CN103740666A

CN103740666A - Herbicide-resistant protein as well as encoding gene and application thereof

Info

Publication number: CN103740666A
Application number: CN201310730718.1A
Authority: CN
Inventors: 陶青; 吴业春; 谢香庭; 丁德荣
Original assignee: BIOTECHNOLOGY CENTER OF BEIJING DABEINONG TECHNOLOGY GROUP Co Ltd; Beijing Dabeinong Technology Group Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2013-12-26
Filing date: 2013-12-26
Publication date: 2014-04-23
Anticipated expiration: 2033-12-26
Also published as: CN103740666B

Abstract

The invention relates to a herbicide-resistant protein as well as an encoding gene and application thereof. The herbicide-resistant protein comprises: (a) a protein constituted by an amino acid sequence shown as SEQ ID NO: 2, or (b) a protein which is obtained by performing substitution and/or deletion and/or addition of one or more amino acid residues on the amino acid sequence in (a), has herbicide resisting activity and is derived from (a). The herbicide-resistant protein is particularly suitable for expression in plants, and is highly resistant to herbicides, especially a phenoxyl auxin herbicide.

Description

Herbicid resistant protein, its encoding gene and purposes

Technical field

The present invention relates to a kind of Herbicid resistant protein, its encoding gene and purposes, particularly relate to a kind of protein, its encoding gene and purposes 2,4-D to resistance.

Background technology

Weeds are crop and the needed valuable nutrient of other object plant in exhausted soil rapidly.Permitted at present eurypalynous weedicide for controlling weeds, a kind of popular especially weedicide is glyphosate.Developed crop glyphosate to resistance, as corn, soybean, cotton, beet, wheat and paddy rice etc.Therefore can spray glyphosate to the field of plantation glyphosate resistance crop and significantly not damage crop to control weeds.

Glyphosate was widely used in the whole world over 20 years, cause thus the depending on unduly of glyphosate and glyphosate-tolerant crop technology, and in wild weed species, the natural plant that has more tolerance or developed resistance glyphosate activity of glyphosate has been applied to high selection and press.Reported that minority weeds have developed the resistance to glyphosate, comprised broadleaf weeds and gramineous weeds, as wimmera ryegrass, Itanlian rye, Herba Eleusines Indicae, artemisiifolia, Horseweed Herb, wild pool wormwood artemisia and buckhorn plantain.In addition, the weeds that were not agricultural problem before being widely used glyphosate-tolerant crop are also prevailing gradually, and be difficult to control with glyphosate-tolerant crop, these weeds mainly occur together with the broadleaf weeds restive with (but not only with), as Amaranthus, Chenopodium, Dandelion and Commelianaceae species.

In the area of glyphosate resistance weeds or restive weed species, grower can be mixed or be used instead by tank and can control the weakness that other weedicide of omitting weeds makes up glyphosate.The mixed companion of a kind of popular and effective tank who controls as a rule broadleaf weeds for 2,4 dichlorophenoxyacetic acid (2,4-D).2,4-D controls over 65 years for wide spectrum broadleaf weeds under agricultural and non-crops condition, is still one of the most widely used weedicide of the whole world.To further use 2,4-D to be limited in its selectivity in dicotyledons (as soybean or cotton) very low, therefore 2,4-D is generally not used in (and generally not close) susceptibility dicotyledonous crops.In addition, the purposes of 2,4-D in gramineous crop is limited to the character of the crop damage that may occur to a certain extent.The combination of 2,4-D and glyphosate is for stronger raw processing of going out was provided before the no-tillage soybean of plantation and cotton, yet due to the susceptibility of these dicotyledonous species to 2,4-D, these raw processing of going out must be carried out for 14-30 days before plantation.

The same with 2,4-D propionic acid with MCPA, 2-first-4-chloropropionic acid, 2,4-D is fibric acid weedicide.2,4-D is used at many monocot cropss (as corn, wheat and paddy rice) selective control broadleaf weeds and not serious damage object crop.2,4-D is synthetic plant hormone derivative, and it act as and makes normal cytohormone homeostasis imbalance, and hinders the controlled growth of balance.

2,4-D has the selectivity (as more responsive than grass in dicotyledons) of different levels to certain plants.Different plants are optionally a kind of explanations of different levels to the different metabolic of 2,4-D.Conventionally the slow metabolism 2 of plant, 4-D, so the different activities of target site more possible explanation plant to different the replying of 2,4-D.The plant metabolism of 2,4-D is generally realized by two step metabolism, is generally then to put together with amino acid or glucose after hydroxylation.

Along with the development of time, microbial population has developed the effective alternative route of this specific exotic of degraded, and described approach causes the permineralization of 2,4-D.To microorganism continuous application weedicide can be used to select to utilize weedicide as carbon source the microorganism for growth (thereby making it there is competitive edge at soil).Because this reason, is formulated as 2,4-D at present and has the relatively short soil transformation period, and crop thereafter is not run into and significantly leaves over effect.This has promoted the weedicide application of 2,4-D.

Broad research a kind of biology of its degraded 2,4-D ability be Ralstonia eutropha (Ralstonia eutropha).The gene of first enzymatic step in coding mineralising approach is tfdA.TfdA is by alpha Ketoglutarate dependency dioxygenase catalytic reaction 2, and 4-D acid changes into chlorophenesic acid (DCP).DCP and 2,4-D compare has herbicidal activity hardly.TfdA in transgenic plant for to conventionally to input 2,4-D resistance in the dicotyledons of 2,4-D sensitivity (as cotton and tobacco).

In environment, identified can the degrade tfdA type gene of protein of 2,4-D of a large amount of codings.Many homologues similar to tfdA (amino acid identity >85%) also have the enzymic activity similar to tfdA.Yet, have a large amount of homologues and tfdA to there is significantly lower identity (25-50%), but have and alpha Ketoglutarate dependency dioxygenase Fe ^{+ 2}the feature residue that dioxygenase is relevant.Therefore the substrate specificity of these different dioxygenases is what is also indefinite.The unique instances with tfdA with low homology (amino acid identity 28%) is the rdpA from Sphingobium herbicidovorans.Shown this enzyme catalysis (R)-2,4-D propionic acid (and other (R)-phenoxy propionic acid) and 2,4-D(phenoxy acetic acid) the first step of mineralising.

Along with the appearance of glyphosate resistance weeds and the broadened application of 2,4-D weedicide, need to be to inputting 2,4-D resistance in the object plant of 2,4-D sensitivity.Do not find at present expression level and the tolerance report to weedicide of AADM3 Herbicid resistant albumen in plant.

Summary of the invention

The object of this invention is to provide a kind of Herbicid resistant protein, its encoding gene and purposes, the present invention aims to provide a kind of new AADM3 gene, and described AADM3 albumen has higher tolerance to weedicide in plant.

For achieving the above object, the invention provides a kind of Herbicid resistant protein, comprising:

(a) there is the protein that the aminoacid sequence shown in SEQ ID NO:2 forms; Or

(b) aminoacid sequence in (a) through replacement and/or disappearance and/or add one or several amino acid and have aryloxy alkanoates dioxygenase activity by (a) derivative protein.

For achieving the above object, the invention provides a kind of herbicide resistance gene, comprising:

(a) the encode nucleotide sequence of described Herbicid resistant protein; Or

(b) nucleotide sequence that there is the protein of aryloxy alkanoates dioxygenase activity with the nucleotide sequence hybridization (a) limiting and coding under stringent condition; Or

(c) there is the nucleotide sequence shown in SEQ ID NO:1.

Described stringent condition can be the Trisodium Citrate at 6 * SSC(), 0.5%SDS(sodium lauryl sulphate) in solution, at 65 ℃, hybridization, then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.

For achieving the above object, the present invention also provides a kind of expression cassette, is included in the described herbicide resistance gene under the regulating and controlling sequence regulation and control of effective connection.

For achieving the above object, the present invention also provides a kind of recombinant vectors that comprises described herbicide resistance gene or described expression cassette.

For achieving the above object, the present invention also provides a kind of generation Herbicid resistant method of protein, comprising:

The cell of the transformed host biology that acquisition comprises described herbicide resistance gene or described expression cassette;

Under the condition that allows generation Herbicid resistant protein, cultivate the cell of described transformed host biology;

Reclaim described Herbicid resistant protein.

Further, described transformed host biology comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.

Preferably, described plant is soybean, cotton, corn, paddy rice, wheat, beet or sugarcane.

For achieving the above object, the present invention also provides a kind of method for increasing herbicidal target scope, comprising: the Herbicid resistant protein of described Herbicid resistant protein or described expression cassette coding is expressed in plant together with at least one the second Nucleotide of Herbicid resistant protein that is different from described Herbicid resistant protein or described expression cassette coding.

Further, can encode glyphosate resistance protein, careless ammonium phosphine resistance protein, 4-hydroxyphenyl pyruvic acid dioxygenase, acetolactate synthase, cytopigment proteinoid or proporphyrinogen oxidase of described the second Nucleotide.

