CN104611304A - A herbicide tolerant protein, a coding gene thereof and uses of the protein - Google Patents

A herbicide tolerant protein, a coding gene thereof and uses of the protein Download PDF

Info

Publication number
CN104611304A
CN104611304A CN201410806871.2A CN201410806871A CN104611304A CN 104611304 A CN104611304 A CN 104611304A CN 201410806871 A CN201410806871 A CN 201410806871A CN 104611304 A CN104611304 A CN 104611304A
Authority
CN
China
Prior art keywords
plant
nucleotide sequence
protein
gene
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410806871.2A
Other languages
Chinese (zh)
Other versions
CN104611304B (en
Inventor
何健
姚利
贾兴军
谢香庭
吴业春
陶青
丁德荣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd
Nanjing Agricultural University
Original Assignee
BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd
Nanjing Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd, Nanjing Agricultural University filed Critical BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd
Priority to CN201410806871.2A priority Critical patent/CN104611304B/en
Publication of CN104611304A publication Critical patent/CN104611304A/en
Application granted granted Critical
Publication of CN104611304B publication Critical patent/CN104611304B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0026—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5)
    • C12N9/0028—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5) with NAD or NADP as acceptor (1.5.1)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
    • A01G7/00—Botany in general
    • A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y105/00—Oxidoreductases acting on the CH-NH group of donors (1.5)
    • C12Y105/01—Oxidoreductases acting on the CH-NH group of donors (1.5) with NAD+ or NADP+ as acceptor (1.5.1)
    • C12Y105/0102—Methylenetetrahydrofolate reductase [NAD(P)H] (1.5.1.20)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/0101—Formyltetrahydrofolate deformylase (3.5.1.10)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Ecology (AREA)
  • Forests & Forestry (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to a herbicide tolerant protein, a coding gene thereof and uses of the protein. The herbicide tolerant protein is a protein formed by the amino acid sequence shown as SEQ ID NO: 2. The herbicide tolerant protein is particularly suitable for expression in plants and is especially expressed in chloroplasts. The herbicide tolerant protein can enhance tolerance to a dicamba herbicide and has a wide application prospect.

