _R promoter of lambda phage,
The P _L promoter and the like are known as strong promoters. The gltA gene with the promoter replaced, p
The pc gene or the gdhA gene is cloned into a plasmid and introduced into the host microorganism, or the chromosomal DNA of the host microorganism using repetitive DNA, inverted repeat, transposon, or the like.
Introduced above.

To enhance CS, PEPC or GDH activity, the promoter of the gltA gene, ppc gene or gdhA gene on the chromosome is replaced by a stronger promoter than those (WO 87/03006).
Or the insertion of a strong promoter upstream of the coding sequence for each gene (see Gene, 29, (1984) 231-241). it can. Specifically, a DN containing a gltA gene, a ppc gene or a gdhA gene or a part thereof replaced with a strong promoter
The homologous recombination may be caused between A and the corresponding gene on the chromosome.

Specific examples of microorganisms belonging to the genus Klebsiella, Erwinia or Pantoea having enhanced CS, PEPC or GDH activity include Klebsiella planticola AJ13399 / RSFCPG and Ervinia herbicola IAM1595 / RSFCPG.

Examples of enzymes that catalyze the reaction that diverges from the L-glutamic acid biosynthetic pathway to produce a compound other than L-glutamic acid include αKGDH, isocitrate lyase, phosphate acetyltransferase, acetate kinase, acetohydroxy acid synthase, and the like. Acetolactate synthase, formate acetyltransferase, lactate dehydrogenase, L-glutamate decarboxylase, 1-
And pyrroline dehydrogenase. Of these enzymes, αKGDH is preferred.

In a microorganism belonging to the genus Klebsiella, Erwinia or Pantoea, the activity of the above enzyme can be reduced or deleted by a conventional mutation treatment method or a genetic engineering technique. Alternatively, a mutation may be introduced such that the activity of the enzyme in the cell is reduced or deleted.

As a mutation treatment method, for example, a method of irradiating X-rays or ultraviolet rays, or N-methyl-N'-nitro-
There is a method of treating with a mutagen such as N-nitrosoguanidine. The site where the mutation is introduced into the gene may be a coding region encoding an enzyme protein or an expression control region such as a promoter.

[0034] Examples of genetic engineering techniques include, for example, methods using gene recombination, transduction, cell fusion and the like. For example, a drug resistance gene is inserted into the cloned target gene to produce a gene that has lost its function (defective gene). Next, the defective gene is introduced into cells of a microorganism belonging to the genus Klebsiella, Erwinia or Pantoea, and the target gene on the chromosome is replaced with the defective gene using homologous recombination (gene disruption).

The activity of the target enzyme in the cell is reduced or deficient, and the degree of the decrease is determined by measuring the enzyme activity of the cell extract or purified fraction of the candidate strain, and comparing with the wild strain or the parent strain. It can be confirmed by comparing. For example, αKGDH activity can be determined by the method of Reed et al. (LJRe
ed and BBMukherjee, Methods in Enzymology 1969,1
3, p.55-61).

Depending on the target enzyme, the target mutant can be selected according to the phenotype of the mutant.
For example, a mutant strain in which αKGDH activity is deficient or reduced cannot grow on a minimal medium containing glucose or a minimal medium containing acetic acid or L-glutamic acid as a sole carbon source under aerobic culture conditions, or has a growth rate of less. It decreases significantly. However, even under the same conditions, normal growth becomes possible by adding succinic acid or lysine, methionine, and diaminopimelic acid to a minimal medium containing glucose. Using these phenomena as indicators, it is possible to select mutant strains in which αKGDH activity is deficient or reduced.

The method for producing the αKGDH gene-deficient strain of Brevibacterium lactofermentum utilizing homologous recombination is described in detail in WO95 / 34672, and is applicable to microorganisms belonging to the genus Klebsiella, Erwinia or Pantoea. A similar method can be applied.

Other techniques such as gene cloning, DNA cleavage, ligation, and transformation methods are described in Molecula.
r Cloning, 2nd edition, Cold Spring Harbor press
(1989)).

As a specific example of the mutant strain in which αKGDH activity is deficient or reduced as described above, Klebsiella planticola AJ13410 can be mentioned. Klebsiella Planticola AJ1341
0 was submitted to the Research Institute of Biotechnology, Industrial Technology Institute of the Ministry of International Trade and Industry on February 19, 1998, under the accession number FERM P-166.
No. 47, transferred to an international deposit under the Budapest Treaty on January 11, 1999, and received accession number FERM.
BP-6617 is provided.

A strain belonging to the genus Klebsiella, Erwinia or Pantoea, in which αKGDH activity is reduced or deficient as described above, or a strain in which CS, PEPC or GDH activity is increased, as described in Examples below, It has the ability to produce L-glutamic acid.

With respect to microorganisms belonging to the genus Escherichia, which is included in the same group of intestinal bacteria as the genus Klebsiella, Erwinia or Pantoea, a strain in which αKGDH activity is reduced or deficient can produce L-glutamic acid (Japanese Unexamined Patent Publication No. 244970), that a strain in which αKGDH activity is reduced or deficient, and in which PEPC activity and GDH activity are enhanced can produce an even greater amount of L-glutamic acid (JP-A-7-203980), and That the strain having enhanced CS activity and GDH activity can produce L-glutamic acid (WO97 / 08294)
It has been known.