In the present invention, the expression of AADM3 Herbicid resistant protein in a kind of transgenic plant can be accompanied by the expression of one or more glyphosate resistance protein and/or careless ammonium phosphine resistance protein.Thisly surpass a kind of Herbicid resistant protein co expression in same strain transgenic plant and can plant be comprised and express required gene and realize by genetic engineering.In addition, a kind of plant (the 1st parent) can be expressed AADM3 Herbicid resistant protein by genetic engineering procedure, and the second plant (the 2nd parent) can be expressed glyphosate resistance protein and/or careless ammonium phosphine resistance protein by genetic engineering procedure.By the 1st parent and the 2nd parent, hybridize and obtain the progeny plants of expressing all genes of introducing the 1st parent and the 2nd parent.

For achieving the above object, the present invention also provides a kind of method of selecting the vegetable cell of conversion, comprise: with described herbicide resistance gene or described expression cassette, transform a plurality of vegetable cells, and at the transformed cell growth that allows to express described herbicide resistance gene or described expression cassette, and kill no transformed cells or suppress under the weedicide concentration of no transformed cells growth, cultivate described cell, described weedicide is phenoxy group growth hormone.

For achieving the above object, the present invention also provides a kind of method of controlling weeds, comprising: the land for growing field crops of kind of plant is used to the weedicide of effective dose, described crop comprises described herbicide resistance gene or described expression cassette or described recombinant vectors.

Preferably, described weedicide is phenoxy group growth hormone.

For achieving the above object; the present invention also provides a kind of method of the damage of avoiding being caused by weedicide for the protection of plant; comprise: by described herbicide resistance gene or described expression cassette or described recombinant vectors importing plant, make the plant generation after importing enough protect it to avoid the Herbicid resistant protein of weedicide infringement amount.

Preferably, described weedicide is phenoxy group growth hormone or aryloxy phenoxyalkanoic acids ester.Described plant is soybean, cotton, corn, paddy rice, wheat, beet or sugarcane.

For achieving the above object, the present invention also provides the method for glyphosate resistant weed in a kind of land for growing field crops of controlling glyphosate-tolerant plant, comprise: the land for growing field crops of plantation glyphosate-tolerant plant is used to the weedicide of effective dose, described glyphosate-tolerant plant comprises described herbicide resistance gene or described expression cassette or described recombinant vectors.

Preferably, described weedicide is phenoxy group growth hormone.Described glyphosate-tolerant plant is monocotyledons or dicotyledons.

For achieving the above object, the present invention also provides a kind of crop 2 of giving, and the method for 4-D Herbicid resistant, comprising: by described herbicide resistance gene or described expression cassette or described recombinant vectors importing plant.

Described herbicide resistance gene or described expression cassette or described recombinant vectors are imported to plant, in the present invention for foreign DNA is imported to vegetable cell, conventional method for transformation includes but not limited to, agriculture bacillus mediated conversion, micro-transmitting bombardment, the direct DNA importing of DNA being taken in to protoplastis, electroporation or silicon whisker mediation.

Of the present invention 2,4-D resistant gene and subsequent resistance crop are provided for controlling the good selection of glyphosate resistance (or high patience and succession) broadleaf weeds species in crop.2,4-D is wide spectrum, relatively cheap and powerful broadleaf herbicide, if can provide equally stronger crop tolerance in dicotyledonous and unifacial leaf, can be grower good effectiveness is provided.2,4-D patience transgenosis dicotyledons also can have higher handiness on Applicative time and consumption.Another purposes of 2,4-D herbicide tolerance proterties is that it can be used for preventing 2,4-D drift, volatilization, transforms the infringement to normal susceptibility crop such as (or other remote mobile phenomenon), misuse, destruction.The multiple mixture that has been widely used different phenoxy group growth hormone combinations is processed the specific weeds spectrum in different areas and envrionment conditions.In plant, use AADM3 gene can provide the more protection of the phenoxy group growth hormone weedicide of spectrum, thereby improve handiness and controllable weeds spectrum, the protection to the drift of the commercially available phenoxy group growth hormone of gamut or other remote phenoxy herbicides damage is provided.

For phenoxy group growth hormone weedicide, conventionally make active acid, but also there are some commercializations to be formulated as one of multiple corresponding esters preparation, because general plant esterase converts these esters to active acid in plant, so these think the substrate of AADM3 enzyme in plant too.Can also be similarly the corresponding organic or inorganic salt of respective acids.When representing chiral propionic acid, propionic salt or propionic ester weedicide, even if different No. CAS may, corresponding to optically pure compound, still think that (R or S) enantiomorph of racemize (R, S) or optics purifying is same weedicide when these weedicides of name.Possible amount ranges can be in crop or non-crop purposes individual curing or with other combinations of herbicides.

Now identified that AADM3 gene has the characteristic that allows to use plant phenoxy group growth hormone weedicide after genetic modification is for expression of plants, in described plant not there are not or be not enough to allow use these weedicides in intrinsic patience.In addition, AADM3 gene can provide the protection to phenoxy group growth hormone weedicide when natural patience is not enough to allow selectivity in plant.Now can be continuously or tank mixedly with a kind of combined treatment of, two kinds or some phenoxy group growth hormone weedicides only containing the plant of AADM3 gene.For the amount ranges of every kind of phenoxy group growth hormone weedicide of controlling wide spectrum broadleaf weed from 25 to 4000g ae/ha, more generally from 100 to 2000g ae/ha.In same large field, (continuous or tank is mixed in combination) combines these different chemical classifications and can provide with the weedicide with different binding modes and scope the control that great majority is needed to the potential weeds of weedicide control.

Glyphosate is widely used, because it controls very broad-leaved and the gramineous weeds species of wide spectrum.Yet, in the application of glyphosate-tolerant crop and non-crop, reuse glyphosate (and will continue) to select to make weeds succession be natural have more indefatigable species or glyphosate resistance biotype.The mixed weedicide companion of tank that effective level is used in most Herbicid resistant operating strategy suggestions is as the method that delays to occur resistant weed, and described weedicide companion provides the control to same species, but has different binding modes.Can be by allowing to use glyphosate and phenoxy group growth hormone (as 2,4-D) to realize the control to glyphosate resistant weed species in glyphosate-tolerant crop (the broadleaf weeds species of being controlled by one or more phenoxy group growth hormone) to same crop-selective by AADM3 gene and glyphosate-tolerant proterties (and/or other herbicide tolerance proterties) stack.The application of these weedicides can be in the tank mixture of the two or more weedicides that contain different binding modes, use simultaneously, using continuously (before as plantation, emerge before or emerge after) in the independent use interval time of the use (scope from 2 hours to 3 months) of single herbicidal composition, or alternatively, can be at any time (from (or for single weedicide for results space befores, get the shortest person) in kind of plant 7 months during to harvesting crops) use representative can apply the combination of the arbitrary number weedicide of every kind of chemical combination classification.

It is very important in controlling broadleaf weeds, having handiness, i.e. the ability of duration of service, single weedicide consumption and control stubbornness or resistant weed.Can be from 250 to 2500g ae/ha with the glyphosate range of application of glyphosate resistance gene/AADM3 gene stacking in crop; Phenoxy group growth hormone weedicide (one or more) can be according to from 25-4000g ae/ha.The best of breed of the time of these application depends on concrete condition, species and environment.

Herbicide formulations (as ester, acid or salt formula or solvable enriching agent, emulsion concentrate or can solution body) and the weeds of the combination of can the remarkably influenced given weedicide of the mixed additive (as adjuvant or compatilizer) of tank or one or more weedicides control.Any chemical association of any aforementioned weedicide all within the scope of the invention.

Well-known to those skilled in the art, being combined in of two or more binding modes improved controlled weeds spectrum and/or the natural benefit having more on patience species or resistant weed species and also can be expanded to by artificial (transgenosis or non-transgenic) and in crop, produce the chemical of the herbicide tolerance except glyphosate tolerable crop.In fact, can be separately or with the proterties of the following resistance of Multiple Combination supercomposed coding effective control to be provided or to prevent the ability of weeds succession to the resistance of the weedicide of any aforementioned classification: glyphosate resistance is (as resistance plant or bacterium EPSPS, GOX, GAT), grass ammonium phosphine resistance is (as PAT, Bar), acetolactate synthase (ALS) inhibition Herbicid resistant is (as imidazolone, sulfonylurea, triazolo pyrimidine, Sulphonanilide, pyrimidine phosphorothioate phenylformic acid and other chemical resistant gene are as AHAS, Csrl, SurA etc.), bromoxynil resistance (as Bxn), to HPPD(4-hydroxyphenyl pyruvic acid dioxygenase) resistance of enzyme inhibitors, resistance to phytoene desaturase (PDS) inhibitor, to the resistance of lightsystemⅡ inhibition weedicide (as psbA), resistance to photosystemⅰ inhibition weedicide, to proporphyrinogen oxidase IX (PPO) inhibition Herbicid resistant (as PPO-1), to the resistance of phenylurea weedicide (as CYP76B1), Mediben degrading enzyme etc.