Description

Herbicide tolerant protein, its encoding gene and purposes
Technical field
The present invention relates to a kind of herbicide tolerant protein, its encoding gene and purposes, particularly relate to and a kind ofly to herbicide dicamba, there is the protein of tolerance, its encoding gene and purposes.
Background technology
Weeds can crop and the valuable nutrient required for other object plant in exhausted soil rapidly.Although herbicide-tolerant glyphosate, careless fourth phosphine, 2,4-D and the transgenic plant of other herbicide treatment can be obtained at present, also there is white space, as control weeds scope, develop extra herbicide tolerant crop etc.In addition, the appearance (although normally local with variable) tolerating the weeds of above-mentioned weedicide causes the needs to extra or alternative Weeds distribution measure.
Prove that herbicide-tolerant proterties is commercially valuable, therefore need to increase the plant of other weedicide of tolerance and the option of the unmanageable weeds kind of management, to avoid depending on any single herbicide unduly, especially need for eco-friendly and in control weeds the effective weedicide of height and develop herbicide tolerant.Dicamba 98 is one of effective and eco-friendly weedicide, it has been used more than 40 year by peasant, and dicamba 98 can be used for controlling annual in corn, Chinese sorghum, millet, herbage, hay, pasture, sugarcane, asparagus, turf and grass seed crops and perennial broadleaf weed and several grassy weed; Meanwhile, dicamba 98 can injure many commercial crops and dicotyledons, and as soybean, cotton, pea, potato, Sunflower Receptacle and rape, above-mentioned crop/plant is all responsive especially for low-level dicamba 98.However, dicamba 98 remains effective in control weed growth, and is important.
Reported the gene being separated encoding dicamba monooxygenase (DMO) from Pseudomonas Maltophilia (Pseudomonas maltophilia), it is ferredoxin dependent form and gives the tolerance to dicamba 98.DMO participates in herbicide dicamba (the chloro-o-anisic acid of 3,6-bis-) to be converted into nontoxic 3,6-dichlorosalicylic acids (DCSA), and the plant of expression DMO gene has the tolerance to dicamba 98.
Because the dicamba 98 tolerant genes found at present is equal and similar, so need more how novel dicamba 98 tolerant genes to avoid depending on a kind of dicamba 98 tolerant genes unduly, dicamba 98-dicamba 98 tolerance type crop is made commercially to have more wide application space.
Summary of the invention
The object of this invention is to provide a kind of herbicide tolerant protein, its encoding gene and purposes, the present invention aims to provide a kind of new DMT66 gene, and described DMT66 albumen has higher tolerance to Banvel D in plant.
For achieving the above object, the invention provides a kind of protein, there is the protein of the aminoacid sequence composition shown in SEQ ID NO:2.
For achieving the above object, the invention provides a kind of gene, comprising:
The nucleotide sequence of (a) code for said proteins; Or
The nucleotide sequence of b nucleotide sequence complementary that () limits with (a) under strict conditions; Or
C () has the nucleotide sequence shown in SEQ ID NO:3; Or
D () has the nucleotide sequence shown in SEQ ID NO:14.
Described stringent condition can be in 6 × SSC (Trisodium Citrate), 0.5%SDS (sodium lauryl sulphate) solution, hybridizes, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively to wash film 1 time at 65 DEG C.
For achieving the above object, present invention also offers a kind of combined protein, comprise at least by the first nucleotide sequence and second nucleotide sequence coded, described first nucleotide sequence coded described protein.
Further, described second nucleotide sequence coded methyl tetrahydrofolate reductase enzyme, formyltetrahydrofolate deformylase and/or methyne cyclase.
Further, described methyl tetrahydrofolate reductase enzyme has the aminoacid sequence shown in SEQ ID NO:4, described formyltetrahydrofolate deformylase has the aminoacid sequence shown in SEQ ID NO:6, and described methyne cyclase has the aminoacid sequence shown in SEQ ID NO:8.
Preferably, described second nucleotide sequence has SEQ ID NO:5, SEQ ID NO:7 and/or the nucleotide sequence shown in SEQ ID NO:9.
Particularly, the nucleotide sequence of described combined protein of encoding has the nucleotide sequence shown in SEQ ID NO:26.
More specifically, the nucleotide sequence of described combined protein of encoding has the nucleotide sequence shown in SEQ ID NO:1.
For achieving the above object, present invention also offers a kind of expression cassette, be included in the nucleotide sequence of described gene under the regulating and controlling sequence regulation and control effectively connected or described combined protein of encoding.
Further, described regulating and controlling sequence is chloroplast transit peptides, and described chloroplast transit peptides is effectively connected with described gene.
Preferably, the nucleotide sequence of described chloroplast transit peptides has the nucleotide sequence shown in SEQ ID NO:16.
For achieving the above object, present invention also offers a kind ofly comprise described gene, the nucleotide sequence of described combined protein of encoding or the recombinant vectors of described expression cassette.
For achieving the above object, present invention also offers a kind of method increasing herbicide-tolerant scope, comprising: is expressed together with the second protein that the protein that described protein, described combined protein or described expression cassette are encoded is different from the protein that described protein, described combined protein or described expression cassette are encoded in plant with at least one.
Further, described the second protein is glyphosate tolerant protein, glufosinate tolerant protein, alpha Ketoglutarate dioxygenase, 4-hydroxyphenyl pyravate dioxygenase, acetolactate synthase, cytopigment proteinoid or proporphyrinogen oxidase.
In the present invention, the expression of DMT66 herbicide tolerant protein in a kind of transgenic plant can along with one or more glyphosate tolerant protein and/or glufosinate tolerant protein expression.This kind of herbicide tolerant protein co expression in same strain transgenic plant that exceedes can make plant comprise by genetic engineering and gene needed for expressing realizes.In addition, one kind of plant (the 1st parent) can express DMT66 herbicide tolerant protein by genetic engineering procedure, and the second plant (the 2nd parent) can express glyphosate tolerant protein and/or glufosinate tolerant protein by genetic engineering procedure.The progeny plants of all genes of expressing introducing the 1st parent and the 2nd parent is obtained by the 1st parent and the 2nd parents.
For achieving the above object, present invention also offers a kind of method selecting the vegetable cell transformed, comprise: transform multiple vegetable cell with the nucleotide sequence of described gene, described combined protein of encoding or described expression cassette, and at permission expressing said gene, the nucleotide sequence of described combined protein of encoding or the transformed cell growth of described expression cassette, and kill no transformed cells or cultivate described cell under suppressing the herbicide concentration of no transformed cells growth, described weedicide is dicamba 98.
For achieving the above object, present invention also offers a kind of method controlling weeds, comprise: the Banvel D land for growing field crops of planting plants being used to effective dose, described plant comprise described gene, the nucleotide sequence of described combined protein of encoding, described expression cassette or described recombinant vectors.
For achieving the above object; present invention also offers the method for a kind of protective plant from the damage caused by weedicide; comprise: described gene, the nucleotide sequence of described combined protein of encoding, described expression cassette or described recombinant vectors are imported plant, the plant after importing is produced and enough protects its herbicide tolerant protein from dicamba 98 infringement amount.
For achieving the above object, present invention also offers a kind of method of giving plant Banvel D tolerance, comprising: described gene, the nucleotide sequence of described combined protein of encoding, described expression cassette or described recombinant vectors are imported plant.
For achieving the above object, present invention also offers a kind of method controlling the land for growing field crops glyphosate tolerance weeds of glyphosate-tolerant plant, comprise: the dicamba 98 land for growing field crops of plantation glyphosate-tolerant plant being used to effective dose, described glyphosate-tolerant plant comprises described gene, the nucleotide sequence of described combined protein of encoding, described expression cassette or described recombinant vectors.
For achieving the above object, present invention also offers a kind of method producing dicamba tolerant plant, comprise in the genome of described plant, introduce described gene, the nucleotide sequence of described combined protein of encoding or described expression cassette, to produce dicamba tolerant plant.
Particularly, the method of described generation dicamba tolerant plant comprises: by producing dicamba tolerant plant by mother plant selfing or with the second plant hybridization, described mother plant and/or the second plant comprise described gene, the nucleotide sequence of described combined protein of encoding or described expression cassette, and described dicamba tolerant plant heredity is from described mother plant and/or the described gene of the second plant, the nucleotide sequence of described combined protein of encoding or described expression cassette.
For achieving the above object, present invention also offers a kind of cultivation has the plant of tolerance method to Banvel D, comprising:
Plant at least one plant seed, the genome of described plant seed comprise described gene, the nucleotide sequence of described combined protein of encoding or described expression cassette;
Described plant seed is made to grow up to plant;
Spray described plant with effective dose Banvel D, gather in the crops the plant that with other, not there is described gene, there is compared with the nucleotide sequence of described combined protein of encoding or the plant of described expression cassette the plant injury weakened.
On the basis of technique scheme, preferably, described plant is soybean, cotton, corn, paddy rice, wheat, beet or sugarcane.
For achieving the above object, present invention also offers a kind of purposes of demethylase dicamba tolerant weedicide of aerobic tetrahydrofolic acid (THFA) dependent form.
For achieving the above object, present invention also offers a kind of bacterial strain, it comprises the nucleotide sequence shown in SEQ ID NO:3, and described bacterial strain is CCTCC M2014550 at the deposit number of China typical culture collection center.
Described gene or described expression cassette or described recombinant vectors are imported plant, be by Exogenous DNA transfered vegetable cell in the present invention, conventional transformation methods includes but not limited to, Agrobacterium-medialed transformation, trace launch bombardment, direct DNA DNA being taken in the mediation of protoplastis, electroporation or silicon whisker imports.
The present invention can increase the tolerance of plant for oxidative stress, include but not limited to, provide product or its analogue of dicamba 98 or dicamba monooxygenase enzyme institute mediated metabolic to flora, to improve the herbicide tolerant of plant, such as, by being DCSA by dicamba 98 metabolism.
The present invention " dicamba 98 " (Dicamba) refers to the chloro-o-anisic acid of 3,6-bis-or the chloro-O-Anisic Acid of 3,6-bis-and acid thereof and salt.Its salt comprises isopropyl amine salt, glycol ether ammonium salt, dimethylamine salt, sylvite and sodium salt.The commercial formulation of dicamba 98 includes but not limited to, (as DMA salt), (BASF, as DGA salt), VEL-58-CS-11 tMwith (BASF, as DGA salt).
That has reported at present has 4 kinds containing methoxyl group aromatic hydroxy compound demethylase, be (1) RHOs (Rieske non-heme type oxydase) respectively, the DMO (GenBank:AY786443.1) of degraded dicamba 98 belongs to the oxydase of three component RHO types; (2) Cytochrome P450, it is the superfamily of a class heme-thiolate proteins, its participates in endogenous material and comprises the metabolism of exogenous material of medicine, environmental compound, and a lot of is exactly this type containing methoxyl group aromatic hydroxy compound demethylase; (3) anaerobic type tetrahydrofolic acid (THFA) dependent form demethylase, be found in anaerobic bacterium as in hot vinegar Moore Salmonella (Moorellathermoacetica), participate in the lignin degradation intermediate product anaerobic degradation as syringic acid and vanillic acid, also studies have found that anaerobic type tetrahydrofolic acid (THFA) dependent form demethylase also can anaerobic degradation dicamba 98; (4) demethylase (Sphingomonas paucimobilis SYK-6) of aerobic tetrahydrofolic acid (THFA) dependent form, participate in the lignin degradation intermediate product anaerobic degradation as syringic acid and vanillic acid, but also do not have this kind of aerobic tetrahydrofolic acid (THFA) dependent form demethylase to degrade the report of dicamba 98 at present.
Gene of the present invention has the characteristic allowing to use Banvel D in plant after being used for expression of plants, in described plant, intrinsic patience does not exist or is not enough to allow to use Banvel D.In addition, DMT66 gene of the present invention can provide the protection to Banvel D in plant when natural tolerance is not enough to permission selectivity.To field use amount of application be about 0.0025 pound/acre (lb/a) to about 20lb/a dicamba 98, more generally from 0.25lb/a to 12lb/a.The control to the potential weeds that great majority need weedicide to control can be provided at same large field (continuous or tank is mixed in combination) combination different chemical classification and the weedicide with different binding mode and scope.
Glyphosate is widely used, because it controls broad-leaved and the gramineous weeds species of very wide spectrum.But, reuse in glyphosate tolerant crop and the application of non-crop glyphosate (and will continue) select to make weeds succession be naturally have more indefatigable species or glyphosate tolerant biotype.Most herbicide tolerant operating strategy suggestion uses the tank of effective level to mix weedicide companion as the method delaying to occur tolerance weeds, and described weedicide companion provides the control to same species, but has different binding modes.DMT66 gene is superposed with glyphosate tolerance trait (and/or other herbicide tolerance trait) by allowing to use glyphosate and dicamba 98 and the control realized glyphosate tolerant crop glyphosate tolerance weed species (the broadleaf weeds species by dicamba 98 controls) to same crop-selective.The application of these weedicides can be use in the tank mixture of the two or more weedicides containing different binding mode simultaneously, using continuously (before as plantation, emerge before or after emerging) in being used alone of the single herbicidal composition interval time of the use (scope from 2 hours to 3 months), or alternatively, can (to (or be results space befores for single weedicide, get the shortest person) during harvesting crops in long-term cropping 7 months) use representative can apply the combination of the arbitrary number weedicide of often kind of chemical combination classification at any time.