Also, with respect to microorganisms belonging to the genus Enterobacter, which are also included in the intestinal bacteria group, strains having reduced or deficient αKGDH activity, PEPC activity,
The present inventors have discovered that a strain having enhanced GDH activity and CS activity can produce L-glutamic acid (Japanese Patent Application No. 10-69068).

Furthermore, with respect to microorganisms belonging to the genus Serratia, the inventors have found that a strain having enhanced PEPC activity, GDH activity, and CS activity can produce L-glutamic acid (Japanese Patent Application No. 10-69068). issue).

Based on these facts, αKGDH activity is reduced or deficient not only for the strains shown in Examples but also for other microorganisms of the genus Klebsiella, Erwinia, Pantoea, Escherichia, Enterobacter, or Serratia. It is easily inferred that the strain obtained or the strain in which the PEPC activity, the GDH activity and the CS activity are amplified can produce L-glutamic acid. Further, as shown in the Examples, by deleting αKGDH, L-kappa planta was transformed into Klebsiella planticola AJ13399 strain.
It is strongly supported that the ability to impart glutamate can be applied to other bacteria of the genus Klebsiella, Erwinia or Pantoea.

A microorganism belonging to the genus Klebsiella, Erwinia or Pantoea and having the ability to produce L-glutamic acid is cultured in a liquid medium, L-glutamic acid is produced and accumulated in the medium, and the L-glutamic acid is collected from the medium.
L-glutamic acid can be produced. As the medium, a normal nutrient medium containing a carbon source, a nitrogen source, inorganic salts, and if necessary, organic trace nutrients such as amino acids and vitamins can be used. Either a synthetic medium or a natural medium can be used. The carbon source and nitrogen source used in the medium may be those available for the strain to be cultured.

As the carbon source, sugars such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolyzate, molasses and the like are used. In addition, organic acids such as acetic acid, citric acid and the like can be used alone or in addition. It is used in combination with a carbon source.

As the nitrogen source, ammonia, ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate and ammonium acetate, nitrates and the like are used.

As organic micronutrients, amino acids, vitamins, fatty acids, nucleic acids, and peptones, casamino acids, yeast extracts, soybean protein decomposed products containing these, and the like are used. When a sex mutant is used, it is necessary to supplement the required nutrients.

As the inorganic salts, phosphates, magnesium salts, calcium salts, iron salts, manganese salts and the like are used.
As the culture method, aeration culture is performed while controlling the fermentation temperature to 20 to 42 ° C. and the pH to 4 to 8. By culturing for about 10 hours to 4 days, a remarkable amount of L
-Glutamic acid is accumulated.

After completion of the cultivation, L-glutamic acid accumulated in the culture solution may be isolated according to a known method. For example, it can be isolated by a method of removing the cells from the culture and then concentrating and crystallization, or by ion exchange chromatography.

[0051]

Next, the present invention will be described more specifically with reference to examples.

(1) Preparation of plasmid having gltA gene, ppc gene and gdhA gene The procedure for preparing plasmid having gltA gene, ppc gene and gdhA gene will be described with reference to FIGS.

A plasmid pBRGDH having a gdhA gene derived from Escherichia coli (Japanese Patent Laid-Open No. 7-2039)
No. 80) was digested with HindIII and SphI, and T4DN
After blunting both ends by A polymerase treatment, gd
The DNA fragment having the hA gene was purified and recovered. on the other hand,
GltA gene and ppc from Escherichia coli
Plasmid pMWCP having the gene (WO97 / 08
294) was digested with XbaI, and both ends were made blunt with T4 DNA polymerase. To this, the g purified above
After mixing the DNA fragments having the dhA gene, they were ligated with T4 ligase to obtain a plasmid pMWCPG further carrying the gdhA gene in pMWCP (FIG. 1).

Further, pBRGDH was converted to HindIII, S
DNA having gdhA gene obtained by digestion with all
After purifying and recovering the fragment, plasmid pMWWG was obtained by introducing it into HindIII and SalI sites of plasmid pMW219 (purchased from Nippon Gene Co., Ltd.) (FIG. 2). Furthermore, glt derived from Escherichia coli
Plasmid pTWVC carrying the A gene (WO97 / 0
No. 8294) was digested with HindIII and EcoRI, and the resulting DNA fragment having the gltA gene was purified and recovered, followed by HindIII and Ec of plasmid pMW219.
By introducing the plasmid pM
WC was obtained (FIG. 3).

At the same time, the broad host range plasmid RSF101
The plasmid pVIC40 having an origin of replication of 0 (Japanese Patent Laid-Open No. 08-047397) was digested with NotI, and T4 DNA was digested.
After digestion with PstI,
After BR322 was digested with EcoT141, treated with T4 DNA polymerase, and mixed with PstI digestion,
Plasmid R ligated by T4 ligase and having the RSF1010 origin of replication and the tetracycline resistance gene
SF-Tet was obtained (FIG. 4).