About other weedicides, some other preferred ALS inhibitor comprise triazolo pyrimidine Sulphonanilide (cloransulammethyl, diclosulam, flumetsulam, metosulam and Kui Linpyrimido quinoline triazole species sulfanilamide (SN)), pyrimidine phosphorothioate phenylformic acid and flucarbazone.Some preferred HPPD inhibitor comprise mesotrione, isoxaflutole and sulphur humulone.Some preferred PPO inhibitor comprise flumioxazin, butafenacil, azoles humulone, sulfentrazone and phenyl ether (as acifluorfen, fomesafen, lactofen and oxyfluorfen).

In addition, can by AADM3 gene separately or with other herbicide tolerant crop feature stack after again with one or more other input (as insect-resistant, fungus resistant or stress tolerance etc.) or output (as the fibrous quality of the output improving, improved oil mass, raising etc.) proterties stack.Therefore, the present invention can be used for providing to control flexibly and economically the ability of agronomy insect and the complete agronomy solution of raising crop quality of any number.

AADM3 gene of the present invention 2, the 4-D that can degrade is the basis of important herbicide tolerant crop and selectable marker feature possibility.

The present invention can carry out transgene expression, can control the combinations of herbicides of nearly all broadleaf weeds.AADM3 gene can be used as outstanding herbicide tolerant crop proterties with other herbicide tolerant crop proterties for example (as glyphosate resistance, grass ammonium phosphine resistance, ALS inhibitor is (as imidazolone type, sulfonylurea, triazolopyrimidine sulfonamides) resistance, bromoxynil resistance, HPPD inhibitor resistance, PPO inhibitor resistance etc.) and insect-resistant proterties (Cry1Ab, Cry1F, Vip3, the insect-resistant albumen in other bacillus thuringiensis protein or non-bacillus source etc.) stack.In addition, AADM3 gene can be used as the primary transformant of the plant of another gene or gene group genetic modification for selectable marker assisted Selection.

Phenoxy alkane acid ester group can be used for stable acid functional group to introduce weedicide.Acidic-group can be inputted phloem active (attribute that herbicide action is required) by " acid is caught ", thereby can be integrated into novel herbicide for active object.Existing may be much the commercially available and experimental weedicide of AADM3 substrate.Therefore, use gene of the present invention can also obtain the patience to other weedicide.

Herbicide tolerance crop character of the present invention can be used in the new combination with other herbicide tolerance crop character (including but not limited to glyphosate-tolerant).Due to the resistance of the new acquisition of weedicide (as glyphosate) or intrinsic patience, these proterties combination results are controlled the novel method of weed species.Therefore, except herbicide tolerance crop character, scope of the present invention comprises the novel method of using herbicide weed control, wherein by the described enzyme in genetically modified crops, produces the patience to described weedicide.

The present invention can be applicable in various plants, as Arabidopis thaliana, tobacco, soybean, cotton, rice, corn and rape.The present invention also can be used for multiple other unifacial leaf (as herbage Gramineae or turfgrass Gramineae) and dicotyledonous crops (as clover, trifolium, arbor species etc.).Similarly, 2,4-D(or other AADM3 substrate) can be more energetically for the moderate gramineous crop of patience, the patience of the raising that proterties obtains thus can be used these weedicides without the possibility of crop damage risk with more effective consumption and wider time of application by providing for grower.

The genome of the plant described in the present invention, plant tissue or vegetable cell, refers to any genetic material in plant, plant tissue or vegetable cell, and comprises nucleus and plastid and Mitochondrial Genome Overview.

Described in the present invention, " resistance " is heritable, and allows plant Growth and reproduction in the situation that weedicide carries out the effective processing of general weedicide to given plant.As those skilled in the art, approve, obvious even if plant is subject to certain degree of injury of herbicide treatment, plant still can be considered to " resistance ".Term in the present invention " patience " is more extensive than term " resistance ", and comprise " resistance ", and the ability of the raising of the various degree damages of the opposing weedicide induction that has of specified plant, and under same weedicide dosage, generally cause the damage of homologous genes type wild-type plant.

Polynucleotide described in the present invention and/or Nucleotide form complete " gene ", coded protein or polypeptide in required host cell.Those skilled in the art are easy to recognize, polynucleotide of the present invention and/or Nucleotide can be placed under object host's regulating and controlling sequence control.

Well-known to those skilled in the art, DNA typically exists with double chain form.In this arrangement, a chain and another chain complementation, vice versa.Because DNA copies other complementary strand that has produced DNA in plant.Like this, the present invention includes the use to the polynucleotide of example in sequence table and complementary strand thereof.Normal " coding strand " using in this area refers to the chain of being combined with antisense strand.For marking protein in vivo, typical case is transcribed into a chain of DNA the complementary strand of a mRNA, and it translates protein as template.MRNA is actually from " antisense " chain of DNA and transcribes." have justice " or " coding " chain has a series of codons (codon is three Nucleotide, once reads three and can produce specific amino acids), it can be used as open reading frame (ORF) and reads and form target protein matter or peptide.The present invention also comprises that the DNA with example has RNA and the PNA(peptide nucleic acid(PNA) of suitable function).

Amplifying nucleic acid molecule of the present invention or its fragment are hybridized with herbicide resistance gene of the present invention under stringent condition.The nucleic acid hybridization of any routine or amplification method may be used to identify the existence of herbicide resistance gene of the present invention.Nucleic acid molecule or its fragment can be carried out specific hybrid with other nucleic acid molecule under a stable condition.In the present invention, if two nucleic acid molecule can form antiparallel double-strandednucleic acid structure, just can say that these two nucleic acid molecule can carry out specific hybrid to each other.If two nucleic acid molecule demonstrate complementarity completely, claim that one of them nucleic acid molecule is another nucleic acid molecule " complement ".In the present invention, when each Nucleotide of a nucleic acid molecule and the corresponding Nucleotide complementation of another nucleic acid molecule, claim these two nucleic acid molecule to demonstrate " complete complementary ".If thereby two nucleic acid molecule can make with enough stability phase mutual crosses them anneal and be bonded to each other under at least conventional " low strict " condition, claim these two nucleic acid molecule for " minimum level is complementary ".Similarly, if thereby two nucleic acid molecule can make with enough stability phase mutual crosses them under " highly strict " condition of routine, anneal and be bonded to each other, and claim these two nucleic acid molecule to there is " complementarity ".From complete complementary, depart from and can allow, as long as this, depart from two molecules of incomplete prevention and form duplex structure.In order to make a nucleic acid molecule as primer or probe, only need to guarantee that it has sufficient complementarity in sequence, so that can form stable duplex structure under adopted specific solvent and salt concn.

In the present invention, the sequence of basic homology is one section of nucleic acid molecule, this nucleic acid molecule under height stringent condition can with the complementary strand generation specific hybrid of another section of nucleic acid molecule matching.Promote the applicable stringent condition of DNA hybridization, for example, process greatly under 45 ℃ of conditions by 6.0 * sodium chloride/sodium citrate (SSC), then under 50 ℃ of conditions, with 2.0 * SSC, wash, these conditions are known to those skilled in the art.For example, the salt concn in washing step can be selected from the approximately 2.0 * SSC, 50 ℃ of low stringent condition to the approximately 0.2 * SSC of height stringent condition, 50 ℃.In addition, the temperature condition in washing step can, from approximately 22 ℃ of the room temperatures of low stringent condition, be elevated to approximately 65 ℃ of height stringent condition.Temperature condition and salt concn can all change, and also can one of them remain unchanged and another variable changes.Preferably, stringent condition of the present invention can be in 6 * SSC, 0.5%SDS solution, at 65 ℃, with SEQ ID NO:1, specific hybrid occurs, and then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film 1 time.

Therefore, having herbicide tolerant sequence active and that hybridize with sequence 1 of the present invention under stringent condition comprises in the present invention.These sequences and sequence of the present invention be 40%-50% homology at least approximately, about 60%, 65% or 70% homology, even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or larger sequence homology.

The invention provides functional protein." functionally active " (or " activity ") refers to that the protein/enzyme (combining separately or with other oroteins) of purposes of the present invention has the ability of degrading or weakening herbicidal activity in the present invention.The plant optimization that produces protein of the present invention produces the protein of " significant quantity ", thereby when with herbicide treatment plant, the level of protein expression is enough to give plant to weedicide (being general consumption unless otherwise noted) resistance or patience wholly or in part.Can use weedicide conventionally to kill the consumption of target plant, normal land for growing field crops consumption and concentration.Preferably, vegetable cell of the present invention and plant are protected avoids growth-inhibiting or the damage that herbicide treatment causes.Conversion of plant of the present invention and vegetable cell preferably have resistance or the patience of 2,4-D weedicide, and the plant and the vegetable cell that transform can be in 2 of significant quantities, and 4-D weedicide exists lower growth.