In control broadleaf weeds, to have handiness be very important, i.e. duration of service, single weedicide consumption and control ability that is obstinate or tolerance weeds.Can from 250 to 2500g ae/ha with the glyphosate range of application of glyphosate tolerance gene/DMT66 gene stacking in crop; Dicamba 98 can according to from 0.25lb/a to 12lb/a.The best of breed of the time of these application depends on concrete condition, species and environment.
Herbicide formulations (as ester, acid or salt formula or solvable enriching agent, emulsion concentrate or can solution body) and tank mix additive (as adjuvant or compatilizer) can the Weeds distribution of combination of the given weedicide of remarkably influenced or one or more weedicides.Any chemical association of any aforementioned herbicides all within the scope of the invention.
Well-known to those skilled in the art, being combined in of two or more binding mode improves controlled weeds spectrum and/or the natural benefit had more in tolerance species or tolerance weed species also extends to the chemical being produced the herbicide tolerance except glyphosate tolerant crop by artificial (transgenosis or non-transgenic) in crop.In fact, can separately or with the proterties of the following tolerance of Multiple Combination supercomposed coding to provide the ability of the tolerance of the weedicide effectively controlling or prevent weeds succession to any aforementioned categories: glyphosate tolerant is (as tolerant plants or bacterium EPSPS, GOX, GAT), glufosinate tolerant is (as PAT, Bar), phenoxy auxin tolerance is (as 2,4-D, methoxone genes conferring resistance is as AAD-1, AAD-12 etc.) acetolactate synthase (ALS) inhibition herbicide tolerant is (as imidazolone, sulfonylurea, triazolo pyrimidine, Sulphonanilide, pyrimidine phosphorothioate phenylformic acid and other chemical resistance gene are as AHAS, Csrl, SurA etc.), bromoxynil tolerance (as Bxn), to the tolerance of HPPD (4-hydroxyphenyl pyravate dioxygenase) enzyme inhibitors, to the tolerance of phytoene desaturase (PDS) inhibitor, to the tolerance (as psbA) of lightsystemⅡ inhibition weedicide, to the tolerance of photosystemⅰ inhibition weedicide, to proporphyrinogen oxidase Ⅸ (PPO) inhibition herbicide tolerant (as PPO-1), to the tolerance (as CYP76B1) of phenylurea herbicides, Mediben degrading enzyme etc.
About other weedicides, some other preferred ALS inhibitor comprise triazolo pyrimidine Sulphonanilide (cloransulammethyl, diclosulam, flumetsulam, metosulam and Kui Linpyrimido quinoline triazole species sulfanilamide (SN)), pyrimidine phosphorothioate phenylformic acid and flucarbazone.Some preferred HPPD inhibitor comprise mesotrione, isoxaflutole and sulphur humulone.Some preferred PPO inhibitor comprise flumioxazin, butafenacil, azoles humulone, sulfentrazone and phenyl ether (as acifluorfen, fomesafen, lactofen and oxyfluorfen).
In addition, can by DMT66 gene separately or input (as insect tolerance, fungi tolerance or stress tolerance etc.) after superposing with other herbicide tolerant crop feature again with one or more other or export (output, the oil mass of improvement, the fibrous quality etc. of raising as improved) proterties and superpose.Therefore, the present invention can be used for providing with flexibly and control the ability of the agronomy insect of any number economically and improve the complete agronomy solution of crop quality.
DMT66 gene of the present invention can be degraded Banvel D, is the basis of important herbicide tolerant crop and selectable marker feature possibility.
The present invention can carry out transgene expression, can control the combinations of herbicides of nearly all broadleaf weeds.DMT66 gene can be used as outstanding herbicide tolerant crop proterties with such as other herbicide tolerant crop proterties (as glyphosate tolerant, glufosinate tolerant, phenoxy auxin tolerance, ALS inhibitor is (as imidazolone type, sulfonylurea, triazolopyrimidine sulfonamides) tolerance, bromoxynil tolerance, HPPD inhibitor tolerance, PPO inhibitor tolerance etc.) and insect tolerance proterties (Cry1Ab, Cry1F, Vip3, the insect tolerance albumen etc. in other B. thuringiehsis protein matter or non-bacillus source) superposition.In addition, DMT66 gene can be used as the primary transformant of the plant of another gene of selectable marker assisted Selection or gene group genetic modification.
Herbicide tolerance crop character of the present invention can be used on the Combination nova of other herbicide tolerance crop character (including but not limited to glyphosate-tolerant).Due to tolerance or the intrinsic patience of the new acquisition to weedicide (as glyphosate), the combination of these proterties produces the novel method controlling weed species.Therefore, except herbicide tolerance crop character, scope of the present invention comprises the novel method using herbicide weed control, wherein produces the patience to described weedicide by the described enzyme in genetically modified crops.
The present invention can be applicable in various plants, as Arabidopis thaliana, tobacco, soybean, cotton, rice, corn and rape.The present invention also can be used for other unifacial leaf multiple (as herbage Gramineae or turfgrass Gramineae) and dicotyledonous crops (as clover, trifolium, arbor species etc.).Similar, dicamba 98 (or other DMT66 substrate) can more energetically in the moderate gramineous crop of patience, and the patience of raising that obtains of proterties can with more effective consumption and wider time of application to use these weedicides and without the possibility of crop damage risk by providing for grower thus.
The genome of the plant described in the present invention, plant tissue or vegetable cell, refers to any genetic material in plant, plant tissue or vegetable cell, and comprises nucleus and plastid and Mitochondrial Genome Overview.
Described in the present invention, " tolerance " is heritable, and allows plant to carry out Growth and reproduction general weedicide effectively processes at weedicide to given plant.Approve as those skilled in the art, even if certain degree of injury that plant is subject to herbicide treatment is obvious, plant still can be considered to " tolerance ".In the present invention, term " patience " is more extensive than term " tolerance ", and comprise " tolerance ", and the ability of the raising of the various degree damage of opposing weedicide induction that specified plant has, and under same doses, generally cause homologous genes type wild-type plant to damage.
Polynucleotide described in the present invention and/or Nucleotide are formed complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, under polynucleotide of the present invention and/or Nucleotide can being placed in the regulating and controlling sequence control of object host.
" combined protein " described in the present invention refers to that described combined protein can be one or more albumen by gene recombination technology by rear for the restructuring of different nucleotide sequences albumen of expressing generation.
Regulating and controlling sequence described in the present invention include but not limited to promotor, transit peptides, terminator, enhanser, leader sequence, intron and other be operably connected to the adjustment sequence of described DMT66 gene.
Described promotor is effable promotor in plant, and described " in plant effable promotor " refers to and guarantee that connected encoding sequence carries out the promotor expressed in vegetable cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from the promotor etc. of the 35S promoter of cauliflower mosaic virus, ubi promoter of maize, paddy rice GOS2 gene.Alternatively, in plant, effable promotor can be tissue-specific promotor, namely this promotor in some tissues of plant as instructed the expression level of encoding sequence higher than its hetero-organization (test by conventional RNA and measure) of plant in chlorenchyma, as PEP carboxylase promoter.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound caused, is significantly increased under the expression compared with normal growth conditions of the encoding sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the proteolytic enzyme suppressor gene (pin I and pin II) of potato and tomato and the promotor of zein enzyme level gene (MPI).
Described transit peptides (also known as secretory signal sequence or targeting sequencing) instructs transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, such as, utilize encoding chloroplast transit peptide sequence target chloroplast(id), include but not limited to Arabidopis thaliana chloroplast transit peptides AtCTP2, or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.
Described leader sequence including but not limited to, picornavirus leader sequence, as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); Potyvirus leaders, as MDMV (Maize Dwarf Mosaic Virus) leader sequence; Human immunoglobulin matter heavy-chain binding protein matter (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.
Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.
For monocotyledons application for, described intron including but not limited to, corn hsp70 intron, maize ubiquitin intron, Adh introne 1, crose synthase intron or paddy rice Act1 intron.For dicotyledons application for, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.
Described terminator can for the applicable polyadenylation signal sequence worked in plant, include but not limited to, derive from the polyadenylation signal sequence of Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene, derive from protease-inhibitor Ⅱ (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.
" effectively connect " described in the present invention represents the connection of nucleotide sequence, and described connection makes a sequence can provide function concerning needing linked sequence." effectively connect " in the present invention and can, for promotor to be connected with interested sequence, make transcribing of this interested sequence be subject to the control of this promotor and regulation and control." effectively connect " when interested sequence encoding albumen and when going for the expression of this albumen and represent: promotor is connected with described sequence, and the mode be connected makes the transcript efficient translation obtained.If the connection of promotor and encoding sequence is transcript when merging and want the expression realizing the albumen of encoding, manufactures such connection, make the first translation initiation codon in the transcript obtained be the initiator codon of encoding sequence.Alternatively, if the connection of promotor and encoding sequence is translated when merging and want the expression realizing the albumen of encoding, manufacture such connection, the first translation initiation codon of containing in 5 ' non-translated sequence and promotor are connected, and mode of connection make the translation product obtained meet reading frame with the relation of the translation opening code-reading frame of the albumen wanted of encoding.The nucleotide sequence that can " effectively connect " includes but not limited to: sequence (the i.e. gene expression element providing genetic expression function, such as promotor, 5 ' untranslated region, intron, protein encoding regions, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), sequence (the i.e. T-DNA border sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), sequence (the i.e. antibiotic resistance marker of selectivity function is provided, biosynthesis gene), the sequence of marker function of can scoring is provided, interior sequence (the i.e. polylinker sequence of assisting series of operations of external or body, Site-specific recombinase sequence) and sequence (the i.e. replication orgin of bacterium of copy function is provided, autonomously replicating sequence, centromeric sequence).
The present invention can give plant novel herbicide tolerance trait, and does not observe detrimentally affect phenotype being comprised to output.In the present invention, plant can tolerate the application level of weedicide as tested at least one 1 times.The raising of these tolerant levels within the scope of the present invention.Such as can carry out forseeable optimization to multiple technologies known in the art and further develop, to increase the expression of given gene.
In the present invention, described herbicide tolerant protein is DMT66 aminoacid sequence, as shown in SEQ ID NO:2 in sequence table.Described herbicide tolerance gene is DMT66 nucleotide sequence, as shown in SEQ ID NO:1 in sequence table.Described herbicide tolerance gene is for plant, except comprising by except the coding region of the nucleotide sequence coded protein of DMT66, also other elements can be comprised, the coding region of such as encoding transit peptides, the protein of encoding selection markers or give the coding region of protein of insect tolerance.
In the present invention, DMT66 herbicide tolerant protein has patience to Banvel D.Plant in the present invention, containing foreign DNA in its genome, described foreign DNA comprises DMT66 nucleotide sequence, protects it from the threat of weedicide by expressing this albumen of significant quantity.Significant quantity refers to dosage that is unmarred or slight damage.Meanwhile, plant should be morphologically normal, and the consumption can cultivated under conventional approaches for product and/or generation.
In vegetable material, herbicide tolerant protein expression level detects by multiple method described in this area, such as undertaken quantitatively by applying the mRNA of special primer to the encodes herbicide tolerance protein produced in tissue, or the amount of the herbicide tolerant protein of directly specific detection generation.
The invention provides a kind of herbicide tolerant protein, its encoding gene and purposes, have the following advantages:
1, the present invention is separated to the bacterial strain with herbicide tolerant first, and described bacterial strain is CCTCC M 2014550 at the deposit number of China typical culture collection center.
2, strong to herbicide tolerant.DMT66 gene of the present invention can be degraded Banvel D, optimizes the preferred codons that DMT66 gene adopts corn and soybean, makes it be particularly suitable for expressing in plant; Optimize DMT66 gene and can give transgenic plant Banvel D tolerance, and express compared in kytoplasm, the described optimization DMT66 assignment of genes gene mapping is expressed and can be strengthened the tolerance of transgenic plant to Banvel D in chloroplast(id).
3, have a extensive future.Herbicide tolerant 3-protein d MT66 of the present invention is the demethylase of aerobic tetrahydrofolic acid (THFA) dependent form, and it is different from known dicamba 98 tolerant genes, therefore can expand dicamba 98 tolerance type range of application on plant.
Below by drawings and Examples, technical scheme of the present invention is described in further detail.
Accompanying drawing explanation
Fig. 1 is bacterium colony figure on solid medium of the bacterial strain Ndbn-20 of herbicide tolerant protein of the present invention, its encoding gene and purposes and Electronic Speculum figure;
Fig. 2 is high-efficient liquid phase chromatogram and the mass spectrometric detection figure of the bacterial strain Ndbn-20 degraded dicamba 98 of herbicide tolerant protein of the present invention, its encoding gene and purposes;
Fig. 3 is the demethylase system gene cluster schematic diagram of herbicide tolerant protein of the present invention, its encoding gene and purposes;
Fig. 4 is the protein SDS-PAGE electrophorogram that the DMT66 gene of herbicide tolerant protein of the present invention, its encoding gene and purposes is expressed in expressive host bacterium BL21 (DE3);
Fig. 5 is the protein SDS-PAGE electrophorogram that the MTHFR66 gene of herbicide tolerant protein of the present invention, its encoding gene and purposes is expressed in expressive host bacterium BL21 (DE3);