Next, pMWCPG was converted to EcoRI, Pst
I digestion and the gltA gene, ppc gene, and gd
The DNA fragment having the hA gene was purified and recovered, and RSF-
Tet was similarly digested with EcoRI and PstI, and RSF1 was digested.
After mixing with a purified and recovered DNA fragment having an origin of replication of 010, it was ligated with T4 ligase and RSF-Te
The gltA gene, ppc gene, and gdhA
The plasmid RSFCPG carrying the gene was obtained (FIG. 5). The expression of the gltA gene, the ppc gene, and the gdhA gene in the obtained plasmid RSFCPG was confirmed by the expression of the gltA gene of Escherichia coli, p.
Complementation of the auxotrophy of the pc gene or gdhA gene-deficient strain and the measurement of each enzyme activity were confirmed. Similarly, that pMWG or pMWC expresses the gdhA gene or the gltA gene was determined to be E. coli.
Complementation of the auxotrophy of the gdhA gene or gltA gene-deficient strain of E. coli was confirmed by measuring the activity of each enzyme.

(2) RSFCPG and pMWC against bacteria of the genus Klebsiella and Erwinia (Pantoea)
And evaluation of L-glutamic acid productivity using RSFCPG, pMWC and pMWG, using Erwinia herbicola IAM1595 (Pantair agglomerans AJ2666) or Klebsiella planticola AJ13399 strain, and electroporation (Miller JH, "A Short Course in Bacterial Genetic
s; Handbook "Cold Spring Harbor Laboratory Press,
USA, 1992) to obtain a transformant showing tetracycline resistance.

The obtained transformant or each parent strain was ligated with 40 g / L of glucose and 20 g / l of ammonium sulfate.
L, magnesium sulfate heptahydrate 0.5 g / L, potassium dihydrogen phosphate 2 g / L, sodium chloride 0.5 g / L, calcium chloride heptahydrate 0.25 g / L, ferrous sulfate heptahydrate 0. 02 g / L, manganese sulfate tetrahydrate 0.02 g / L,
Zinc sulfate dihydrate 0.72 mg / L, copper sulfate pentahydrate 0.6
Medium containing 4 mg / L, cobalt chloride hexahydrate 0.72 mg / L, boric acid 0.4 mg / L, sodium molybdate dihydrate 1.2 mg / L, yeast extract 2 g / L, calcium carbonate 30 g / L A 50 ml large test tube in which 5 ml was injected was inoculated, and cultured with shaking at 37 ° C. until the sugar in the medium was consumed. For the culture of the transformant,
25 mg / L of tetracycline was added. After the completion of the culture, the results of measurement of L-glutamic acid accumulated in the culture solution are shown in Table 1.

[0059]

Table 1 Table 1 L-glutamic acid accumulation 蓄積 Bacterial strain L-glutamic acid accumulation ─ ───────────────────────────── IAM1595 0.0g / L IAM1595 / RSFCPG 5.0 AJ13399 0.0 AJ13399 / RSFCPG 3. 1 AJ13399 / pMWC 2.5 AJ13399 / pMWG 0.8 Medium only 0.2 ───────────────────────────────

Ervinia Herbicola IAM159
5 or Klebsiella Planticola AJ13
399 strain did not accumulate L-glutamic acid,
In the strains in which CS, PEPC, and GDH activities were amplified by introducing FCPG, 5.0 g /
L, 3.1 g / L of L-glutamic acid was accumulated. Further, 2.5 g / L L-glutamic acid was accumulated by amplifying only the CS activity of AJ13399 strain, and 0.8 g / L L-glutamic acid was accumulated by amplifying only the GDH activity.

(3) Klebsiella planticola
Cloning of a fragment having a part of the αKGDH gene of the AJ13399 strain Klebsiella planticola A fragment having a part of the αKGDH gene of the AJ13399 strain was obtained from Azotobacter vinelandii whose base sequence has already been reported.
The αKGDH gene of each organism of Bacillus subtilis, Escherichia coli, Corynebacterium glutamicum, Haemophilus influenza, human, and Saccharomyces cerevisiae (Eur. J. Bioche)
m. 187, 235-239, 1990; M.
ol. Gen. Genet. , 234, 285-2
96, 1992; Eur. J. Biochem. ,
141, 351-359, 1984; Micr
obiology, Vol. 142, 3347-3354
Page, 1996; Science, 269, 496.
-512, 1995; Proc. Natl. Aca
d. Sci. U. S. A. 89, 1963-19
67, 1992; Mol. Cel. Biol. 9, Vol. 9, 2695-2705, 1989), and the cloning was carried out by PCR using oligonucleotides having homologous nucleotide sequences and EcoRI sites as primers. Specifically, the following primers were used.

(Primer 1) 5 'CCGGGAATTCGGTGACGTNAARTAYCA3' (SEQ ID NO: 1) (Primer 2) 5'GGCGAATTCGGGAACGGGTASAGYTGYTC3 '(SEQ ID NO: 2)

The chromosomal DNA of Klebsiella planticola AJ13399 strain used as a template for PCR is usually expressed in Escherichia coli by chromosomal DN.
A method similar to that used to extract A (Biotechnology Experiments, Japan Society for Biotechnology, 97-98, Baifukan, 1
992).