Gene described in the present invention and protein not only comprise specific exemplary sequence, also comprise the part and/fragment (comprise with full length protein and comparing and/or terminal deletion), variant, mutant, substituent (having the amino acid whose protein of substituting), mosaic and fusion rotein of the Herbicid resistant living features of the protein of having preserved described particular example.Described " variant " or " variation " refer to that the same albumen of coding or coding have the nucleotide sequence of the albumen of equal value of Herbicid resistant activity.Described " albumen of equal value " refers to the bioactive albumen with the albumen of claim with identical or essentially identical herbicide tolerant.

" fragment " of the DNA molecular described in the present invention or protein sequence or " brachymemma " refer to a part or its artificial reconstructed form (sequence that is for example applicable to expression of plants) of the original DNA that relates to or protein sequence (Nucleotide or amino acid), comprise and close on fragment and compare the disappearance of inside and/or end with full-length molecule, can there is variation in the length of aforementioned sequence, but length sufficient to guarantee (coding) protein is Herbicid resistant protein.(the particularly expression in plant) in some cases, it may be favourable using the truncated gene of coding truncated protein matter.Preferred truncated gene 40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,96,97,98 or 99% of the full length protein of generally encoding.

Due to the Feng Yuxing of genetic codon, the multiple different DNA sequence dna identical aminoacid sequence of can encoding.Produce the alternative DNA sequence dna of these encode identical or essentially identical albumen just in those skilled in the art's state of the art.These different DNA sequence dnas comprise within the scope of the invention.Described " substantially the same " sequence refers to aminoacid replacement, disappearance, interpolation or insertion but does not affect in fact the sequence of Herbicid resistant activity, also comprises the fragment that retains Herbicid resistant activity.

In the present invention, the replacement of aminoacid sequence, disappearance or interpolation are the ordinary skill in the art, and preferably this seed amino acid is changed to: little characteristic changing, i.e. and the folding and/or active conserved amino acid of not remarkably influenced albumen replaces; Little disappearance, common about 1-30 amino acid whose disappearance; Little amino or carboxyl terminal extend, and for example aminoterminal extends a methionine residues; Little connection peptides, for example an about 20-25 residue is long.

The conservative example replacing is the replacement occurring in following amino acid group: basic aminoacids (as arginine, Methionin and Histidine), acidic amino acid (as L-glutamic acid and aspartic acid), polare Aminosaeren (as glutamine, l-asparagine), hydrophobic amino acid (as leucine, Isoleucine and α-amino-isovaleric acid), aromatic amino acid (as phenylalanine, tryptophane and tyrosine), and small molecules amino acid (as glycine, L-Ala, Serine, Threonine and methionine(Met)).Conventionally those aminoacid replacement that do not change given activity are well-known in this area, and by, for example, N.Neurath and R.L.Hill are described in the < < Protein > > of new york academic press (Academic Press) in 1979 publication.Modal exchange has Ala/Ser, Val/Ile, Asp/Glu, Thu/Ser, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly, and their contrary exchanges.

For a person skilled in the art apparently, this replacement can occur outside the region that molecular function is played an important role, and still produces active polypeptide.For by polypeptide of the present invention, it is active essential and therefore select not substituted amino-acid residue, can be according to methods known in the art, as site-directed mutagenesis or alanine scanning mutagenesis identify (as referring to, Cunningham and Wells, 1989, Science244:1081-1085).A rear technology is that each positively charged residue place introduces sudden change in molecule, and the Herbicid resistant that detects gained mutating molecule is active, thereby determines the amino-acid residue that this molecular activity is overstated and wanted.Substrate-enzyme interacting site also can be measured by the analysis of its three-dimensional structure, this three-dimensional structure can by the technical measurements such as nuclear magnetic resonance spectroscopy, crystallography or photoaffinity labeling (referring to, as de Vos etc., 1992, Science255:306-312; Smith etc., 1992, J.Mol.Biol224:899-904; Wlodaver etc., 1992, FEBS Letters309:59-64).

Therefore the aminoacid sequence that, has certain homology with the aminoacid sequence shown in sequence 2 is also included within the present invention.These sequences and sequence similarity/homogeny of the present invention are typically greater than 60%, are preferably greater than 75%, are preferredly greater than 80%, are even preferredly greater than 90%, and can be greater than 95%.Also can be according to more specific homogeny and/or similarity scope definition preferred polynucleotide of the present invention and protein.For example there are 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homogeny and/or similarity with the sequence of example of the present invention.

Regulating and controlling sequence described in the present invention includes but not limited to promotor, transit peptides, terminator, enhanser, and leader sequence, intron and other are operably connected to the adjusting sequence of described AADM3 gene.

Described promotor is effable promotor in plant, and described " effable promotor in plant " refers to the promotor of guaranteeing that connected encoding sequence is expressed in vegetable cell.In plant, effable promotor can be constitutive promoter.Instruct the example of the promotor of constitutive expression in plant to include but not limited to, derive from 35S promoter, the ubi promoter of maize of cauliflower mosaic virus, the promotor of paddy rice GOS2 gene etc.Alternatively, in plant, effable promotor can be tissue-specific promotor, this promotor is in some tissues of plant as instructed the expression level of encoding sequence higher than its hetero-organization of plant (can be tested and be measured by conventional RNA), as PEP carboxylase promotor in chlorenchyma.Alternatively, in plant, effable promotor can be wound-induced promotor.Wound-induced promotor or instruct the promotor of the expression pattern of wound-induced to refer to when plant is stood machinery or gnaws by insect the wound causing, is significantly increased under the expression compared with normal growth conditions of the encoding sequence under promoter regulation.The example of wound-induced promotor includes but not limited to, the promotor of the proteolytic enzyme suppressor gene of potato and tomato (pin I and pin II) and zein enzyme suppressor gene (MPI).

Described transit peptides (claiming again secretory signal sequence or targeting sequencing) is to instruct transgene product to arrive specific organoid or cellular compartment, concerning receptor protein, described transit peptides can be allos, for example, utilize coding chloroplast transit peptide sequence target chloroplast(id), or utilize ' KDEL ' reservation queue target endoplasmic reticulum, or utilize the CTPP target vacuole of barley plants agglutinin gene.

Described leader sequence including but not limited to, picornavirus leader sequence, as EMCV leader sequence (encephalomyocarditis virus 5 ' non-coding region); Potyvirus group leader sequence, as the MDMV(corn mosaic virus that stunts) leader sequence; Human immunoglobulin matter heavy chain conjugated protein (BiP); The coat protein mRNA of alfalfa mosaic virus does not translate leader sequence (AMV RNA4); Tobacco mosaic virus (TMV) (TMV) leader sequence.

Described enhanser including but not limited to, cauliflower mosaic virus (CaMV) enhanser, figwort mosaic virus (FMV) enhanser, carnation weathering circovirus virus (CERV) enhanser, cassava vein mosaic virus (CsVMV) enhanser, Mirabilis jalapa mosaic virus (MMV) enhanser, Night-Blooming jessamine tomato yellow leaf curl China virus (CmYLCV) enhanser, Cotton leaf curl Multan virus (CLCuMV), commelina yellow mottle virus (CoYMV) and peanut chlorisis streak mosaic virus (PCLSV) enhanser.

For monocotyledons application, described intron including but not limited to, corn hsp70 intron, corn ubiquitin intron, Adh introne 1, sucrose synthase intron or paddy rice Act1 intron.For dicotyledons application, described intron including but not limited to, CAT-1 intron, pKANNIBAL intron, PIV2 intron and " super ubiquitin " intron.

Described terminator can be the applicable polyadenylation signal sequence working in plant, include but not limited to, derive from Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene polyadenylation signal sequence, derive from proteinase inhibitor II (pin II) gene polyadenylation signal sequence, derive from the polyadenylation signal sequence of pea ssRUBISCO E9 gene and derive from the polyadenylation signal sequence of alpha-tubulin (α-tubulin) gene.

Described in the present invention, " effectively connect " connection that represents nucleotide sequence, described connection makes a sequence that the function needing concerning the sequence that is connected can be provided.In the present invention, " effectively connect " and can, for promotor is connected with interested sequence, makes transcribing of this interested sequence be subject to this promotor and control and regulate and control.When interested sequence encoding albumen and while going for the expression of this albumen " effectively connecting " represent: promotor is connected with described sequence, and connected mode is efficiently translated the transcript obtaining.If when promotor is the expression of transcript fusion and the albumen of wanting realization coding with being connected of encoding sequence, manufacture such connection, in the transcript that makes to obtain, the first translation initiation codon is the initiator codon of encoding sequence.Alternatively, when if promotor is the expression of translation fusion and the albumen of wanting realization coding with being connected of encoding sequence, manufacture such connection, the first translation initiation codon and the promotor that in 5 ' non-translated sequence, contain are connected, and mode of connection make the relation of the translation opening code-reading frame of the albumen that the translation product that obtains and coding want meet reading frame.The nucleotide sequence that can " effectively connect " includes but not limited to: it (is gene expression element that the sequence of genetic expression function is provided, promotor for example, 5 ' untranslated region, intron, encoding histone region, 3 ' untranslated region, poly-putative adenylylation site and/or transcription terminator), it (is T-DNA border sequence that the sequence of DNA transfer and/or integration function is provided, site-specific recombinase recognition site, intergrase recognition site), it (is antibiotic resistance markers that the sequence of selectivity function is provided, biosynthesis gene), the sequence of the marker function of can scoring is provided, sequence external or the interior assistance of body series of operations (is polylinker sequence, locus specificity recombination sequence) and the sequence of copy function is provided (is the replication orgin of bacterium, autonomously replicating sequence, centromeric sequence).