Fig. 6 is that the albumen of the abduction delivering of herbicide tolerant protein of the present invention, its encoding gene and purposes is degraded in 1 hour the high-efficient liquid phase chromatogram of dicamba 98;
Fig. 7 is that the recombinant cloning vector DBN01-T containing optimization DMT66 nucleotide sequence of herbicide tolerant protein of the present invention, its encoding gene and purposes builds schema;
Fig. 8 is that the recombinant expression vector DBN100879 containing optimization DMT66 nucleotide sequence of herbicide tolerant protein of the present invention, its encoding gene and purposes builds schema;
Fig. 9 is the recombinant expression vector DBN100945 structural representation containing optimization DMT66 nucleotide sequence of herbicide tolerant protein of the present invention, its encoding gene and purposes;
Figure 10 is the recombinant expression vector DBN100945N structural representation containing natural DMT66 nucleotide sequence of herbicide tolerant protein of the present invention, its encoding gene and purposes;
Figure 11 is the transgenic arabidopsis T of herbicide tolerant protein of the present invention, its encoding gene and purposes 1plant herbicide tolerant design sketch;
Figure 12 is that the recombinant expression vector DBN-HT120066 containing optimization DMT66 nucleotide sequence of herbicide tolerant protein of the present invention, its encoding gene and purposes builds schema;
Figure 13 be herbicide tolerant protein of the present invention, its encoding gene and purposes containing natural DMT66 nucleotide sequence recombinant expression vector DBN-HT120066N structural representation.
Embodiment
The technical scheme of herbicide tolerant protein of the present invention, its encoding gene and purposes is further illustrated below by specific embodiment.
The separation andpreconcentration of the first embodiment, bacterial strain
1, the separation of bacterial strain
The enriched medium of dicamba 98 degradation bacteria strains takes from biochemical sludge, compost, Marine shoal, Saline Soil in Xinjiang, forest soil, agricultural land soil etc. around dicamba 98 factory, is separated with the substratum containing finite concentration dicamba 98.Soil sampling is at low chlorine basal salt media (dipotassium hydrogen phosphate 1.3g/L, potassium primary phosphate 0.87g/L, ammonium sulfate 0.66g/L, magnesium sulfate 0.097g/L, Manganous sulfate monohydrate 0.025g/L, ferrous sulfate 0.005g/L and calcium sulfate 1.26mg/L, the pH 7.0 of 500mg/L dicamba 98; Solid medium adds 15g/L agar) upper cultivation 5 days (temperature 30 DEG C, rotating speed 180r/min), the inoculum size with 5% is transferred in identical substratum, continuously switching 3 times.
Whether there is degradation effect by ultraviolet scanner detection the 4th generation pregnant solution, to there being the pregnant solution of degradation effect to carry out gradient dilution, getting 10 -4-10 -7the each 0.1mL of pregnant solution of weaker concn coats and is added with on solid medium flat board that concentration is 2.25mM dicamba 98, temperature 30 DEG C is cultivated after 5 days, single bacterium colony that picking grows, use method of scoring, be further purified, single colony inoculation after picking purifying, in being in the low chlorine basal salt media of 2.25mM dicamba 98 containing concentration, being cultivated 3 days at temperature 30 DEG C, rotating speed 180r/min shaking table, is verified its degradation effect by ultraviolet scanner.
From pregnant solution, be separated to a strain dicamba 98 degradation bacteria, called after Ndbn-20.Bacterial strain Ndbn-20 at cultured on solid medium after 3 days, bacterium colony smooth surface, neat in edge, protuberance, in faint yellow, through negative staining, under transmission electron microscope, this bacterium is shaft-like, atrichia, without pod membrane, does not form gemma (as shown in Figure 1), gram negative bacterium (G-), thalline is rod-short, and size is 0.4-0.66 × 0.9-1.5 μm, aerobic growth.
With the genomic dna of bacterial strain Ndbn-20 for template, with the universal primer of bacterium 16s rDNA gene order, be about the 16S rRNA gene order (Genbank:KP064570) of 1359bp by pcr amplification acquisition length.By sequence alignment and in conjunction with strain morphology and physiological and biochemical property, identify that described bacterial strain Ndbn-20 is Sphingomonas (Sphingomonas sp.), this bacterial strain is stored in China typical culture collection center and (is called for short CCTCC, address: Luo Jia Shan, Hubei China province wuchang, wuhan, Wuhan University, postcode 430072) preservation, deposit number is CCTCC NO:M 2014550, and preservation date is on November 5th, 2014.
2, bacterial strain Ndbn-20 degrades the recruitment evaluation of dicamba 98 and Methanogenesis
The verification method of degradation effect: bacterial strain Ndbn-20 is seeded on LB liquid nutrient medium, temperature 30 DEG C is cultured to logarithmic phase, low-speed centrifugal collects thalline, fresh, the aseptic low chloro plinth salt nutrient solution of thalline rinses 2 times, be resuspended in low chloro plinth salt nutrient solution, cell concn is about 1.0 × 108cfu/mL, by 1% (v/v) inoculum size, is inoculated into 50mL and cultivates 64 hours (temperature 30 DEG C) containing on the low chlorine basal salt media of 2.25mM dicamba 98.
Get the lyophilize of 1mL nutrient solution, dry thing adds 1mL dissolve with methanol (chromatographically pure), filters with filter membrane (0.22 μm, aperture), adopts high performance liquid chromatography to detect.Liquid phase chromatogram condition is: moving phase is acetonitrile: methyl alcohol: water: acetic acid (31.7:7.5:58.4:2.4, V/V), Zorbax C218ODS Spherex reversed-phase column (5 μm, 4.6mm × 250mm, Agilent, USA), column temperature is room temperature, UV-detector, and mensuration wavelength is 319nm, sample size is 20 μ L, and flow velocity is 0.8mL/min.External standard method presses peak area quantification.The qualification of meta-bolites is by HPLC-MS (high performance liquid chromatography and mass spectrometry), condition is: moving phase is acetonitrile: methyl alcohol: water: acetic acid (31.7:7.5:58.4:2.4, V/V), Zorbax XDB-C18,5cm × 0.46cm 1.8mm reversed-phase column (5 μm, 4.6mm × 250mm, Agilent, USA), flow velocity is 0.25mL/min.MS analyzes and uses ESI pattern, and detector is Agilent G6410B Triple Quad Mass Spectrometer.
Result shows that described bacterial strain Ndbn-20 can degrade dicamba 98, and cultivate after 64 hours, described bacterial strain Ndbn-20 can reach about 90% to the dicamba 98 degradation rate that concentration is 2.25mM.HPLC-MS/MS (second order ms) detected result shows that the first step that dicamba 98 is degraded is that demethylation generates intermediate product 3,6-dichlorosalicylic acid (DCSA), as shown in Figure 2.
The separation of the second embodiment, DMT66 gene and order-checking
1, the preparation of bacterial strain Ndbn-20 genome DNA
After described bacterial strain Ndbn-20 mass propgation, adopt the genome DNA of the described bacterial strain Ndbn-20 of high salt binding CTAB method extraction high purity, large fragment, be dissolved in TE damping fluid (pH8.0), be placed in temperature-20 DEG C of preservations, concrete grammar is with reference to " fine works molecular biology experiment guide " volumes such as () F Ao Sibai.
2, gene order-checking and interpretation of result
(1) DNA sample is sent and detection
Bacterial genomes order-checking requires that the OD value of DNA sample is between 1.8-2.0, and concentration is not less than 30ng/ μ L, and meticulous figure at least needs sample size 30ug.Satisfactory enough DNA sample are sent to Shanghai Mei Ji biological medicine Science and Technology Ltd. (Beijing Company) under dry ice insulation.
Sample detection adopts: A, Concentration Testing, and agarose gel electrophoresis is quantitative; B, OD260/280 and OD260/230 detection method: NanoDrop.
(2) order-checking of bacterial strain Ndbn-20 draft genome and interpretation of result
Build storehouse, order-checking after DNA sample detection is qualified, and use related software to carry out fundamental analysis and analysis of biological information to data.
Gene order-checking result shows, described bacterial strain Ndbn-20 draft genome size is 5,351,429bp, 127 scaffold, and the scaffold being greater than 1000bp has 111, predicts totally 4911 open reading frame (ORF) by de novo.
OMIGA3.0 is adopted to be compared one by one with 111 scaffold in described bacterial strain Ndbn-20 by the 4 type demethylases reported, found that in described bacterial strain Ndbn-20 genome, there is no the sequencing and analyzing finding to have homology with RHOs (Rieske non-heme type oxydase), Cytochrome P450 and the anaerobic type tetrahydrofolic acid (THFA) dependent form demethylase gene reported.Compare with the syringic acid demethylase DesA sequence of aerobic tetrahydrofolic acid (THFA) dependent form and described bacterial strain Ndbn-20 genome sequence, find there is the homologous sequence with DesA in this fragment of scaffold66.To comprise this section of homologous sequence fragment (as shown in SEQ ID NO:1) carried out ORF analysis, result shows this section of sequence to contain a demethylase system gene cluster (as shown in Figure 3), its main effective fragment is as shown in SEQ ID NO:26, comprise a demethylase (Vanillate/3-O-methygallate O-demethylase), a methyl tetrahydrofolate reductase enzyme (5, 10-methylenetetrahydrofolate reductase), a formyltetrahydrofolate deformylase (formyltetrahydrofolate deformylase) and a methyne cyclase (methylenetetrahydrofolate cyclohydrolase).The wherein aminoacid sequence (466 amino acid) of demethylase DMT66, as shown in SEQ ID NO:2 in sequence table, encode corresponding to the DMT66 nucleotide sequence (1401 Nucleotide) of the aminoacid sequence of described demethylase DMT66, as shown in SEQ ID NO:3 in sequence table; Methyl tetrahydrofolate reductase enzyme MTHFR66 is positioned at 104bp place, DMT66 downstream, its aminoacid sequence (289 amino acid), as shown in SEQ ID NO:4 in sequence table, encode corresponding to the MTHFR66 nucleotide sequence (870 Nucleotide) of the aminoacid sequence of described methyl tetrahydrofolate reductase enzyme MTHFR66, as shown in SEQ ID NO:5 in sequence table; Formyltetrahydrofolate deformylase DHC66 is positioned at 1093bp place, DMT66 downstream, its aminoacid sequence (285 amino acid), as shown in SEQ ID NO:6 in sequence table, encode corresponding to the DHC66 nucleotide sequence (858 Nucleotide) of the aminoacid sequence of described formyltetrahydrofolate deformylase DHC66, as shown in SEQ ID NO:7 in sequence table; Methyne cyclase MTHC66 is positioned at 1950bp place, DMT66 downstream, its aminoacid sequence (287 amino acid), as shown in SEQ ID NO:8 in sequence table, encode corresponding to the MTHC66 nucleotide sequence (864 Nucleotide) of the aminoacid sequence of described methyne cyclase MTHC66, as shown in SEQ ID NO:9 in sequence table.
The external high expression of the 3rd embodiment, demethylase DMT66 and Function Identification
1, the structure of bacterial expression vector and recombinant microorganism obtain
(1) pcr amplification of DMT66 gene
Design pair of primers:
Primer 1:5-GGAATTC cATATGgTGCGGTCGGTTCAGGA-3 (underscore is Nde I restriction enzyme site), as shown in SEQ ID NO:10 in sequence table;
Primer 2: 5-CCG cTCGAGgAGCGTCGCGCGGACCCGGC-3 (underscore is Xho I restriction enzyme site), as shown in SEQ ID NO:11 in sequence table;
To increase from described bacterial strain Ndbn-20 genomic dna DMT66 gene by following PCR amplification system:
PCR reaction conditions is: 98 DEG C of sex change 1min; Then enter following circulation: 98 DEG C of sex change 15s, 55 DEG C of annealing 15s, 72 DEG C extend 1min, totally 29 circulations; Last 72 DEG C extend 10min, are cooled to room temperature.
(2) structure of bacterial expression vector and recombinant microorganism obtain
With restriction enzyme NdeI and XhoI respectively enzyme cut above-mentioned pcr amplification product and bacterial expression vector pET-29a (+), bacterial expression vector pET-29a (+) after the DMT66 nucleotide sequence fragment cut and enzyme being cut carries out enzyme and connects, enzyme is connected product conversion to expressive host bacterium BL21 (DE3), obtain recombinant microorganism BL21 (DMT66).
2, the Expression and purification of DMT66 albumen in intestinal bacteria
Described recombinant microorganism BL21 (DMT66) is at LB substratum (the Tryptones 10g/L of 100mL, yeast extract 5g/L, NaCl 10g/L, penbritin 100mg/L, adjust pH to 7.5 with NaOH) in be cultured to concentration be OD600nm=0.6-0.8, add the isopropylthiogalactoside (IPTG) that concentration is 0.4mM, induce 20 hours at temperature 16 DEG C.Centrifugal, collect thalline, with 20ml Tris-HCl buffer (100mM, pH 8.0) resuspended thalline, ultrasonication (X0-900D ultrasonic processor ultrasonic processor, 30%intensity) 10min, then centrifugal, collect supernatant, with nickel ion affinity chromatograph post, purifying is carried out to DMT66 albumen, purification result is detected, the stripe size (51.26KDa) consistent (as shown in Figure 4) of stripe size and theoretical prediction with SDS-PAGE protein electrophoresis.
3, the enzyme activity of DMT66 albumen is measured
Enzyme reaction system (300 μ L) alive: containing 0.45mM substrate, 0.2mg DMT66,1mM tetrahydrofolic acid (THFA) (THF), buffer system is the Tris-HCl (pH 8.0) of concentration 100mM, react 1 hour in water-bath at temperature 30 DEG C, then in boiling water, 1min is placed, termination reaction.Add 300 μ L dissolve with methanol lyophilized products after reaction solution lyophilize, high performance liquid chromatography (HPLC) detects the growing amount of meta-bolites 3,6-dichlorosalicylic acid (DCSA).An enzyme activity unit is defined as: dicamba 98 of degrading in 1min under pH 8.0, temperature 30 DEG C of conditions generates the amount of enzyme required for 1nmol product D CSA, represents with U.
Above-mentioned experimental result shows: the DMT66 albumen after purifying can produce the DCSA of 0.15mM in 1 hour, and the ratio enzyme of DMT66 albumen is lived as 3.75U/mg.
4th embodiment, methyl tetrahydrofolate reductase enzyme MTHFR66 can improve the function of demethylase DMT66
1, the structure of bacterial expression vector and recombinant microorganism obtain
(1) pcr amplification of MTHFR66 gene
Primer 3:5-GGAATTC cATATGgGCTCGCCCGTTATGG-3 (underscore is NdeI restriction enzyme site), as shown in SEQ ID NO:12 in sequence table;
Primer 4:5-CCG cTCGAG(underscore is XhoI restriction enzyme site to GTGCTTTCGAGCGTAGTCAG-3, as shown in SEQ ID NO:13 in sequence table;
To increase from described bacterial strain Ndbn-20 genomic dna MTHFR66 gene by 1 (1) described PCR amplification system in third embodiment of the invention.
(2) structure of bacterial expression vector and recombinant microorganism obtain
With restriction enzyme NdeI and XhoI respectively enzyme cut above-mentioned pcr amplification product and bacterial expression vector pET-29a (+), bacterial expression vector pET-29a (+) after the MTHFR66 nucleotide sequence fragment cut and enzyme being cut carries out enzyme and connects, enzyme is connected product conversion to expressive host bacterium BL21 (DE3), obtain recombinant microorganism BL21 (MTHFR66).
2, the Expression and purification of MTHFR66 albumen in intestinal bacteria
Concrete grammar is with reference to the method for the Expression and purification of DMT66 albumen in intestinal bacteria described in 2 in third embodiment of the invention.With nickel ion affinity chromatograph post, purifying is carried out to MTHFR66 albumen, detect purification result with SDS-PAGE protein electrophoresis, the stripe size (31.79kDa) consistent (as shown in Figure 5) of stripe size and theoretical prediction.
3, the enzyme activity of identification of M THFR66+DMT66 and DMT66