The PCR conditions were 94 ° C. for 1 minute, 50 ° C. for 1 minute.
The resulting DNA fragment was digested with EcoRI and inserted into EcoRI-digested vector plasmid pT7Blue to obtain a recombinant plasmid pT7KP. Vector plasmid pT7Blue
For (ampicillin resistance), a commercial product manufactured by Novagen was used.

The nucleotide sequence of the cloned fragment and the amino acid sequence encoded by this sequence are shown in SEQ ID NO: 3. Moreover, only the same amino acid sequence is represented by SEQ ID NO: 4
Shown in This sequence corresponds to αKGDH- of Escherichia coli.
It shows 82.3% homology with the E1 subunit gene (hereinafter referred to as "sucA gene"), and is apparently succi of Klebsiella planticola AJ13399 strain.
It is considered part of the A gene. In the base sequence shown in SEQ ID NO: 3, base numbers 18 to 1659 correspond to suc
Base number 0-17 and 1660-1 derived from A gene
679 is derived from the primer.

(4) Klebsiella Planticola
Acquisition of αKGDH-Deficient Strain Derived from AJ13399 Strain Using a fragment having a part of the sucA gene of Klebsiella planticola obtained as above, αKDH of Klebsiella planticola was homologously recombined.
A GDH-deficient strain was obtained.

First, pT7KP was digested with BstEII, and cloned into the plasmid pNEO (purchased from Pharmacia) by PCR, and BT was added to both ends.
The kanamycin resistance gene fragment into which the stEII site was introduced was introduced, and succi of Klebsiella planticola was introduced.
A plasmid pT7KPKm in which a kanamycin resistance gene was inserted at the center of the A gene was obtained. The primers used for cloning the kanamycin resistance gene are as follows.

(Primer 3) 5'TACTGGGTCACCTGACAGCTTATCATCGAT3 '(SEQ ID NO: 5) (Primer 4) 5'CGTTCGGTGACCACCAAAGCGGCCATCGTG3' (SEQ ID NO: 6)

Next, pT7KPKm was digested with KpnI, cloned into it by PCR from plasmid pBR322 (purchased from Takara Shuzo Co., Ltd.), and a tetracycline resistance gene fragment having KpnI sites introduced at both ends was introduced. Cola su
A plasmid pT7KPKmTc was obtained in which a kanamycin resistance gene was inserted at the center of the cA gene and a tetracycline resistance gene was inserted next to the kanamycin resistance gene. The primers used for cloning the tetracycline resistance gene are as follows.

(Primer 5) 5'GGGGTACCCAAATAGGCGTATCACGAG3 '(SEQ ID NO: 7) (Primer 6) 5'GGGGTACCCGCGATGGATATGTTCTG3' (SEQ ID NO: 8)

Subsequently, plasmid pT7KPKmTc was replaced with S
By digestion with acl and XbaI, a kanamycin resistance gene was inserted into the central part of the sucA gene of Klebsiella planticola, and a DNA fragment having a tetracycline resistance gene next to it was cut out, which was digested with SacI and XbaI. Chromosome insertion plasmid vector pGP704 (Marta He
rrero et al., Journal of Bacteriology, 1990, 172,
p.6557-6567) and the plasmid pUTONNOTK
I got

The resulting plasmid pUTONNOT
Using K, Klebsierra Planticola AJ1
The 3399 strain was transformed by electroporation to obtain a strain in which the plasmid pUTONNOTK was inserted on the chromosome by homologous recombination of the sucA gene fragment using tetracycline resistance and kanamycin resistance as indicators. Further, from this strain, su on the chromosome was determined using tetracycline sensitivity and kanamycin resistance as indices.
The sucA gene which is considered to have been replaced by the sucA gene with the kanamycin resistance gene inserted in the center of the cA gene
Defective strain Klebsiella planticola AJ1341
0 shares were acquired.

AJ13410 obtained as described above
To confirm that the strain lacks αKGDH activity, the method of Reed et al. (LJ Reed and BBMukherjee, Method
s inEnzymology 1969, 13, p.55-61). As a result, as shown in Table 2, AJ1341
In the 0 strain, αKGDH activity could not be detected.
It was confirmed that A was missing.

[0074]

Table 2 αKGDH activity ─────────────────────────── Strain αKGDH activity (ΔABS / min / mg protein) ──── ─────────────────────── AJ13399 0.101 AJ13410 <0.002 ─────────

(5) Klebsiella Planticola
Evaluation of L-glutamic acid productivity of αKGDH-deficient strain AJ13399 and AJ13410 were subjected to glucose 40 g / L, ammonium sulfate 20 g / L, magnesium sulfate heptahydrate 0.5 g / L, and potassium dihydrogen phosphate 2 g.
/ L, sodium chloride 0.5g / L, calcium chloride 7
Water salt 0.25 g / L, ferrous sulfate heptahydrate 0.02 g /
L, manganese sulfate tetrahydrate 0.02 g / L, zinc sulfate dihydrate 0.72 mg / L, copper sulfate pentahydrate 0.64 mg / L,
Cobalt chloride hexahydrate 0.72mg / L, boric acid 0.4m
g / L, sodium molybdate dihydrate 1.2 mg /
L, yeast extract 2 g / L, calcium carbonate 30 g / L,
L-lysine monohydrochloride 200 mg / L, L-methionine 2
00 mg / L, DL-α, ε-diaminopimelic acid (D
(AP) A 500 ml flask filled with 20 ml of a medium containing 200 mg / L was inoculated, and cultured with shaking at 37 ° C. until the sugar in the medium was consumed. After the culture, the results of measuring L-glutamic acid and α-ketoglutaric acid (hereinafter abbreviated as “αKG”) accumulated in the culture solution are shown in Table 3.