The present invention can give plant novel herbicide resistance proterties, and does not observe the detrimentally affect that phenotype is comprised to output.In the present invention plant can tolerate weedicide 2 as tested at least one *, 3 *, 4 * or 5 * application level.The raising of these patience levels within the scope of the present invention.For example can multiple technologies known in the art be carried out forseeable optimization and be further developed, to increase the expression of given gene.

In the present invention, described Herbicid resistant protein is AADM3 aminoacid sequence, as shown in SEQ ID NO:2 in sequence table.Described herbicide resistance gene is AADM3 nucleotide sequence, as shown in SEQ ID NO:1 in sequence table.Described herbicide resistance gene is for plant, except comprising the coding region by the nucleotide sequence coded protein of AADM3, also can comprise other elements, the protein of the coding region of the transit peptides of for example encoding, codes selection mark or the coding region of giving the protein of insect-resistant.

In the present invention, AADM3 Herbicid resistant protein has patience to most of phenoxy group growth hormone weedicides.Plant in the present invention contains foreign DNA in its genome, and described foreign DNA comprises AADM3 nucleotide sequence, by expressing this albumen of significant quantity, protects it to avoid the threat of weedicide.Significant quantity refers to the dosage of unmarred or slight damage.Meanwhile, plant should be normal in form, and can under ordinary method, cultivate consumption and/or the generation for product.

In vegetable material, Herbicid resistant protein expression level can detect by described several different methods in this area, for example by application special primer to organizing the mRNA of the coding Herbicid resistant protein of interior generation to carry out quantitatively, or the direct amount of the Herbicid resistant protein of specific detection generation.

The invention provides a kind of Herbicid resistant protein, its encoding gene and purposes, have the following advantages:

1, strong to Herbicid resistant.The strong resistance of Herbicid resistant a-protein ADM3 of the present invention to weedicide, especially for phenoxy group growth hormone weedicide, particularly 2,4-D.

2, wide to Herbicid resistant.Herbicid resistant a-protein ADM3 albumen of the present invention can show higher resistance to multiple phenoxy group plant hormone weedicide, therefore on plant, has a extensive future.

Below by drawings and Examples, technical scheme of the present invention is described in further detail.

Accompanying drawing explanation

Fig. 1 is that the recombinant cloning vector DBN01-T that contains AADM3 nucleotide sequence of Herbicid resistant protein of the present invention, its encoding gene and purposes builds schema;

Fig. 2 is that the recombinant expression vector DBN100289 that contains AADM3 nucleotide sequence of Herbicid resistant protein of the present invention, its encoding gene and purposes builds schema;

Fig. 3 is that the recombinant expression vector DBN100289N that contains control sequence of Herbicid resistant protein of the present invention, its encoding gene and purposes builds schema;

Fig. 4 is the transgenic arabidopsis T of Herbicid resistant protein of the present invention, its encoding gene and purposes ₁plant Herbicid resistant design sketch;

Fig. 5 is that the recombinant expression vector DBN100762 that contains AADM3 nucleotide sequence of Herbicid resistant protein of the present invention, its encoding gene and purposes builds schema;

Fig. 6 is that the recombinant expression vector DBN100762N that contains control sequence of Herbicid resistant protein of the present invention, its encoding gene and purposes builds schema.

Embodiment

Below by specific embodiment, further illustrate the technical scheme of Herbicid resistant protein of the present invention, its encoding gene and purposes.

The acquisition of the first embodiment, AADM3 gene order and synthetic

1, obtain AADM3 gene order

The aminoacid sequence of AADM3 Herbicid resistant protein (292 amino acid), as shown in SEQ ID NO:2; According to favorite plant codon, obtain coding corresponding to the nucleotide sequence (879 Nucleotide) of the aminoacid sequence (292 amino acid) of described AADM3 Herbicid resistant protein, as shown in SEQ ID NO:1 in sequence table.

2, synthetic above-mentioned AADM3 nucleotide sequence

Described AADM3 nucleotide sequence (as shown in SEQ ID NO:1 in sequence table) is synthesized by Nanjing Genscript Biotechnology Co., Ltd.; 5 ' end of synthetic described AADM3 nucleotide sequence (SEQ ID NO:1) is also connected with SpeI restriction enzyme site, and 3 ' end of described AADM3 nucleotide sequence (SEQ ID NO:1) is also connected with KasI restriction enzyme site.

The structure of the second embodiment, Arabidopis thaliana recombinant expression vector and recombinant expression vector transform Agrobacterium

1, build the Arabidopis thaliana recombinant cloning vector DBN01-T that contains AADM3 nucleotide sequence

Synthetic AADM3 nucleotide sequence is connected into cloning vector pGEM-T(Promega, Madison, USA, CAT:A3600) on, operation steps is undertaken by the product pGEM-T of Promega company carrier specification sheets, obtain recombinant cloning vector DBN01-T, it builds flow process, and (wherein, Amp represents ampicillin resistance gene as shown in Figure 1; F1 represents the replication orgin of phage f1; LacZ is LacZ initiator codon; SP6 is SP6RNA polymerase promoter; T7 is t7 rna polymerase promotor; AADM3 is AADM3 nucleotide sequence (SEQ ID NO:1); MCS is multiple clone site).

Then recombinant cloning vector DBN01-T is transformed to intestinal bacteria T1 competent cell (Transgen by heat shock method, Beijing, China, CAT:CD501), its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant cloning vector DBN01-T), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaking culture 1 hour (under 100rpm rotating speed, shaking table shakes), on surface, scribble IPTG(isopropylthio-β-D-galactoside) and the chloro-3-indoles-β-D-of the bromo-4-of X-gal(5-galactoside) dull and stereotyped (the Tryptones 10g/L of LB of penbritin (100 mg/litre), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) upper grow overnight.Picking white colony, in LB liquid nutrient medium (NaCl10g/L, penbritin 100mg/L, adjusts pH to 7.5 with NaOH for Tryptones 10g/L, yeast extract 5g/L) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid: by bacterium liquid centrifugal 1min under 12000rpm rotating speed, remove supernatant liquor, and the solution I (25mM Tris-HCl, 10mM EDTA(ethylenediamine tetraacetic acid (EDTA)) of 100 μ l ice precoolings for precipitation thalline, 50mM glucose, pH8.0) suspends; The solution II (0.2M NaOH, 1%SDS(sodium lauryl sulphate) that adds the new preparation of 150 μ l), pipe is put upside down 4 times, mixed, put 3-5min on ice; Add the solution III that 150 μ l are ice-cold (4M Potassium ethanoate, 2M acetic acid), fully mix immediately, place 5-10min on ice; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition adds 2 times of volume dehydrated alcohols in supernatant liquor, mixes rear room temperature and places 5min; Centrifugal 5min under 4 ℃ of temperature, rotating speed 12000rpm condition, abandons supernatant liquor, after the washing with alcohol that precipitation is 70% by concentration (V/V), dries; Add 30 μ l containing RNase(20 μ g/ml) TE(10mM Tris-HCl, 1mM EDTA, PH8.0) dissolution precipitation; Water-bath 30min at 37 ℃ of temperature, digestion RNA; In temperature-20, ℃ save backup.

The plasmid extracting is cut after evaluation through SpeI and KasI enzyme, positive colony is carried out to sequence verification, result shows that the described AADM3 nucleotides sequence inserting in recombinant cloning vector DBN01-T classifies the nucleotide sequence shown in SEQ ID NO:1 as, and AADM3 nucleotide sequence correctly inserts.

2, build the Arabidopis thaliana recombinant expression vector DBN100289 that contains AADM3 nucleotide sequence

With restriction enzyme SpeI and KasI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-01(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the AADM3 nucleotide sequence fragment cutting is inserted between the SpeI and KasI site of expression vector DBNBC-01, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, be built into recombinant expression vector DBN100289, it builds flow process (Spec: spectinomycin gene as shown in Figure 2; RB: right margin; AtUbi10: Arabidopis thaliana Ubiquitin(ubiquitin) 10 gene promoters (SEQ ID NO:3); AADM3:AADM3 nucleotide sequence (SEQ ID NO:1); Nos: the terminator of rouge alkali synthetase gene (SEQ ID NO:4); PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:5); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQ ID NO:6); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:7); LB: left margin).

Recombinant expression vector DBN100289 is transformed to intestinal bacteria T1 competent cell by heat shock method, and its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100289), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaking culture 1 hour (under 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L spectinomycin (Spectinomycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, spectinomycin 50mg/L, adjusts pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme SpeI and KasI enzyme, and by the positive colony evaluation of checking order, result show the nucleotides sequence of recombinant expression vector DBN100289 between SpeI and KasI site classify sequence table as in nucleotide sequence, i.e. AADM3 nucleotide sequence shown in SEQ ID NO:1.