MTHFR66+DMT66 enzyme reaction system (300 μ L) alive: containing 0.45mM substrate, 0.2mg DMT66 (in third embodiment of the invention 2 purifying gained), 0.25mg MTHFR66,1mM tetrahydrofolic acid (THFA) (THF), buffer system is the Tris-HCl (pH 8.0) of concentration 100mM; DMT66 enzyme lives reaction system with system described in 3 in third embodiment of the invention.At water-bath react 1 hour at putting into temperature 30 DEG C simultaneously, then in boiling water, place 1min, termination reaction.Add 300 μ L dissolve with methanol lyophilized products after reaction solution lyophilize, HPLC detects the growing amount of meta-bolites DCSA.An enzyme activity unit is defined as: at pH 8.0, and under temperature 30 DEG C of conditions, in 1min, degraded dicamba 98 generates the amount of enzyme required for 1nmol product D CSA, represents with U.
Above-mentioned experimental result shows: the reaction system alive of the enzyme only containing DMT66 after purifying produced the DCSA of 0.15mM in 1 hour, and the enzyme of MTHFR66+DMT66 reaction system alive produced the DCSA (as shown in Figure 6) of 0.54mM in 1 hour; Live as 3.75U/mg compared to the ratio enzyme only containing DMT66 albumen, under the existence of methyl tetrahydrofolate reductase enzyme MTHFR66, the ratio enzyme of DMT66 albumen is lived as 13.5U/mg, absolutely proves that methyl tetrahydrofolate reductase enzyme MTHFR66 can significantly improve the function of demethylase DMT66.
The optimization of the 5th embodiment, gene order and synthesis
1, the acquisition of plant majorizing sequence
Keep the aminoacid sequence of described demethylase DMT66 (466 amino acid) not change, codon optimized transformation is carried out to the DMT66 nucleotide sequence (1401 Nucleotide) of encoding corresponding to the aminoacid sequence of described demethylase DMT66.
The strategy of codon optimized transformation mainly comprises: according to corn and the preferred codons of soybean, the transformation of unstable sequence, the raising etc. of G+C content.The G+C content of natural gene is lower, A+T content is very high, on the one hand, if directly imported in Plant Genome by native gene sequence, may to be mistaken as be plant gene regulatory sequence, in these natural genes, there will be A+T is rich in region simultaneously, be similar to the TATA box in gene promoter, these regions then can cause the aberrant transcription of gene; On the other hand, in the mRNA transcribed, polyadenylation signal sequence (AAUAAA), the tiny RNA complementary sequence relevant to mRNA montage can cause RNA unstable.Therefore, improved gene order, except having higher G+C content, also changes DNA and is transcribed into the unstable structure occurred in mRNA, thus ensureing the normal translation of albumen; Again on the one hand, the preferred codons transformation native gene sequence of application corn and soybean, gets rid of the modification of restriction enzyme site and some sequences.
Based on above optimisation strategy, be optimized DMT66 nucleotide sequence, and optimize DMT66 nucleotide sequence altogether containing 1401 Nucleotide, 466 amino acid of encoding, its nucleotide sequence is as shown in SEQ ID NO:14 in sequence table.
2, synthesis optimizing DMT66 nucleotide sequence
Optimize DMT66 nucleotide sequence to be synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' end of described optimization DMT66 nucleotide sequence (SEQ ID NO:14) of synthesis is also connected with SpeI restriction enzyme site, and 3 ' end of described optimization DMT66 nucleotide sequence (SEQ ID NO:14) is also connected with KasI restriction enzyme site.
The structure of the 6th embodiment, Arabidopis thaliana recombinant expression vector and recombinant expression vector transformation Agrobacterium
1, the Arabidopis thaliana recombinant cloning vector containing optimizing DMT66 nucleotide sequence is built
The optimization DMT66 nucleotide sequence of synthesis is connected into cloning vector pGEM-T (Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by Promega Products pGEM-T carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 7; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; MDMT66 is for optimizing DMT66 nucleotide sequence (SEQ ID NO:14); MCS is multiple clone site).
Then by recombinant cloning vector DBN01-T heat shock method transformation of E. coli T1 competent cell (Transgen, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ L intestinal bacteria T1 competent cells, 10 μ L plasmid DNA (recombinant cloning vector DBN01-T), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 100rpm rotating speed shaking table shake), LB flat board (the Tryptones 10g/L of the penbritin (100mg/L) of IPTG (isopropylthio-β-D-galactoside) and X-gal (the chloro-3-indoles of the bromo-4-of 5--β-D-galactoside) is scribbled on surface, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, penbritin 100mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, precipitation thalline solution I (25mM Tris-HCl, the 10mM EDTA (ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings, 50mM glucose, pH8.0) suspend; Add the solution II (0.2M NaOH, 1%SDS (sodium lauryl sulphate)) that 200 μ L newly prepare, pipe is put upside down 4 times, mixing, puts 3-5min on ice; Add the ice-cold solution III of 150 μ L (3M Potassium ethanoate, 5M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, adds 2 times of volume dehydrated alcohols in supernatant liquor, and after mixing, room temperature places 5min; Centrifugal 5min under temperature 4 DEG C, rotating speed 12000rpm condition, abandons supernatant liquor, and precipitation concentration (V/V) is dry after the washing with alcohol of 70%; Add TE (10mM Tris-HCl, 1mM EDTA, the pH8.0) dissolution precipitation of 30 μ L containing RNase (20 μ g/mL); Water-bath 30min at temperature 37 DEG C, digestion RNA; Save backup in temperature-20 DEG C.
The plasmid extracted is after SpeI and KasI enzyme cuts qualification, sequence verification is carried out to positive colony, result shows that the described optimization DMT66 nucleotides sequence inserted in recombinant cloning vector DBN01-T is classified as the nucleotide sequence shown in SEQ ID NO:14 in sequence table, namely optimizes DMT66 nucleotide sequence and correctly inserts.
2, the Arabidopis thaliana recombinant expression vector DBN100879 containing optimizing DMT66 nucleotide sequence is built
With restriction enzyme SpeI and KasI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01 (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide)), the optimization DMT66 nucleotide sequence fragment cut is inserted between SpeI and the KasI site of expression vector DBNBC-01, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression vector DBN100879 (being positioned chloroplast(id)), it builds flow process (Kan: kanamycin gene as shown in Figure 8; RB: right margin; AtUbi10: Arabidopis thaliana Ubiquitin (ubiquitin) 10 gene promoter (SEQ ID NO:15); AtCTP2: Arabidopis thaliana chloroplast transit peptides (SEQ ID NO:16); MDMT66: optimize DMT66 nucleotide sequence (SEQ ID NO:14); Nos: the terminator (SEQ ID NO:17) of rouge alkali synthetase gene; PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:18); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQ ID NO:19); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:20); LB: left margin).
By recombinant expression vector DBN100879 heat shock method transformation of E. coli T1 competent cell, its hot shock condition is: 50 μ L intestinal bacteria T1 competent cells, 10 μ L plasmid DNA (recombinant expression vector DBN100879), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 100rpm rotating speed shaking table shake); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex (Kanamycin), yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under temperature 37 DEG C of conditions, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction.The plasmid restriction enzyme SpeI of extraction and KasI enzyme are cut rear qualification, and positive colony is carried out order-checking qualification, result shows that the nucleotides sequence of recombinant expression vector DBN100879 between SpeI and KasI site is classified as nucleotide sequence shown in SEQ ID NO:14 in sequence table, namely optimizes DMT66 nucleotide sequence.
The method of the recombinant expression vector DBN100879 optimizing DMT66 nucleotide sequence is contained according to the structure in the present embodiment described in 2, build the recombinant expression vector DBN100945 (being positioned kytoplasm) containing optimizing DMT66 nucleotide sequence, its carrier structure is (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide) as shown in Figure 9; Kan: kanamycin gene; RB: right margin; AtUbi10: Arabidopis thaliana Ubiquitin (ubiquitin) 10 gene promoter (SEQ ID NO:15); MDMT66: optimize DMT66 nucleotide sequence (SEQ ID NO:14); Nos: the terminator (SEQ ID NO:17) of rouge alkali synthetase gene; PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:18); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQ ID NO:19); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:20); LB: left margin).Carry out sequence verification to positive colony, result shows that the optimization DMT66 nucleotides sequence inserted in recombinant expression vector DBN100945 is classified as the nucleotide sequence shown in SEQ ID NO:14 in sequence table, namely optimizes DMT66 nucleotide sequence and correctly inserts.
3, the Arabidopis thaliana recombinant expression vector DBN100945N containing natural DMT66 nucleotide sequence is built
Contain the method for the recombinant cloning vector DBN01-T optimizing DMT66 nucleotide sequence according to the structure in the present embodiment described in 1, utilize natural DMT66 nucleotide sequence (SEQ ID NO:3) to build the recombinant cloning vector DBN01R-T containing natural DMT66 nucleotide sequence.Carry out sequence verification to positive colony, result shows that the natural DMT66 nucleotides sequence inserted in recombinant cloning vector DBN01R-T is classified as the nucleotide sequence shown in SEQ ID NO:3 in sequence table, and namely natural DMT66 nucleotide sequence correctly inserts.
The method of the recombinant expression vector DBN100879 optimizing DMT66 nucleotide sequence is contained according to the structure in the present embodiment described in 2, utilize natural DMT66 nucleotide sequence to build the recombinant expression vector DBN100945N containing natural DMT66 nucleotide sequence, its carrier structure is (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide) as shown in Figure 10; Kan: kanamycin gene; RB: right margin; AtUbi10: Arabidopis thaliana Ubiquitin (ubiquitin) 10 gene promoter (SEQ ID NO:15); DMT66: natural DMT66 nucleotide sequence (SEQ ID NO:3); Nos: the terminator (SEQ ID NO:17) of rouge alkali synthetase gene; PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:18); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQ ID NO:19); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:20); LB: left margin).Carry out sequence verification to positive colony, result shows that the natural DMT66 nucleotides sequence inserted in recombinant expression vector DBN100945N is classified as the nucleotide sequence shown in SEQ ID NO:3 in sequence table, and namely natural DMT66 nucleotide sequence correctly inserts.
4, Arabidopis thaliana recombinant expression vector transformation Agrobacterium
Be transformed in Agrobacterium GV3101 to oneself through building correct recombinant expression vector DBN100879, DBN100945 and DBN100945N liquid nitrogen method, its conversion condition is: 100 μ L Agrobacterium GV3101,3 μ L plasmid DNA (recombinant expression vector); Be placed in liquid nitrogen 10 minutes, 37 DEG C of warm water bath 10 minutes; Agrobacterium GV3101 after conversion is inoculated in LB test tube and cultivates 2 hours under temperature 28 DEG C, rotating speed are 200rpm condition, be applied on the LB flat board containing the Rifampin (Rifampicin) of 50mg/L and the kantlex of 50mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, carry out digestion verification after cutting DBN100879, DBN100945 and DBN100945N with restriction enzyme BamHI or AhdI enzyme, result shows that recombinant expression vector DBN100879, DBN100945 and DBN100945N structure is entirely true.
The acquisition of the 7th embodiment, transgenic Arabidopsis plants
By wildtype Arabidopsis thaliana seed suspension in 0.1% agarose solution.The seed of suspension is preserved at 4 DEG C 2 days to complete the needs of dormancy to ensure that seed is synchronously sprouted.Also extremely moistening with water sub-irrigation with vermiculite mixing horsehit soil, make soil mixture draining 24 hours.Pretreated seed is covered 7 days with moisture preserving cover on soil mixture.Make seed germination and be 120-150 μm of ol/m in constant temperature (22 DEG C) constant humidity (40-50%) light intensity 2second long-day conditions (16 h light/8 h dark) under in greenhouse culturing plants.Start, with Huo Gelan nutrition liquid irrigation plant, then to irrigate with deionized water, keep soil moisture but do not drench.
Use colored infusion method arabidopsis thaliana transformation.With the Agrobacterium colony inoculation chosen, a or many parts of 15-30mL are containing the pre-culture of the YEP nutrient solution of kantlex (100mg/L) and Rifampin (10mg/L).With 220rpm, culture is shaken overnight incubation 28 DEG C of constant speed.Each pre-culture contains the culture of the YEP nutrient solution of kantlex (100mg/L) and Rifampin (10mg/L) for inoculating two parts of 500ml and culture is continued shake overnight incubation at 28 DEG C.Room temperature, with about 8700 × g centrifugal 10 minutes sedimentation cells, discards the supernatant liquor obtained.Softly be resuspended in by cell precipitation in 500mL osmotic medium, described osmotic medium contains 1/2 × MS salt/B5 VITAMIN, 10% (w/v) sucrose, 0.044 μM of benzyladenine (10 μ L/L (stoste in 1mg/mL DMSO)) and 300 μ L/L Silvet L-77.The plant at about 1 monthly age is soaked 15 seconds in the medium, guarantees the inflorescence that submergence is up-to-date.Then fallen in plant side and covered (transparent or opaque) 24 hours, and then washed with water and vertically place.At 22 DEG C with the photoperiod culturing plants of 16 h light/8 h dark.Soak and gather in the crops seed after about 4 weeks.
By (optimizing DMT66 nucleotide sequence and the natural DMT66 nucleotide sequence) T newly gathered in the crops 1seed was drying at room temperature 7 days.By seed in 26.5 × 51cm sprouting dish, often dish accepts 200mg T 1seed (about 10000 seeds), described seed has been suspended in 40mL 0.1% agarose solution in advance and at 4 DEG C, has preserved 2 days to complete the needs of dormancy to ensure that seed is synchronously sprouted.
Also extremely moistening with water sub-irrigation with vermiculite mixing horsehit soil, utilize gravity drainage.With transfer pipet, pretreated seed (each 40mL) is planted on soil mixture equably, and cover 4-5 days with moisture preserving cover.After use is emerged, spray the careless ammonium phosphine pat gene of cotransformation (select) carry out initial transformant and select to remove cover in first 1 day.
After 7 plantation number of days (DAP) reuse DeVilbiss compressed-air atomizer with 0.2% spray solution T of the sprinkling volume Liberty weedicide of 10mL/ dish (703L/ha) (the careless ammonium phosphine of 200g ai/L) in 11DAP 1plant (being respectively cotyledon period and 2-4 leaf phase), to provide the careless ammonium phosphine of each application 280g ai/ha significant quantity.In the end qualification survival strain (plant of active growth) in 4-7 days after sprinkling, and be transplanted to (often dish 3-5) in the square basin of the 7cm x 7cm prepared with horsehit soil and vermiculite respectively.The plant 3-4 days transplanted is covered with moisture preserving cover, and as being prepended in 22 DEG C of culturing room or directly moving into greenhouse.Then remove cover and before test DMT66 gene provides the ability of Banvel D tolerance at least 1 day by plant cultivating to greenhouse (22 ± 5 DEG C, 50 ± 30%RH, 14 h light: 10 h dark, minimum 500 μ E/m 2s 1natural+to supplement light).