[0076]

Table 3 L-glutamic acid and αKG accumulation amount 量 Strain L-glutamic acid accumulation amount αKG Amount accumulated ────────────────────────────── AJ13399 0.0 g / L 0.0 g / L AJ13410 12.8 1.5 ──────────────────────────────

AJ13410 deficient in αKGDH activity
The strain accumulated 12.8 g / L of L-glutamic acid. At the same time, 1.5 g / L of αKG was accumulated.

(6) Klebsiella planticola α
Introduction of RSFCPG into KGDH-deficient strain and evaluation of L-glutamic acid productivity Transform AJ13410 strain using RSFCPG,
The obtained RSFCPG-introduced strain AJ13410 / RSFC
PG was converted to glucose 40 g / L, ammonium sulfate 20
g / L, magnesium sulfate heptahydrate 0.5 g / L, potassium dihydrogen phosphate 2 g / L, sodium chloride 0.5 g / L
L, calcium chloride heptahydrate 0.25 g / L, ferrous sulfate heptahydrate 0.02 g / L, manganese sulfate tetrahydrate 0.02 g
/ L, zinc sulfate dihydrate 0.72 mg / L, copper sulfate pentahydrate 0.64 mg / L, cobalt chloride hexahydrate 0.72 mg / L
L, boric acid 0.4 mg / L, sodium molybdate 2
Water salt 1.2 mg / L, yeast extract 2 g / L, tetracycline 25 mg / L, calcium carbonate 30 g / L, L-
Lysine monohydrochloride 200 mg / L, L-methionine 200
The medium was inoculated into a 500 ml flask into which 20 ml of a medium containing 200 mg / L of DL-α, ε-DAP was added and shake-cultured at 37 ° C. until the sugar in the medium was consumed. After completion of the culture, the results of measuring L-glutamic acid and αKG accumulated in the culture solution are shown in Table 4.

[0079]

Table 4 L-glutamic acid and αKG accumulation ─────────────────────────────────── strain L -Glutamic acid accumulation amount αKG accumulation amount Ａ AJ13410 12.8 g / L 5 g / L AJ13410 / RSFCPG 24.2 0.0 mm

Introducing RSFCPG, CS, PEPC,
And, in the strains in which GDH activity was amplified, the amount of accumulated αKG was decreased, and the accumulation of L-glutamic acid was further improved.

[0081]

EFFECT OF THE INVENTION Since the microorganism of the present invention has a high L-glutamic acid-producing ability, it is considered that a higher productivity can be imparted by using a conventionally known breeding technique for coryneform L-glutamic acid-producing bacteria. It is expected that studies on culture conditions and the like will lead to the development of an inexpensive and efficient method for producing L-glutamic acid.

[0082]

[Sequence List] SEQUENCE LISTING <110> Ajinomoto Co., Inc. <120> L-glutamic acid producing bacteria and method for producing L-glutamic acid <130> P-6323 <150> JP 10-69106 <151 > 1998-03-18 <150> JP 10-224909 <151> 1998-08-07 <160> 8 <170> PatentIn Ver. 2.0

<210> 1 <211> 27 <212> DNA <213> Artificial Sequence <220> <221> misc_feature <222> (19) <223> n = a or c or g or t <220> <223 > Description of Artificial Sequence: primer <400> 1 ccgggaattc ggtgacgtna artayca 27

<210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 2 ggcgaattcg ggaacgggta sagytgytc 29