3, build the Arabidopis thaliana recombinant expression vector DBN100289N that contains control sequence

The method of the recombinant cloning vector DBN01-T that contains AADM3 nucleotide sequence according to the structure described in 1 in second embodiment of the invention, utilizes control sequence (SEQ ID NO:8) to build the recombinant cloning vector DBN01R-T that contains control sequence.Positive colony is carried out to sequence verification, and result shows that the native sequences of inserting in recombinant cloning vector DBN01R-T is the nucleotide sequence shown in SEQ ID NO:8 in sequence table, and control sequence is correctly inserted.

The method of the recombinant expression vector DBN100289 that contains AADM3 nucleotide sequence according to the structure described in 2 in second embodiment of the invention, utilize native sequences to build the recombinant expression vector DBN100289N that contains native sequences, it builds flow process (carrier framework: pCAMBIA2301(CAMBIA mechanism can provide) as shown in Figure 3; Spec: spectinomycin gene; RB: right margin; AtUbi10: Arabidopis thaliana Ubiquitin(ubiquitin) 10 gene promoters (SEQ ID NO:3); MN: control sequence (SEQ ID NO:8); Nos: the terminator of rouge alkali synthetase gene (SEQ ID NO:4); PrCaMV35S: cauliflower mosaic virus 35 S promoter (SEQ ID NO:5); PAT: careless fourth phosphinothricin acetyl transferase gene (SEQ ID NO:6); TCaMV35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:7); LB: left margin).Positive colony is carried out to sequence verification, and result shows that the control sequence of inserting in recombinant expression vector DBN100289N is the nucleotide sequence shown in SEQ ID NO:8 in sequence table, and control sequence is correctly inserted.

4, Arabidopis thaliana recombinant expression vector transforms Agrobacterium

To oneself through building correct recombinant expression vector DBN100289 and DBN100289N(control sequence) by liquid nitrogen method, be transformed in Agrobacterium GV3101, its conversion condition is: 100 μ L Agrobacterium GV3101,3 μ L plasmid DNA (recombinant expression vector), be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes, Agrobacterium GV3101 after transforming is inoculated in LB test tube in 28 ℃ of temperature, rotating speed is under 200rpm condition, to cultivate 2 hours, be applied on the LB flat board that contains the Rifampin (Rifampicin) of 50mg/L and the spectinomycin of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking mono-clonal, with restriction enzyme StyI and SmaI enzyme, cut and carry out enzyme after DBN100289 and cut checking, with restriction enzyme StyI and BglI enzyme, cut DBN100289N(control sequence) after carry out enzyme and cut checking, result shows recombinant expression vector DBN100289 and DBN100289N(native sequences) structure is entirely true.

The 3rd embodiment, proceed to the acquisition of the Arabidopis thaliana plant of AADM3 nucleotide sequence

Wild-type Arabidopis thaliana seed is suspended in 0.1% agarose solution.The seed of suspension is preserved at 4 ℃ to 2 days to complete need to synchronously sprout with assurance seed dormancy.Extremely moistening with vermiculite mixing horsehit soil water sub-irrigation, make soil mixture draining 24 hours.Pretreated seed is covered to 7 days on soil mixture and with moisture preserving cover.Make seed germination and be 120-150 μ mol/m in constant temperature (22 ℃) constant humidity (40-50%) light intensity ²second long day condition (16 hours illumination/8 hour dark) under in greenhouse culturing plants.Start, with Huo Gelan nutrition liquid irrigation plant, then with deionized water, to irrigate, keep soil moist but not drenched.

Use flower infusion method arabidopsis thaliana transformation.With the Agrobacterium colony inoculation chosen, a or many parts of 15-30ml are containing the preculture thing of the YEP nutrient solution of spectinomycin (100mg/L) and Rifampin (10mg/L).With 220rpm, culture is shaken to overnight incubation 28 ℃ of constant speed.Each preculture thing is used for inoculating two parts of 500ml containing the culture of the YEP nutrient solution of spectinomycin (100mg/L) and Rifampin (10mg/L) and culture is continued to shake overnight incubation at 28 ℃.Room temperature, with about centrifugal 10 minutes sedimentation cells of 8700 * g, discards the supernatant liquor obtaining.Cell precipitation is softly resuspended in 500ml infiltration substratum, and described infiltration substratum contains 1/2 * MS salt/B5 VITAMIN, 10%(w/v) sucrose, 0.044 μ M benzyladenine (10 μ l/ liter (stoste in 1mg/ml DMSO)) and 300 μ l/ rise Silvet L-77.The plant at approximately 1 monthly age is soaked 15 seconds in substratum, guaranteed the inflorescence that submergence is up-to-date.Then fallen in plant side and covered (transparent or opaque) 24 hours, and then washing with water and vertically place.22 ℃ of photoperiod culturing plants with 16 hours illumination/8 hour dark.Soak results seed after approximately 4 weeks.

By (AADM3 nucleotide sequence and the native sequences) T newly gathering in the crops ₁seed was drying at room temperature 7 days.By seed, in 26.5 * 51cm sprouting dish, every dish is accepted 200mgT ₁seed (approximately 10000 seeds), described seed has been suspended in advance 40ml0.1% agarose solution and at 4 ℃, has preserved 2 days to complete need to synchronously sprout with assurance seed dormancy.

Extremely moistening with vermiculite mixing horsehit soil water sub-irrigation, utilize gravity drainage.With transfer pipet, pretreated seed (each 40ml) is planted on soil mixture equably, and cover 4-5 days with moisture preserving cover.After use is emerged, spraying the careless ammonium phosphine pat gene of cotransformation (select) carries out initial transformant and selects to remove for first 1 day cover.

After 7 plantation number of days (DAP) and in 11DAP reuse DeVilbiss compressed-air atomizer with the sprinkling volume of 10ml/ dish (703L/ha) the 0.2% spray solution T with Liberty weedicide (the careless ammonium phosphine of 200g ai/L) ₁plant (being respectively cotyledon period and 2-4 leaf phase), to provide the careless ammonium phosphine of each application 280g ai/ha significant quantity.Within after in the end spraying 4-7 days, identify survival strain (plant of active growth), and be transplanted to respectively in the square basin of and 7cmx7cm prepared by vermiculite native with horsehit (every dish 3-5).With moisture preserving cover, cover the plant 3-4 days transplanting, and as be prepended in 22℃ culturing room or directly move into greenhouse.Then remove cover and at test AADM3 gene, provide before the ability of phenoxy group growth hormone Herbicid resistant at least 1 day plant cultivating to greenhouse (22 ± 5 ℃, 50 ± 30%RH, illumination in 14 hours: 10 hours dark, minimum 500 μ E/m ²s ¹natural+supplementary light).

The Herbicid resistant effect detection of the 4th embodiment, transgenic arabidopsis plant

With AADM3 gene, carry out transformation of Arabidopsis thaliana first.First use careless ammonium phosphine selection scheme never in transformed the seed background, to select T ₁transformant.Approximately 20000 T have been screened ₁in seed and identified 216 strain T ₁for positive transformant (pat gene), approximately 1.1% transformation efficiency.The Arabidopis thaliana T of AADM3 nucleotide sequence will be proceeded to ₁plant, proceed to the Arabidopis thaliana T of control sequence ₁plant and wild-type Arabidopis thaliana plant (after planting 18 days) carry out Herbicid resistant effect detection to 2,4-D diformazan ammonium salt and methoxone respectively.

The Arabidopis thaliana T of AADM3 nucleotide sequence will be proceeded to respectively ₁plant, proceed to the Arabidopis thaliana T of control sequence ₁plant and wild-type Arabidopis thaliana plant use respectively 2,4-D diformazan ammonium salt (560g ae/ha, 1 times of land for growing field crops concentration), methoxone (560g ae/ha, 1 times of land for growing field crops concentration) and blank solvent (water) to spray.Spray and added up afterwards plant resistance situation with 14 days in 7 days: after 7 days, upgrowth situation is consistent with blank solvent (water) divides high resistance plant into, after 7 days, there is anti-plant in the dividing into of lotus throne leaf roll song, still can not bolting after 14 days divide low anti-plant into, deadly after 14 days divide not anti-plant into.Due to every strain Arabidopis thaliana T ₁plant is transformation event independently, can estimate individual T in given dose ₁the significant difference of replying.Result is as shown in table 1 and Fig. 4.

Table 1, transgenic arabidopsis T ₁plant Herbicid resistant experimental result

For Arabidopis thaliana, 50g ae/ha2,4-D and methoxone are the effective doses that sensitive plant and the floral region with average resistance level are separated.The result of table 1 and Fig. 4 shows: AADM3 gene is given individual arabidopsis thaliana Herbicid resistant, and (reason of only having part plant to have resistance is due to T ₁for plant insertion point, be random, thereby the expression level of resistant gene is variant, shows the difference of resistance level), phenoxy group growth hormone weedicide especially; And wild-type Arabidopis thaliana plant and the Arabidopis thaliana T that proceeds to control sequence ₁plant does not all have phenoxy group growth hormone Herbicid resistant.