The herbicide tolerant effect detection of the 8th embodiment, transgenic Arabidopsis plants
Transformation of Arabidopsis thaliana is first carried out with DMT66 gene.First use in the unconverted seed background of careless ammonium phosphine selection scheme and select T 1transformant.Transform the Arabidopsis plant (At chloroplast(id) mDMT66) proceeding to optimization DMT66 nucleotide sequence for being positioned chloroplast(id) of recombinant expression vector DBN100879, transforming the Arabidopsis plant (At kytoplasm mDMT66) proceeding to optimization DMT66 nucleotide sequence for being positioned kytoplasm of recombinant expression vector DBN100945, transforming the Arabidopsis plant (At kytoplasm DMT66) proceeding to natural DMT66 nucleotide sequence for being positioned kytoplasm of recombinant expression vector DBN100945N.Screen the T of about 20000 At chloroplast(id) mDMT66 1seed, and identify 213 strain T 1for positive transformant (pat gene), the transformation efficiency of about 1.0%; Screen the T of about 20000 At kytoplasm mDMT66 1seed, and identify 195 strain T 1for positive transformant (pat gene), the transformation efficiency of about 1.0%; Screen the T of about 20000 At kytoplasm DMT66 1seed, and identify 172 strain T 1for positive transformant (pat gene), the transformation efficiency of about 0.86%.By the T of At chloroplast(id) mDMT66 1the T of plant, At kytoplasm mDMT66 1the T of plant, At kytoplasm DMT66 1plant and wild-type Arabidopsis plants (after planting 18 days) carry out herbicide tolerant effect detection to dicamba 98.
Respectively by the T of At chloroplast(id) mDMT66 1the T of plant, At kytoplasm mDMT66 1the T of plant, At kytoplasm DMT66 1plant and wild-type Arabidopsis plants dicamba 98 (560g ae/ha, 1 times of land for growing field crops concentration) and blank solvent (water) are sprayed.Spraying 7 days with 14 days adds up plant tolerated afterwards: what after 7 days, upgrowth situation was consistent with blank solvent (water) divides high resistance plant into, anti-plant in the dividing into of lotus throne leaf roll song is had after 7 days, after 14 days still can not bolting divide low anti-plant into, deadly after 14 days divides not anti-plant into.Due to every strain Arabidopis thaliana T 1plant is independently transformation event, can estimate individual T in given dose 1the significant difference of response.Result is as shown in table 1 and Figure 11.
For Arabidopis thaliana, 560g ae/ha dicamba 98 is the effective dose separated with the floral region with average durability level by sensitive plant.The result of table 1 and Figure 11 shows: optimization DMT66 gene gives individual arabidopsis thaliana Banvel D tolerance, and (reason only having plant part to have tolerance is due to T 1be random for plant insertion point, thus the expression level of genes conferring resistance is variant, shows the difference of durability level); Compared to the T of At kytoplasm DMT66 1plant, the T of At kytoplasm mDMT66 1higher Banvel D tolerance can be produced for Arabidopis thaliana offspring part, show that described DMT66 gene can strengthen the tolerance of arabidopsis thaliana to Banvel D through vegetable codon optimization; Again compared to the T of At kytoplasm mDMT66 1plant, the T of At chloroplast(id) mDMT66 1higher Banvel D tolerance can be produced for Arabidopis thaliana offspring part, show that the described optimization DMT66 assignment of genes gene mapping is expressed in chloroplast(id) and can strengthen the tolerance of arabidopsis thaliana to Banvel D; Wildtype Arabidopsis thaliana does not then have Banvel D tolerance.
Table 1, transgenic arabidopsis T 1plant herbicide tolerant experimental result
The structure of the 9th embodiment, corn recombinant expression vector and recombinant expression vector transformation Agrobacterium
1, the corn recombinant expression vector DBN-HT120066 containing optimizing DMT66 nucleotide sequence is built
With restriction enzyme SpeI and KasI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-02 (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide)), the optimization DMT66 nucleotide sequence fragment cut is inserted between SpeI and the KasI site of expression vector DBNBC-02, conventional enzymatic cleavage methods carrier construction is utilized to be well-known to those skilled in the art, be built into recombinant expression vector DBN-HT120066 (being positioned chloroplast(id)), it builds flow process (Kan: kanamycin gene as shown in figure 12; RB: right margin; Ubi: corn Ubiquitin (ubiquitin) 1 gene promoter (SEQ ID NO:21); AtCTP2: Arabidopis thaliana chloroplast transit peptides (SEQ ID NO:16); MDMT66: optimize DMT66 nucleotide sequence (SEQ ID NO:14); Nos: the terminator (SEQ ID NO:17) of rouge alkali synthetase gene; PMI: Phophomannose isomerase gene (SEQ ID NO:22); LB: left margin).
By recombinant expression vector DBN-HT120066 heat shock method transformation of E. coli T1 competent cell, its hot shock condition is: 50 μ L intestinal bacteria T1 competent cells, 10 μ L plasmid DNA (recombinant expression vector DBN-HT120066), 42 DEG C of water-baths 30 seconds; 37 DEG C of shaking culture 1 hour (under 100rpm rotating speed shaking table shake); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L kantlex, yeast extract 5g/L, NaCl 10g/L, agar 15g/L, adjust pH to 7.5 with NaOH) upper cultivation 12 hours under temperature 37 DEG C of conditions, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl 10g/L, kantlex 50mg/L, with NaOH adjust pH to 7.5) under temperature 37 DEG C of conditions overnight incubation.Its plasmid of alkalinity extraction.The plasmid restriction enzyme SpeI of extraction and KasI enzyme are cut rear qualification, and positive colony is carried out order-checking qualification, result shows that the nucleotides sequence of recombinant expression vector DBN-HT120066 between SpeI and KasI site is classified as nucleotide sequence shown in SEQ ID NO:14 in sequence table, namely optimizes DMT66 nucleotide sequence.
2, the corn recombinant expression vector DBN-HT120066N containing natural DMT66 nucleotide sequence is built
The method of the recombinant expression vector DBN-HT120066 optimizing DMT66 nucleotide sequence is contained according to the structure in the present embodiment described in 1, utilize the recombinant cloning vector DBN01R-T containing natural DMT66 nucleotide sequence in sixth embodiment of the invention described in 3, build the recombinant expression vector DBN-HT120066N containing natural DMT66 nucleotide sequence, its carrier structure is (carrier framework: pCAMBIA2301 (CAMBIA mechanism can provide) as shown in figure 13; Kan: kanamycin gene; RB: right margin; Ubi: corn Ubiquitin (ubiquitin) 1 gene promoter (SEQ ID NO:21); AtCTP2: Arabidopis thaliana chloroplast transit peptides (SEQ ID NO:16); DMT66: natural DMT66 nucleotide sequence (SEQ ID NO:3); Nos: the terminator (SEQ ID NO:17) of rouge alkali synthetase gene; PMI: Phophomannose isomerase gene (SEQ ID NO:22); LB: left margin).Carry out sequence verification to positive colony, result shows that the natural DMT66 nucleotides sequence inserted in recombinant expression vector DBN-HT120066N is classified as the nucleotide sequence shown in SEQ ID NO:3 in sequence table, and namely natural DMT66 nucleotide sequence correctly inserts.
3, corn recombinant expression vector transformation Agrobacterium
To oneself through building correct recombinant expression vector DBN-HT120066 and DBN-HT120066N liquid nitrogen method is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector); Be placed in liquid nitrogen 10 minutes, 37 DEG C of warm water bath 10 minutes; Agrobacterium LBA4404 after conversion is inoculated in LB test tube and cultivates 2 hours under temperature 28 DEG C, rotating speed are 200rpm condition, be applied on the LB flat board containing the Rifampin (Rifampicin) of 50mg/L and the kantlex of 50mg/L until grow positive monoclonal, picking Colony Culture also extracts its plasmid, carry out digestion verification after cutting DBN-HT120066 and DBN-HT120066N with restriction enzyme EcoRI and AhdI enzyme, result show recombinant expression vector DBN-HT120066 and DBN-HT120066N structure entirely true.
The acquisition of the tenth embodiment, transgenic corn plant and checking
The Agrobacterium infestation method conveniently adopted, by the Agrobacterium Dual culture in the rataria of comprehensive for the corn variety of sterile culture 31 (Z31) and ninth embodiment of the invention described in 3, so that the T-DNA in 1 and 2 recombinant expression vector DBN-HT120066 and DBN-HT120066N built in ninth embodiment of the invention (is comprised the promoter sequence of corn Ubiquitin1 gene, optimize DMT66 nucleotide sequence, natural DMT66 nucleotide sequence, AtCTP2 chloroplast transit peptide sequence, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, obtain and be positioned proceeding to the milpa (Zm chloroplast(id) mDMT66) of optimization DMT66 nucleotide sequence and being positioned the milpa (Zm chloroplast(id) DMT66) proceeding to natural DMT66 nucleotide sequence of chloroplast(id) of chloroplast(id), in contrast with wild-type corn plant simultaneously.
For agriculture bacillus mediated corn transformation, briefly, from corn, be separated immature rataria, contact rataria with agrobacterium suspension, wherein DMT66 nucleotide sequence can be passed at least one cell (step 1: infect step) of one of rataria by Agrobacterium.In this step, rataria preferably immerses agrobacterium suspension (OD 660=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in start inoculation.Rataria and Agrobacterium Dual culture one period (3 days) (step 2: Dual culture step).Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation.After this Dual culture stage, optionally " recovery " step can be had.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH5.8) at least exist in a kind of oneself know suppress Agrobacterium growth microbiotic (cephamycin), do not add the selective agent (step 3: recovering step) of vegetable transformant.Preferably, rataria is having microbiotic but is not having the solid medium of selective agent is cultivated, to eliminate Agrobacterium and to provide decubation for infected cell.Then, the rataria of inoculation cultivates the transformed calli (step 4: select step) that also growth selection on the substratum containing selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH5.8) upper cultivation, causes the cell selective growth transformed.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, is above cultivating with aftergrowth at solid medium (MS division culture medium and MS root media) containing the callus that the substratum of selective agent grows.
Screen the resistant calli obtained and transfer to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, plant gel 3g/L, pH5.8), on, at 25 DEG C, differentiation is cultivated.Differentiation seedling out transfers to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, plant gel 3g/L, pH5.8) on, be cultured to about 10cm at 25 DEG C high, move to hot-house culture to solid.In greenhouse, every day cultivates 16 hours at 28 DEG C, then cultivates 8 hours at 20 DEG C.
2, transgenic corn plant is verified with TaqMan
The blade getting Zm chloroplast(id) mDMT66 and Zm chloroplast(id) DMT66 is respectively about 100mg as sample, extract its genomic dna with the DNeasy Plant Maxi Kit of Qiagen, determined the copy number of transgenic corn plant by the copy number of Taqman fluorescence probe quantitative PCR method detection PMI gene.In contrast with wild-type corn plant, carry out detection according to the method described above to analyze simultaneously.3 repetitions are established in experiment, average.
The concrete grammar detecting PMI gene copy number is as follows:
Step 11, get each 100mg of blade of Zm chloroplast(id) mDMT66, Zm chloroplast(id) DMT66 and wild-type corn plant respectively, in mortar, be ground into homogenate with liquid nitrogen respectively, 3 repetitions got by each sample;
The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;
Step 13, measure the genomic dna concentration of above-mentioned sample with NanoDrop 2000 (Thermo Scientific);
Step 14, adjust the genomic dna concentration of above-mentioned sample to same concentration value, the scope of described concentration value is 80-100ng/ μ L;
The copy number of step 15, employing Taqman fluorescence probe quantitative PCR method qualification sample, using the sample through qualification known copy number as standard substance, with the sample of wild-type corn plant in contrast, the repetition of 3, each sample, gets its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:
Following primer and probe are used for detecting PMI gene:
Primer 5:CCGGGTGAATCAGCGTTT is as shown in SEQ ID NO:23 in sequence table;
Primer 6:GCCGTGGCCTTTGACAGT is as shown in SEQ ID NO:24 in sequence table;
Probe 1:TGCCGCCAACGAATCACCGG is as shown in SEQ ID NO:24 in sequence table;
PCR reaction system is:
Described 50 × primer/probe mixture comprises each 45 μ L of often kind of primer of 1mM concentration, the probe 50 μ L of 100 μMs of concentration and 860 μ L 1 × TE damping fluids, and at 4 DEG C, is housed in amber tube.
PCR reaction conditions is:
Utilize SDS2.3 software (Applied Biosystems) analytical data.
Experimental result shows, all oneself is incorporated in the genome of detected milpa for optimization DMT66 nucleotide sequence and natural DMT66 nucleotide sequence, and Zm chloroplast(id) mDMT66 and Zm chloroplast(id) DMT66 all obtains the transgenic corn plant containing single copy DMT66 gene.
The Herbicid resistant effect detection of the 11 embodiment, transgenic corn plant
Zm chloroplast(id) mDMT66, Zm chloroplast(id) DMT66 and wild-type corn plant (V3-V4 period) are carried out Herbicid resistant effect detection to dicamba 98 respectively.
Get the T of Zm chloroplast(id) mDMT66, Zm chloroplast(id) DMT66 and wild-type corn plant respectively 1for heterozygous plant (v5-v6 phase), and spray by Banvel D (4480g ae/ha, 8 times of land for growing field crops concentration) and blank solvent (water).Spray 21 days and add up buttress root developmental state afterwards.Zm chloroplast(id) mDMT66 is totally 3 strains (S1, S2 and S3), and Zm chloroplast(id) DMT66 is totally 2 strains (S4 and S5), (CK) totally 1 strain of wild-type; 10-15 strain is selected to test from each strain.Result is as shown in table 2.
Table 2, transgenic corns T 1plant Herbicid resistant experimental result
The result of table 2 shows: optimize the high-level tolerance (because monocotyledons itself has certain resistance to Banvel D, thus showing high-level resistance) that DMT66 gene gives rotaring gene corn plant Banvel D; Compared to Zm chloroplast(id) DMT66, Zm chloroplast(id) mDMT66 can produce higher Banvel D tolerance, shows that described DMT66 gene can strengthen the tolerance of maize plant to Banvel D through vegetable codon optimization; Zm chloroplast(id) DMT66 has moderate Banvel D tolerance; Wild-type corn plant does not then have Banvel D tolerance.
In sum, DMT66 gene of the present invention can be degraded Banvel D, optimizes the preferred codons that DMT66 gene adopts corn and soybean, makes it be particularly suitable for expressing in plant; Optimizing DMT66 gene can give transgenic plant better Banvel D tolerance, and expresses compared in kytoplasm, and the described optimization DMT66 assignment of genes gene mapping is expressed and can be strengthened the tolerance of transgenic plant to Banvel D in chloroplast(id); Herbicide tolerant 3-protein d MT66 of the present invention is the demethylase of aerobic tetrahydrofolic acid (THFA) dependent form simultaneously, and it is different from known dicamba 98 tolerant genes, therefore can expand dicamba 98 tolerance type range of application on plant.
It should be noted last that, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to technical scheme of the present invention or equivalent replacement, and not depart from the spirit and scope of technical solution of the present invention.