<210> 3 <211> 1679 <212> DNA <213> Klebsiella planticola <220> <221> CDS <222> (1) .. (1679) <400> 3 ggt gac gtg aaa tat cac atg ggc ttc tct tct gac atg gaa acc gaa 48 Gly Asp Val Lys Tyr His Met Gly Phe Ser Ser Asp Met Glu Thr Glu 1 5 10 15 ggc ggc ctg gtg cac ctg gcg ctg gcg ttt aac ccg tca cac ctc Lea Val Gly His Leu Ala Leu Ala Phe Asn Pro Ser His Leu Glu 20 25 30 atc gtc agc ccg gtg gtt atc ggg tcg gtt cgc gcg cgt ctc gat cgt 144 Ile Val Ser Pro Val Val Ile Gly Ser Val Arg Ala Arg Leu Asp Arg 35 40 45 ctc gac gag ccg agc agc aat aaa gtg ctg ccg att act atc cac ggc 192 Leu Asp Glu Pro Ser Ser Asn Lys Val Leu Pro Ile Thr Ile His Gly 50 55 60 gac gcc gca gtg acg ggt cag ggc gtg gtt cagga ctg aac atg 240 Asp Ala Ala Val Thr Gly Gln Gly Val Val Gln Glu Thr Leu Asn Met 65 70 75 80 tcc aag gcg cgt ggc tac gaa gtg ggc gga acc gta cgt atc gtt atc 288 Ser Lys Ala Arg Gly Tyr Glu Val Gly Gly Thr Val Arg Ile Val Ile 85 90 95 aac aac cag gtg ggc ttc act acc tc g aac ccg ctg gat gcg cgc tcc 336 Asn Asn Gln Val Gly Phe Thr Thr Ser Asn Pro Leu Asp Ala Arg Ser 100 105 110 acg cca tac tgc acc gat atc ggt aaa atg gtt cag gcg ccg atc ttc 384 Thr Pro Tyr Cys Thr Asp Ile Gly Lys Met Val Gln Ala Pro Ile Phe 115 120 125 cac gtg aac gcg gac gat ccg gaa gcc gtt gct ttc gtt acc cgc ctg 432 His Val Asn Ala Asp Asp Pro Glu Ala Val Ala Phe Val Thr Arg Leu 130 135 140 gcg ctg gat ttc cgt aat acc ttc aaa cgc gat gtc ttc atc gac ctg 480 Ala Leu Asp Phe Arg Asn Thr Phe Lys Arg Asp Val Phe Ile Asp Leu 145 150 155 160 gtg tgc tac cgc cgt cac gc gac gac gac gac cat ccg agc gca 528 Val Cys Tyr Arg Arg His Gly His Asn Glu Ala Asp Glu Pro Ser Ala 165 170 175 acg cag ccg ctg atg tat cag aaa atc aaa aaa cat ccg acc ccg cgc 576 Thr Gln Pro Leu Met Tyr Gln Lys Ile Lys Lys His Pro Thr Pro Arg 180 185 190 aaa atc tac gcc gac aaa ctt gag cag gac aaa gtg tcg acc ctg gaa 624 Lys Ile Tyr Ala Asp Lys Leu Glu Gln Asp Lys Val Ser Thr Leu Glu 195 200 205 gat gcg acc gaa ctg gt t aac ctc tat cgt gat gcg ctg gat gcc ggc 672 Asp Ala Thr Glu Leu Val Asn Leu Tyr Arg Asp Ala Leu Asp Ala Gly 210 215 220 gaa tgc gtg gtt gag gaa tgg cgt ccg atg aac ctg gac tcc acct Val Val Glu Glu Trp Arg Pro Met Asn Leu His Ser Phe Thr 225 230 235 240 tgg tca ccg tac ctc aac cac gag tgg gat gag agc tac ccg agt aaa 768 Trp Ser Pro Tyr Leu Asn His Glu Trp Asp Glu Ser Tyr Pro Ser Lys 245 250 255 gtc gag atg aaa cgt ctg cag gag ctg gct aaa cgc att agc act gtg 816 Val Glu Met Lys Arg Leu Gln Glu Leu Ala Lys Arg Ile Ser Thr Val 260 265 270 270 ccg gac agc att gaa atg cag tc gcg aag att tat ggc gat 864 Pro Asp Ser Ile Glu Met Gln Ser Arg Val Ala Lys Ile Tyr Gly Asp 275 280 285 cgc cag gcg atg gcc gcc ggc gag aag ctg ttc gac tgg ggg gcg gcg 912 Arg Ala Ala Mla Glu Lys Leu Phe Asp Trp Gly Ala Ala 290 295 300 gaa aac ctg gct tac gcc acg ctg gtt gat gaa ggg att ccg att cgc 960 Glu Asn Leu Ala Tyr Ala Thr Leu Val Asp Glu Gly Ile Pro Ile Arg ct 310 310 tc c ggt gaa gac tcc ggt cgc ggt acg ttc ttc cac cgc cat tcc 1008 Leu Ser Gly Glu Asp Ser Gly Arg Gly Thr Phe Phe His Arg His Ser 325 330 335 gtg att cat aac cag gtg aac ggt tcg acc tac acg ccg cag cag cat 1056 Val Ile His Asn Gln Val Asn Gly Ser Thr Tyr Thr Pro Leu Gln His 340 345 350 gtg cat aac ggc cag gag cat ttc aaa gtc tgg gac tcc gtg ctt tct 1104 Val His Asn Gly Gln Glu His Phe Lys Val Trp Asp Ser Val Leu Ser 355 360 365 gaa gaa gcg gtg ctg gcg ttc gaa tac ggc tac gcc act gcg gaa ccg 1152 Glu Glu Ala Val Leu Ala Phe Glu Tyr Gly Tyr Ala Thr Ala Glu Pro 370 375 380 cgc t gg ga t at gcg cag ttc ggt gac ttt gct aac ggc 1200 Arg Thr Leu Thr Ile Trp Glu Ala Gln Phe Gly Asp Phe Ala Asn Gly 385 390 395 400 gct caa gtg gtg atc gat cag ttc atc agc tcc ggc gag cag aag tgg 1248 Val Ile Asp Gln Phe Ile Ser Ser Gly Glu Gln Lys Trp 405 410 415 ggc cgg atg tgt ggc ctg gtc atg ctg ctg ccg cac ggc tac gaa ggc 1296 Gly Arg Met Cys Gly Leu Val Met Leu Leu Pro His Gly Tyr 420 425 430 cag ggc ccg gag cac tcc tcc gcg cgt ctg gaa cgc tat ctg cag ctg 1344 Gln Gly Pro Glu His Ser Ser Ala Arg Leu Glu Arg Tyr Leu Gln Leu 435 440 445 tgt gct gaa cag aat tg cag cg tcg act ccg gct cag 1392 Cys Ala Glu Gln Asn Met Gln Val Cys Val Pro Ser Thr Pro Ala Gln 450 455 460 gtt tac cac atg ctg cgt cgt cag gcg ctg cgc ggt atg cgt cgt ccg 1440 Val Tyr His Met Leu Arg Arg Gln Ala Leu Arg Gly Met Arg Arg Pro 465 470 475 480 ctg gtg gtg atg tcg ccg aaa tct ctg ctg cgc cat ccg ctg gcg gtc 1488 Leu Val Val Met Ser Pro Lys Ser Leu Leu Aru His Pro Leu Ala t cc 490 490 ctg gac gag ctg gcg aac ggc acc ttc ctg ccg gcc atc ggt 1536 Ser Ser Leu Asp Glu Leu Ala Asn Gly Thr Phe Leu Pro Ala Ile Gly 500 505 510 gaa atc gat gac ctc gac ccg aaa gcg gtg gag cgt ggt cgt 1584 Glu Ile Asp Asp Leu Asp Pro Lys Ala Val Lys Arg Val Val Leu Cys 515 520 525 tct ggt aag gtt tat tac gat ctg ctg gaa caa cgc cgt aag aac gac 1632 Ser Gly Lys Val Tyr Tyr Asp Leu Leu Glu Gln Arg Arg Lys Asn Asp 530 535 540 caa aaa gat gtc gct atc gtg cgt ata gaa caa ctg tac ccg ttc cc 1679 Gln Lys Asp Val Ala Ile Val Arg Ile Glu Gln Leu Tyr Pro Phe 545 550 555