The structure of the 5th embodiment, corn recombinant expression vector and recombinant expression vector transform Agrobacterium

1, build the corn recombinant expression vector DBN100762 that contains AADM3 nucleotide sequence

With restriction enzyme SpeI and KasI respectively enzyme cut recombinant cloning vector DBN01-T and expression vector DBNBC-02(carrier framework: pCAMBIA2301(CAMBIA mechanism can provide)), the AADM3 nucleotide sequence fragment cutting is inserted between the SpeI and KasI site of expression vector DBNBC-02, it is well-known to those skilled in the art utilizing conventional enzyme blanking method carrier construction, SpeI in expression vector DBNBC-02 and KasI restriction enzyme site are also to utilize conventional enzyme blanking method to introduce, be built into recombinant expression vector DBN100762, it builds flow process (Spec: spectinomycin gene as shown in Figure 5, RB: right margin, Ubi: corn Ubiquitin(ubiquitin) 1 gene promoter (SEQ ID NO:9), AADM3:AADM3 nucleotide sequence (SEQ ID NO:1), Nos: the terminator of rouge alkali synthetase gene (SEQ ID NO:4), PMI: Phophomannose isomerase gene (SEQ ID NO:10), LB: left margin).

Recombinant expression vector DBN100762 is transformed to intestinal bacteria T1 competent cell by heat shock method, and its hot shock condition is: 50 μ l intestinal bacteria T1 competent cells, 10 μ l plasmid DNA (recombinant expression vector DBN100762), 42 ℃ of water-baths 30 seconds; 37 ℃ of shaking culture 1 hour (under 100rpm rotating speed, shaking table shakes); Then at LB solid plate (the Tryptones 10g/L containing 50mg/L spectinomycin (Spectinomycin), yeast extract 5g/L, NaCl10g/L, agar 15g/L, adjusts pH to 7.5 with NaOH) above under 37 ℃ of conditions of temperature, cultivate 12 hours, picking white colony, at LB liquid nutrient medium (Tryptones 10g/L, yeast extract 5g/L, NaCl10g/L, spectinomycin 50mg/L, adjusts pH to 7.5 with NaOH) under 37 ℃ of conditions of temperature overnight incubation.Alkaline process extracts its plasmid.The plasmid of extraction is cut to rear evaluation with restriction enzyme SpeI and KasI enzyme, and by the positive colony evaluation of checking order, result show the nucleotides sequence of recombinant expression vector DBN100762 between SpeI and KasI site classify sequence table as in nucleotide sequence, i.e. AADM3 nucleotide sequence shown in SEQ ID NO:1.

2, build the corn recombinant expression vector DBN100762N that contains control sequence

The method of the recombinant cloning vector DBN01-T that contains AADM3 nucleotide sequence according to the structure described in 1 in second embodiment of the invention, utilizes control sequence (SEQ ID NO:8) to build the recombinant cloning vector DBN02R-T that contains control sequence.Positive colony is carried out to sequence verification, and result shows that the native sequences of inserting in recombinant cloning vector DBN02R-T is the nucleotide sequence shown in SEQ ID NO:8 in sequence table, and control sequence is correctly inserted.

The method of the recombinant expression vector DBN100762 that contains AADM3 nucleotide sequence according to the structure described in 1 in fifth embodiment of the invention, utilize native sequences to build the recombinant expression vector DBN100762N that contains native sequences, it builds flow process (carrier framework: pCAMBIA2301(CAMBIA mechanism can provide) as shown in Figure 6; Spec: spectinomycin gene; RB: right margin; Ubi: corn Ubiquitin(ubiquitin) 1 gene promoter (SEQ ID NO:9); MN: control sequence (SEQ ID NO:8); Nos: the terminator of rouge alkali synthetase gene (SEQ ID NO:4); PMI: Phophomannose isomerase gene (SEQ ID NO:10); LB: left margin).Positive colony is carried out to sequence verification, and result shows that the control sequence of inserting in recombinant expression vector DBN100762N is the nucleotide sequence shown in SEQ ID NO:8 in sequence table, and control sequence is correctly inserted.

3, corn recombinant expression vector transforms Agrobacterium

To oneself through building correct recombinant expression vector DBN100762 and DBN100762N(control sequence) by liquid nitrogen method, be transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT:18313-015) in, its conversion condition is: 100 μ L Agrobacterium LBA4404s, 3 μ L plasmid DNA (recombinant expression vector), be placed in liquid nitrogen 10 minutes, 37 ℃ of warm water bath 10 minutes, Agrobacterium LBA4404 after transforming is inoculated in LB test tube in 28 ℃ of temperature, rotating speed is under 200rpm condition, to cultivate 2 hours, be applied on the LB flat board that contains the Rifampin (Rifampicin) of 50mg/L and the spectinomycin of 100mg/L until grow positive monoclonal, its plasmid is cultivated and extracted to picking mono-clonal, with Restriction enzyme Sma I and BglI enzyme, cut and carry out enzyme after DBN100762 and cut checking, with restriction enzyme StyI and BglI enzyme, cut DBN100762N(control sequence) after carry out enzyme and cut checking, result shows recombinant expression vector DBN100762 and DBN100762N(native sequences) structure is entirely true.

The 6th embodiment, proceed to acquisition and the checking of the milpa of AADM3 nucleotide sequence

The Agrobacterium infestation method adopting according to routine, the corn variety of sterile culture is combined to 31(Z31) rataria and the 5th embodiment in Agrobacterium described in 3 cultivate altogether, with by 1 and 2 recombinant expression vector DBN100762 and the DBN100762N(native sequences that build in the 5th embodiment) in T-DNA(comprise the promoter sequence of corn Ubiquitin1 gene, AADM3 nucleotide sequence, control sequence, PMI gene and Nos terminator sequence) be transferred in maize chromosome group, the milpa that proceeds to AADM3 nucleotide sequence and the milpa that proceeds to control sequence have been obtained, in contrast with wild-type milpa simultaneously.

For agriculture bacillus mediated corn, transform, briefly, from corn, separated immature rataria, contacts rataria with agrobacterium suspension, and wherein Agrobacterium can be passed to AADM3 nucleotide sequence at least one cell (step 1: infect step) of one of rataria.In this step, rataria preferably immerses agrobacterium suspension (OD ₆₆₀=0.4-0.6, infect substratum (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 68.5g/L, glucose 36g/L, Syringylethanone (AS) 40mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH5.3)) in, to start, inoculate.Rataria and Agrobacterium are cultivated one period (3 days) (step 2: be total to culturing step) altogether.Preferably, rataria after infecting step at solid medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 20g/L, glucose 10g/L, Syringylethanone (AS) 100mg/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) is upper to be cultivated.After this common cultivation stage, can there is optionally " recovery " step.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) in, at least exist a kind of oneself know the microbiotic (cephamycin) that suppresses Agrobacterium growth, the selective agent (step 3: recovering step) of not adding vegetable transformant.Preferably, rataria is cultivated on the solid medium of selective agent having microbiotic but do not have, and take and eliminates Agrobacterium and provide decubation as infected cell.Then, the rataria of inoculation is containing the transformed calli (step 4: select step) of cultivating and selecting growing on the substratum of selective agent (seminose).Preferably, rataria is having the screening solid medium of selective agent (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 5g/L, seminose 12.5g/L, 2,4-dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH5.8) upper cultivation, causes the cell selective growth transforming.Then, callus regeneration becomes plant (step 5: regeneration step), preferably, above cultivate with aftergrowth at solid medium (MS division culture medium and MS root media) at the callus containing growing on the substratum of selective agent.

The resistant calli that screening obtains is transferred to described MS division culture medium (MS salt 4.3g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, seminose 5g/L, agar 8g/L, pH5.8) upper, cultivate differentiation at 25 ℃.Differentiation seedling is out transferred to described MS root media (MS salt 2.15g/L, MS vitamin b6 usp, casein food grade 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH5.8) on, at 25 ℃, be cultured to about 10cm high, move to hot-house culture to solid.In greenhouse, cultivate 16 hours every day at 28 ℃, then at 20 ℃, cultivate 8 hours.

2, with TaqMan checking, proceed to the milpa of AADM3 nucleotide sequence

Get respectively the about 100mg of blade of the milpa that proceeds to the milpa of AADM3 nucleotide sequence and proceed to control sequence as sample, with the DNeasy Plant Maxi Kit of Qiagen, extract its genomic dna, by Taqman fluorescence probe quantitative PCR method, detect the copy number of AADM3 gene.In contrast with wild-type milpa, detect according to the method described above analysis simultaneously.3 repetitions are established in experiment, average.