Claims (25)

1. a protein, is characterized in that, has the protein of the aminoacid sequence composition shown in SEQ ID NO:2.
2. a gene, is characterized in that, comprising:
The nucleotide sequence of protein described in (a) coding claim 1; Or
The nucleotide sequence of b nucleotide sequence complementary that () limits with (a) under strict conditions; Or
C () has the nucleotide sequence shown in SEQ ID NO:3; Or
D () has the nucleotide sequence shown in SEQ ID NO:14.
3. a combined protein, is characterized in that, comprises at least by the first nucleotide sequence and second nucleotide sequence coded, protein described in described first nucleotide sequence coded claim 1.
4. combined protein according to claim 3, is characterized in that, described second nucleotide sequence coded methyl tetrahydrofolate reductase enzyme, formyltetrahydrofolate deformylase and/or methyne cyclase.
5. combined protein according to claim 4, it is characterized in that, described methyl tetrahydrofolate reductase enzyme has the aminoacid sequence shown in SEQ ID NO:4, described formyltetrahydrofolate deformylase has the aminoacid sequence shown in SEQ IDNO:6, and described methyne cyclase has the aminoacid sequence shown in SEQ ID NO:8.
6. combined protein according to claim 5, it is characterized in that, described second nucleotide sequence has SEQ ID NO:5, SEQ ID NO:7 and/or the nucleotide sequence shown in SEQ ID NO:9.
7. combined protein according to claim 6, it is characterized in that, the nucleotide sequence of described combined protein of encoding has the nucleotide sequence shown in SEQ ID NO:26.
8. combined protein according to claim 7, it is characterized in that, the nucleotide sequence of described combined protein of encoding has the nucleotide sequence shown in SEQ ID NO:1.
9. an expression cassette, is characterized in that, is included in the nucleotide sequence of combined protein described in gene described in the claim 2 under the regulating and controlling sequence regulation and control effectively connected or any one of coding claim 3-8.
10. expression cassette according to claim 9, it is characterized in that, described regulating and controlling sequence is chloroplast transit peptides, and described chloroplast transit peptides is effectively connected with gene described in claim 2.
11. expression cassettes according to claim 10, it is characterized in that, the nucleotide sequence of described chloroplast transit peptides has the nucleotide sequence shown in SEQ ID NO:16.
The recombinant vectors of expression cassette described in 12. 1 kinds of nucleotide sequences or any one of claim 9-11 comprising combined protein described in gene described in claim 2, coding any one of claim 3-8.
13. 1 kinds of methods increasing herbicide-tolerant scope, it is characterized in that, comprising: is expressed together with the second protein that the protein of expression cassette coding described in combined protein described in protein, any one of claim 3-8 described in claim 1 or any one of claim 9-11 is different from the protein that combined protein or any one of claim 9-11 are encoded described in protein described in claim 1, any one of claim 3-8 in plant with at least one.
14. according to the method increasing herbicide tolerant described in claim 13, it is characterized in that, described the second protein is glyphosate tolerant protein, glufosinate tolerant protein, alpha Ketoglutarate dioxygenase, 4-hydroxyphenyl pyravate dioxygenase, acetolactate synthase, cytopigment proteinoid or proporphyrinogen oxidase.
Select the method for vegetable cell transformed for 15. 1 kinds, it is characterized in that, comprise: transform multiple vegetable cell with expression cassette described in the nucleotide sequence of combined protein described in gene described in claim 2, any one of coding claim 3-8 or any one of claim 9-11, and at permission expressing said gene, the nucleotide sequence of described combined protein of encoding or the transformed cell growth of described expression cassette, and kill no transformed cells or cultivate described cell under suppressing the herbicide concentration of no transformed cells growth, described weedicide is dicamba 98.
16. 1 kinds of methods controlling weeds, it is characterized in that, comprise: the Banvel D land for growing field crops of planting plants being used to effective dose, described plant comprises recombinant vectors described in expression cassette described in the nucleotide sequence of combined protein described in gene described in claim 2, coding any one of claim 3-8, any one of claim 9-11 or claim 12.
17. 1 kinds of protective plants are from the method for the damage caused by weedicide; it is characterized in that; comprise: recombinant vectors described in expression cassette described in the nucleotide sequence of combined protein described in gene, any one of coding claim 3-8 described in claim 2, any one of claim 9-11 or claim 12 is imported plant, the plant after importing is produced and enough protects its herbicide tolerant protein from dicamba 98 infringement amount.
18. 1 kinds of methods of giving plant Banvel D tolerance, it is characterized in that, comprising: recombinant vectors described in expression cassette described in the nucleotide sequence of combined protein described in gene, any one of coding claim 3-8 described in claim 2, any one of claim 9-11 or claim 12 is imported plant.
19. 1 kinds of methods controlling the land for growing field crops glyphosate tolerance weeds of glyphosate-tolerant plant, it is characterized in that, comprise: use the dicamba 98 of effective dose to the land for growing field crops of plantation glyphosate-tolerant plant, described glyphosate-tolerant plant comprises recombinant vectors described in expression cassette described in the nucleotide sequence of combined protein described in gene described in claim 2, any one of coding claim 3-8, any one of claim 9-11 or claim 12.
20. 1 kinds of methods producing dicamba tolerant plant, it is characterized in that, comprise in the genome of described plant, to introduce combined protein described in gene described in claim 2, any one of coding claim 3-8 nucleotide sequence or any one of claim 9-11 described in expression cassette, to produce dicamba tolerant plant.
21. according to the method producing dicamba tolerant plant described in claim 20, it is characterized in that, comprise: by producing dicamba tolerant plant by mother plant selfing or with the second plant hybridization, described mother plant and/or the second plant comprise gene described in claim 2, expression cassette described in the nucleotide sequence of combined protein described in coding any one of claim 3-8 or any one of claim 9-11, described dicamba tolerant plant heredity is from the described gene of described mother plant and/or the second plant, to encode the nucleotide sequence of described combined protein or described expression cassette.
22. 1 kinds of cultivations have the method for the plant of tolerance to Banvel D, it is characterized in that, comprising:
Plant at least one plant seed, the genome of described plant seed comprises expression cassette described in the nucleotide sequence of combined protein described in gene described in claim 2, any one of coding claim 3-8 or any one of claim 9-11;
Described plant seed is made to grow up to plant;
Spray described plant with effective dose Banvel D, gather in the crops the plant that with other, not there is described gene, there is compared with the nucleotide sequence of described combined protein of encoding or the plant of described expression cassette the plant injury weakened.
23. according to any one of claim 13-22 method, it is characterized in that, described plant is soybean, cotton, corn, paddy rice, wheat, beet or sugarcane.
The purposes of the demethylase dicamba tolerant weedicide of 24. 1 kinds of aerobic tetrahydrofolic acid (THFA) dependent forms.
25. 1 kinds of bacterial strains, it comprises the nucleotide sequence shown in SEQ ID NO:3, and described bacterial strain is CCTCC M 2014550 at the deposit number of China typical culture collection center.
CN201410806871.2A 2014-12-22 2014-12-22 A herbicide tolerant protein, a coding gene thereof and uses of the protein Active CN104611304B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410806871.2A CN104611304B (en) 2014-12-22 2014-12-22 A herbicide tolerant protein, a coding gene thereof and uses of the protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410806871.2A CN104611304B (en) 2014-12-22 2014-12-22 A herbicide tolerant protein, a coding gene thereof and uses of the protein