<210> 4 <211> 559 <212> PRT <213> Klebsiella planticola <400> 4 Gly Asp Val Lys Tyr His Met Gly Phe Ser Ser Asp Met Glu Thr Glu 1 5 10 15 Gly Gly Leu Val His Leu Ala Leu Ala Phe Asn Pro Ser His Leu Glu 20 25 30 Ile Val Ser Pro Val Val Ile Gly Ser Val Arg Ala Arg Leu Asp Arg 35 40 45 Leu Asp Glu Pro Ser Ser Asn Lys Val Leu Pro Ile Thr Ile His Gly 50 55 60 Asp Ala Ala Val Thr Gly Gln Gly Val Val Gln Glu Thr Leu Asn Met 65 70 75 80 Ser Lys Ala Arg Gly Tyr Glu Val Gly Gly Thr Val Arg Ile Val Ile 85 90 95 Asn Asn Gln Val Gly Phe Thr Thr Ser Asn Pro Leu Asp Ala Arg Ser 100 105 110 Thr Pro Tyr Cys Thr Asp Ile Gly Lys Met Val Gln Ala Pro Ile Phe 115 120 125 His Val Asn Ala Asp Asp Pro Glu Ala Val Ala Phe Val Thr Arg Leu 130 135 140 Ala Leu Asp Phe Arg Asn Thr Phe Lys Arg Asp Val Phe Ile Asp Leu 145 150 155 160 Val Cys Tyr Arg Arg His Gly His Asn Glu Ala Asp Glu Pro Ser Ala 165 170 175 Thr Gln Pro Leu Met Tyr Gln Lys Ile Lys Lys His Pro Thr Pro Arg 180 185 190 Lys Ile Tyr Ala Asp Lys Leu Glu Gln Asp Lys Val Ser Thr Leu Glu 195 200 205 Asp Ala Thr Glu Leu Val Asn Leu Tyr Arg Asp Ala Leu Asp Ala Gly 210 215 220 Glu Cys Val Val Glu Glu Trp Arg Pro Met Asn Leu His Ser Phe Thr 225 230 235 240 Trp Ser Pro Tyr Leu Asn His Glu Trp Asp Glu Ser Tyr Pro Ser Lys 245 250 255 Val Glu Met Lys Arg Leu Gln Glu Leu Ala Lys Arg Ile Ser Thr Val 260 265 270 Pro Asp Ser Ile Glu Met Gln Ser Arg Val Ala Lys Ile Tyr Gly Asp 275 280 285 285 Arg Gln Ala Met Ala Ala Gly Glu Lys Leu Phe Asp Trp Gly Ala Ala 290 295 300 Glu Asn Leu Ala Tyr Ala Thr Leu Val Asp Glu Gly Ile Pro Ile Arg 305 310 315 320 Leu Ser Gly Glu Asp Ser Gly Arg Gly Thr Phe Phe His Arg His Ser 325 330 335 Val Ile His Asn Gln Val Asn Gly Ser Thr Tyr Thr Pro Leu Gln His 340 345 350 Val His Asn Gly Gln Glu His Phe Lys Val Trp Asp Ser Val Leu Ser 355 360 365 Glu Glu Ala Val Leu Ala Phe Glu Tyr Gly Tyr Ala Thr Ala Glu Pro 370 375 380 Arg Thr Leu Thr Ile Trp Glu Ala Gln Phe Gly Asp Phe Ala Asn Gly 385 390 395 395 400 Ala Gln Val Val Ile Asp Gln Phe Ile Ser Ser Gly Glu Gln Lys Trp 405 410 415 Gly Arg Met Cys Gly Leu Val Met Leu Leu Pro His Gly Tyr Glu Gly 420 425 430 Gln Gly Pro Glu His Ser Ser Ala Arg Leu Glu Arg Tyr Leu Gln Leu 435 440 445 Cys Ala Glu Gln Asn Met Gln Val Cys Val Pro Ser Thr Pro Ala Gln 450 455 460 Val Tyr His Met Leu Arg Arg Gln Ala Leu Arg Gly Met Arg Arg Pro 465 470 475 480 480 Leu Val Val Met Ser Pro Lys Ser Leu Leu Arg His Pro Leu Ala Val 485 490 495 Ser Ser Leu Asp Glu Leu Ala Asn Gly Thr Phe Leu Pro Ala Ile Gly 500 505 510 Glu Ile Asp Asp Leu Asp Pro Lys Ala Val Lys Arg Val Val Leu Cys 515 520 525 Ser Gly Lys Val Tyr Tyr Asp Leu Leu Glu Gln Arg Arg Lys Asn Asp 530 535 540 Gln Lys Asp Val Ala Ile Val Arg Ile Glu Gln Leu Tyr Pro Phe 545 550 555