The concrete grammar that detects AADM3 gene copy number is as follows:

Step 11, get each 100mg of blade that proceeds to the milpa of AADM3 nucleotide sequence, the milpa that proceeds to control sequence and wild-type milpa respectively, be ground into homogenate respectively in mortar with liquid nitrogen, each sample is got 3 repetitions;

The DNeasy Plant Mini Kit of step 12, use Qiagen extracts the genomic dna of above-mentioned sample, and concrete grammar is with reference to its product description;

Step 13, use NanoDrop2000(Thermo Scientific) measure the genomic dna concentration of above-mentioned sample;

Step 14, adjust above-mentioned sample genomic dna concentration to same concentration value, the scope of described concentration value is 80-100ng/ μ l;

Step 15, adopt Taqman fluorescence probe quantitative PCR method to identify the copy number of sample, using through the sample of identifying known copy number as standard substance, with the sample of wild-type milpa in contrast, 3 repetitions of each sample, get its mean value; Fluorescence quantification PCR primer and probe sequence be respectively:

Following primer and probe are used for detecting AADM3 nucleotide sequence:

Primer 1:CCCAAGGTGCTGTTTTCTCTG is as shown in SEQ ID NO:11 in sequence table;

Primer 2: TGTCTGCAAAGCAGGTTCTGC is as shown in SEQ ID NO:12 in sequence table;

Probe 1:CCAACCGCCGGAACCACCTCTG is as shown in SEQ ID NO:13 in sequence table;

Following primer and probe are used for detecting control sequence:

Primer 3:TGCGTATTCAATTCAACGACATG is as shown in SEQ ID NO:14 in sequence table;

Primer 4:CTTGGTAGTTCTGGACTGCGAAC is as shown in SEQ ID NO:15 in sequence table;

Probe 2:CAGCGCCTTGACCACAGCTATCCC is as shown in SEQ ID NO:16 in sequence table;

PCR reaction system is:

Each 45 μ l of every kind of primer that described 50 * primer/probe mixture comprises 1mM concentration, the probe 50 μ l of 100 μ M concentration and 860 μ l1 * TE damping fluid, and at 4 ℃, be housed in amber test tube.

PCR reaction conditions is:

Utilize SDS2.3 software (Applied Biosystems) analytical data.

Experimental result shows, all oneself is incorporated in the genome of detected milpa for AADM3 nucleotide sequence and native sequences, and the milpa that proceeds to the milpa of AADM3 nucleotide sequence and proceed to control sequence has all obtained the transgenic corn plant that contains single copy AADM3 gene.

The Herbicid resistant effect detection of the 7th embodiment, transgenic corn plant

By proceeding to the milpa of AADM3 nucleotide sequence, the milpa that proceeds to control sequence and wild-type milpa (V3-V4 period), respectively 2,4-D diformazan ammonium salt and methoxone are carried out to Herbicid resistant effect detection.

Get respectively and proceed to the milpa of AADM3 nucleotide sequence, the milpa that proceeds to control sequence and wild-type milpa, and use respectively 2,4-D diformazan ammonium salt (8960g ae/ha, 16 times of land for growing field crops concentration), methoxone (8960g ae/ha, 16 times of land for growing field crops concentration) and blank solvent (water) are sprayed.After spraying 21 days, add up buttress root developmental state.Proceed to totally 3 strains (S1, S2 and S3) of AADM3 nucleotide sequence, proceed to totally 2 strains (S4 and S5) of control sequence, (CK) of wild-type be totally 1 strain; From each strain, select 10-15 strain to test.Result is as shown in table 2.

Table 2, transgenic corns T ₁plant Herbicid resistant experimental result

The result of table 2 shows: AADM3 gene is given the high-level resistance of rotaring gene corn plant weedicide, especially phenoxy group growth hormone weedicide (because monocotyledons itself has certain resistance to phenoxy group growth hormone weedicide, thereby showing high-level resistance); Wild-type milpa does not all have high-caliber phenoxy group growth hormone Herbicid resistant with the milpa that proceeds to control sequence.

In sum, the milpa and the Arabidopis thaliana plant that proceed to AADM3 nucleotide sequence all have compared with high herbicidal agent resistance capacity.AADM3 herbicide resistance gene of the present invention adopts the preference codon of plant, makes herbicide resistance gene of the present invention be particularly suitable for expressing in plant, and AADM3 Herbicid resistant protein of the present invention is wide to Herbicid resistant, especially phenoxy group growth hormone weedicide.

It should be noted last that, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although the present invention is had been described in detail with reference to preferred embodiment, those of ordinary skill in the art is to be understood that, can modify or be equal to replacement technical scheme of the present invention, and not depart from the spirit and scope of technical solution of the present invention.

Claims

1. a Herbicid resistant protein, is characterized in that, comprising:

2. a herbicide resistance gene, is characterized in that, comprising:

(a) nucleotide sequence of Herbicid resistant protein described in coding claim 1; Or

(c) there is the nucleotide sequence shown in SEQ ID NO:1.

3. an expression cassette, is characterized in that, is included in herbicide resistance gene described in the claim 2 under the regulating and controlling sequence regulation and control of effective connection.

4. a recombinant vectors that comprises expression cassette described in herbicide resistance gene described in claim 2 or claim 3.

5. produce a Herbicid resistant method of protein, it is characterized in that, comprising:

The cell that acquisition comprises the transformed host biology of expression cassette described in herbicide resistance gene described in claim 2 or claim 3;

Reclaim described Herbicid resistant protein.

6. produce according to claim 5 Herbicid resistant method of protein, it is characterized in that, described transformed host biology comprises vegetable cell, zooblast, bacterium, yeast, baculovirus, nematode or algae.

7. produce according to claim 6 Herbicid resistant method of protein, it is characterized in that, described plant is soybean, cotton, corn, paddy rice, wheat, beet or sugarcane.

8. the method for increasing herbicidal target scope, it is characterized in that, comprising: together with the second Nucleotide of the Herbicid resistant protein that the Herbicid resistant protein of expression cassette coding described in Herbicid resistant protein or claim 3 described in claim 1 is encoded with expression cassette described in Herbicid resistant protein or claim 3 described at least one is different from claim 1 in plant, express.

9. according to claim 8 for increasing the method for herbicidal target scope, it is characterized in that described the second Nucleotide can encode glyphosate resistance protein, careless ammonium phosphine resistance protein, 4-hydroxyphenyl pyruvic acid dioxygenase, acetolactate synthase, cytopigment proteinoid or proporphyrinogen oxidase.

10. a method of selecting the vegetable cell that transforms, it is characterized in that, comprise: with expression cassette described in herbicide resistance gene or claim 3 described in claim 2, transform a plurality of vegetable cells, and at the transformed cell growth that allows to express described herbicide resistance gene or described expression cassette, and kill no transformed cells or suppress under the weedicide concentration of no transformed cells growth, cultivate described cell, described weedicide is phenoxy group growth hormone.

11. 1 kinds of methods of controlling weeds, it is characterized in that, comprise: the land for growing field crops of kind of plant is used to the weedicide of effective dose, described crop comprises described in claim 2 described in herbicide resistance gene or claim 3 recombinant vectors described in expression cassette or claim 4.

12. according to the method for controlling weeds described in claim 11, it is characterized in that, described weedicide is phenoxy group growth hormone.

The method of 13. 1 kinds of damages of avoiding being caused by weedicide for the protection of plant; it is characterized in that; comprise: recombinant vectors described in expression cassette described in herbicide resistance gene described in claim 2 or claim 3 or claim 4 is imported to plant, make the plant generation after importing enough protect it to avoid the Herbicid resistant protein of weedicide infringement amount.

14. according to the method for the damage of avoiding being caused by weedicide for the protection of plant described in claim 13, it is characterized in that, described weedicide is phenoxy group growth hormone.

15. according to the method for the damage of avoiding being caused by weedicide for the protection of plant described in claim 13 or 14, it is characterized in that, described plant is soybean, cotton, corn, paddy rice, wheat, beet or sugarcane.

The method of glyphosate resistant weed in 16. 1 kinds of lands for growing field crops of controlling glyphosate-tolerant plant, it is characterized in that, comprise: the land for growing field crops of plantation glyphosate-tolerant plant is used to the weedicide of effective dose, described glyphosate-tolerant plant comprises described in claim 2 described in herbicide resistance gene or claim 3 recombinant vectors described in expression cassette or claim 4.

17. according to the method for controlling glyphosate resistant weed in the land for growing field crops of glyphosate-tolerant plant described in claim 16, it is characterized in that, described weedicide is phenoxy group growth hormone.

18. according to the method for controlling glyphosate resistant weed in the land for growing field crops of glyphosate-tolerant plant described in claim 16 or 17, it is characterized in that, described glyphosate-tolerant plant is monocotyledons or dicotyledons.

Give crop 2 for 19. 1 kinds, the method for 4-D Herbicid resistant, is characterized in that, comprising: recombinant vectors described in expression cassette described in herbicide resistance gene described in claim 2 or claim 3 or claim 4 is imported to plant.

20. according to giving crop 2 described in claim 19, the method for 4-D Herbicid resistant, is characterized in that, described plant is soybean, cotton, corn, paddy rice, wheat, beet or sugarcane.