Publications (2)

Publication Number Publication Date
CN104611304A true CN104611304A (en) 2015-05-13
CN104611304B CN104611304B (en) 2017-05-17

Family

ID=53145956

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410806871.2A Active CN104611304B (en) 2014-12-22 2014-12-22 A herbicide tolerant protein, a coding gene thereof and uses of the protein

Country Status (1)

Country Link
CN (1) CN104611304B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105925590A (en) * 2016-06-18 2016-09-07 北京大北农生物技术有限公司 Herbicide resistance protein and coding gene and application thereof
CN107828803A (en) * 2017-11-03 2018-03-23 南京农业大学 The hydroxylation enzyme gene dsmABC of 3,6 dichlorosalicylic acid 5 and its application
CN108330115A (en) * 2018-04-13 2018-07-27 重庆市农业科学院 A kind of resistance glyphosate epsp synthase MC1-EPSPS and its encoding gene and application
CN109476709A (en) * 2016-06-16 2019-03-15 福阿母韩农株式会社 The method and composition of herbicide tolerant is assigned and/or enhanced using proporphyrinogen oxidase or its variant
CN111139238A (en) * 2019-10-14 2020-05-12 中国农业科学院生物技术研究所 Degradation gene dicX3 of herbicide dicamba and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1236394A (en) * 1996-11-07 1999-11-24 曾尼卡有限公司 Herbicide resistant plants
US7022896B1 (en) * 1997-04-04 2006-04-04 Board Of Regents Of University Of Nebraska Methods and materials for making and using transgenic dicamba-degrading organisms
CN101460626A (en) * 2006-06-06 2009-06-17 孟山都技术有限公司 Method for selection of transformed cells
USRE45048E1 (en) * 2006-06-06 2014-07-22 Monsanto Technology Llc Methods for weed control using plants having dicamba-degrading enzymatic activity

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1236394A (en) * 1996-11-07 1999-11-24 曾尼卡有限公司 Herbicide resistant plants
US7022896B1 (en) * 1997-04-04 2006-04-04 Board Of Regents Of University Of Nebraska Methods and materials for making and using transgenic dicamba-degrading organisms
CN101460626A (en) * 2006-06-06 2009-06-17 孟山都技术有限公司 Method for selection of transformed cells
USRE45048E1 (en) * 2006-06-06 2014-07-22 Monsanto Technology Llc Methods for weed control using plants having dicamba-degrading enzymatic activity

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
JEAN ET AL.: "Molecular characterization of Fdxl,a putidaredoxin-type [2Fe-2S] ferredoxin able to transfer electrons to the dioxin dioxygenase of Sphingomonas sp. RWl", 《EUR.J.BIOCHEM.》 *
MV SUBRAMANIAN: "Engineering dicamba selectivity in crops: a search for appropriate degradative enzyme(s)", 《JOURNAL OF INDUSTRIAL MICROBIOLOGY & BIOTECHNOLOGY》 *
TOMOKUNI ET AL.: "A Tetrahydrofolate-Dependent O-Demethylase, LigM, Is Crucial for Catabolism of Vanillate and Syringate in Sphingomonas paucimobilis SYK-6", 《JOURNAL OF BACTERIOLOGY》 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109476709A (en) * 2016-06-16 2019-03-15 福阿母韩农株式会社 The method and composition of herbicide tolerant is assigned and/or enhanced using proporphyrinogen oxidase or its variant
CN105925590A (en) * 2016-06-18 2016-09-07 北京大北农生物技术有限公司 Herbicide resistance protein and coding gene and application thereof
CN105925590B (en) * 2016-06-18 2019-05-17 北京大北农生物技术有限公司 Herbicide resistance protein, its encoding gene and purposes
CN107828803A (en) * 2017-11-03 2018-03-23 南京农业大学 The hydroxylation enzyme gene dsmABC of 3,6 dichlorosalicylic acid 5 and its application
CN107828803B (en) * 2017-11-03 2020-12-22 南京农业大学 3, 6-dichlorosalicylic acid 5-hydroxylase gene dsmABC and application thereof
CN108330115A (en) * 2018-04-13 2018-07-27 重庆市农业科学院 A kind of resistance glyphosate epsp synthase MC1-EPSPS and its encoding gene and application
CN108330115B (en) * 2018-04-13 2021-08-13 重庆市农业科学院 Glyphosate-resistant EPSP synthetase MC1-EPSPS, and coding gene and application thereof
CN111139238A (en) * 2019-10-14 2020-05-12 中国农业科学院生物技术研究所 Degradation gene dicX3 of herbicide dicamba and application thereof
CN111139238B (en) * 2019-10-14 2021-08-03 中国农业科学院生物技术研究所 Degradation gene dicX3 of herbicide dicamba and application thereof

Also Published As

Publication number Publication date
CN104611304B (en) 2017-05-17

Similar Documents

Publication Publication Date Title
CN103013938B (en) Herbicide resistance protein, coding gene and application thereof
CN103060279B (en) Herbicide resistance protein and encoding genes thereof and application thereof
CA2975762C (en) Herbicide-resistant protein, encoding gene and use thereof
EP4032976A1 (en) Mutant hydroxyphenylpyruvate dioxygenase polypeptide, encoding gene thereof and use thereof
CN104611304B (en) A herbicide tolerant protein, a coding gene thereof and uses of the protein
AU2016218739B2 (en) Herbicide-resistant protein, encoding gene and use thereof
CA2976060C (en) Herbicide-resistant protein, encoding gene and use thereof
CN103013939B (en) Weedicide-resistant protein, coding gene and application thereof
US11365425B2 (en) Resistant protein for use in herbicide, encoding gene and application thereof
CN104630162B (en) Herbicide tolerant protein, its encoding gene and purposes
CN103740663B (en) Herbicide resistance protein, its encoding gene and purposes
CN103740666A (en) Herbicide-resistant protein as well as encoding gene and application thereof
CN103740665B (en) Herbicide resistance protein, its encoding gene and purposes
CN103740664A (en) Weedicide-resistant protein, coding gene and application thereof
CN103725653B (en) Herbicide resistance protein, its encoding gene and purposes
WO2023108495A1 (en) Mutated hydroxyphenylpyruvate dioxygenase polypeptide, and coding gene and use thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB02 Change of applicant information

Address after: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49

Applicant after: BEIJING DBN BIOTECH CO., LTD.

Applicant after: Nanjing Agricultural University

Address before: 100193 No. 2, West Old Summer Palace Road, Beijing, Haidian District, Institute of atomic energy, Chinese Academy of Agricultural Sciences, building 49

Applicant before: Biotechnology Center of Beijing Dabeinong Technology Group Co., Ltd.

Applicant before: Nanjing Agricultural University

COR Change of bibliographic data
GR01 Patent grant
GR01 Patent grant