<210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 5 tactgggtca cctgacagct tatcatcgat 30

<210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 6 cgttcggtga ccaccaaagc ggccatcgtg 30

<210> 7 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 7 ggggtaccca aataggcgta tcacgag 27

<210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: primer <400> 8 ggggtacccg cgatggatat gttctg 26

[Brief description of the drawings]

FIG. 1. gltA gene, ppc gene and gdh
The figure which shows construction of the plasmid pMWCPG which has A gene.

FIG. 2 Plasmid pMWG having gdhA gene
FIG.

FIG. 3. Plasmid pMWC having gltA gene
FIG.

FIG. 4: Plasmid RS containing the origin of replication of the broad host range plasmid RSF1010 and the tetracycline resistance gene
The figure which shows construction of F-Tet.

FIG. 5 Origin of replication of broad host range plasmid RSF1010, tetracycline resistance gene, gltA gene, p
Plasmid R having pc and gdhA genes
The figure which shows construction of SFCPG.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12R 1:01) (C12P 13/14 C12R 1:22) (C12P 13/14 C12R 1:01) (72 Inventor Eiji Ono 1-1 Suzuki-cho, Kawasaki-ku, Kawasaki-shi, Kanagawa Prefecture Ajinomoto Co., Inc. Fermentation Research Laboratory (72) Inventor Kazuhiko Matsui 1-1, Suzuki-cho, Kawasaki-ku, Kawasaki-shi, Kanagawa Ajinomoto Co., Ltd. Inside the research institute (72) Inventor Hisao Ito 1-1 Suzuki-cho, Kawasaki-ku, Kawasaki-shi, Kanagawa Prefecture Ajinomoto Co., Inc. (72) Inventor Yoshihiko Hara 1-1 Suzuki-cho, Kawasaki-ku, Kawasaki-shi, Kanagawa Ajinomoto Fermentation Technology Laboratory Co., Ltd. F-term (reference) 4B064 AE19 CA02 CA19 CC24 DA10 DA16

Claims (8)

[Claims] 1. A microorganism belonging to the genus Klebsiella, Erwinia or Pantoea, and having an ability to produce L-glutamic acid. 2. The microorganism according to claim 1, which belongs to Klebsiella planticola or Pantoea agglomerans. 3. The microorganism according to claim 1, wherein the activity of an enzyme that catalyzes a biosynthesis reaction of L-glutamic acid is enhanced. 4. The microorganism according to claim 3, wherein the enzyme that catalyzes the biosynthesis reaction of L-glutamic acid is selected from citrate synthase, phosphoenolpyruvate carboxylase, and glutamate dehydrogenase. 5. The microorganism according to claim 4, wherein the enzyme that catalyzes the biosynthesis reaction of L-glutamic acid is all of citrate synthase, phosphoenolpyruvate carboxylase, and glutamate dehydrogenase. 6. The activity of an enzyme that catalyzes a reaction that produces a compound other than L-glutamic acid by branching off from the L-glutamic acid biosynthetic pathway is reduced or defective.
The microorganism according to any one of the above. 7. The microorganism according to claim 6, wherein the enzyme that catalyzes a reaction for producing a compound other than L-glutamic acid by branching off from the L-glutamic acid biosynthetic pathway is α-ketoglutarate dehydrogenase. 8. The method according to claim 1, wherein the microorganism according to claim 1 is cultured in a liquid medium, L-glutamic acid is produced and accumulated in the medium, and the L-glutamic acid is collected from the medium. -A method for producing glutamic acid.