CN111139238B

CN111139238B - Degradation gene dicX3 of herbicide dicamba and application thereof

Info

Publication number: CN111139238B
Application number: CN201910973901.1A
Authority: CN
Inventors: 陆伟; 林敏�; 周正富; 郭倩楠; 张维; 陈明
Original assignee: 中国农业科学院生物技术研究所
Current assignee: Longping Biotechnology Hainan Co ltd
Priority date: 2019-10-14
Filing date: 2019-10-14
Publication date: 2021-08-03
Anticipated expiration: 2039-10-14
Also published as: CN111139238A

Abstract

The invention discloses a gene dicX3 capable of degrading herbicide dicamba. The invention constructs a recombinant vector containing the gene and expresses the recombinant vector in prokaryotic host cells escherichia coli. Experiments prove that the gene has the function of degrading herbicide dicamba after being expressed in prokaryotic host cells, and can be used for cultivating herbicide-resistant transgenic crops and bioremediation of polluted soil.

Description

Degradation gene dicX3 of herbicide dicamba and application thereof

Technical Field

The invention relates to a gene with a function of degrading herbicide dicamba.

Background

The herbicide is a chemical which can lead weeds to die thoroughly or selectively and is widely used for preventing and controlling harmful plants such as weeds, miscellaneous irrigation, miscellaneous trees and the like in farmlands, orchards, flower nursery gardens, grasslands, non-cultivated lands, railway lines, riverways, reservoirs, warehouses and the like. The herbicide can damage crops while bringing harm to weeds, and can cause the problems of yield reduction and the like of the crops, so that the use of the herbicide is greatly limited. To solve this problem of reduced yield, more and more people are beginning to focus on the use of transgenic approaches to develop herbicide-resistant crops.

Dicamba (Dicamba) is a selective and systemic herbicide of postemergence auxin type, belongs to benzoic acid herbicide, and has obvious effect of preventing and killing annual and perennial broadleaf weeds. In recent years, with the excessive use of dicamba, the residue in soil is very serious, and therefore, more and more researchers are beginning to research the degradation problem of dicamba in soil. At present, the degradation mechanism of dicamba is unclear, and research on target proteins cannot be carried out. Only partial studies were conducted on the cloning and acquisition of dicamba-degrading enzyme genes.

The microorganisms are subjected to long-term pressure selection to develop a series of survival mechanisms and functional genes which are suitable for the habitat. The genomes of the strains contain abundant gene resources, and are worthy of being deeply researched.

Disclosure of Invention

The invention aims to find a novel herbicide dicamba degradation gene, and an encoded protein of the gene can be used for degrading dicamba molecules.

The invention obtains a gene dicX3 for degrading herbicide dicamba from the microbial metagenome data of soil samples around certain pharmaceutical factories in south China. The expression vector of the gene is constructed and is expressed in escherichia coli of a herbicide degradation screening strain.

Experiments prove that the gene has the function of degrading herbicide dicamba after being expressed in prokaryotic host cells, and can be used for cultivating herbicide-resistant transgenic crops and bioremediation of polluted soil.

The specific study work was as follows:

1. obtaining a recombinant engineering strain containing the dicX3 gene

1) The dicX3 gene is amplified from the microbial metagenome of the soil sample around some pharmaceutical factory in south by PCR, the size is 1086bp, the gene codes 361 amino acids, and the gene is cloned on a vector pJET to construct a recombinant clone plasmid pJET-dicX3 containing the complete dicX3 gene;

2) the dicX3 gene is connected to pRAD1 plasmid, which contains a constitutive high-expression groEL promoter and can efficiently and continuously express downstream target protein. Constructing a finished recombinant plasmid pRAD-dicX 3;

3) transferring the recombinant plasmid pRAD-dicX3 into which the dicX3 gene is introduced into a dicamba degradation gene screening strain Escherichia coli JM109 to obtain an engineering strain JM-dicX3 (see example 1 for details);

2. catalytic activity experiment of recombinant escherichia coli engineering strain expressing dicX3

Studies have shown that a key step in the degradation of the herbicide dicamba is in the demethylation of the dicamba molecule. The herbicide dicamba is demethoxylated to generate 3, 6-dichlorosalicylic acid (DCSA) without herbicide activity through the catalysis of microbial enzyme.

Experiments prove that after the herbicide dicamba compound is added into the culture medium and incubation is carried out for 48 hours, the recombinant Escherichia coli engineering strain JM-dicX3 expressing dicX3 can completely degrade dicamba molecules to generate demethylated DCSA without herbicide activity.

Experimental results show that the recombinant expression DicX3 protein has a catalytic function of degrading herbicide dicamba, and degradation products are mainly 3, 6-dichlorosalicylic acid (DCSA) without herbicide activity. The gene has application potential in the aspects of cultivation of herbicide-resistant transgenic crops and bioremediation of polluted soil.

Sequence Listing information

SEQ ID NO. 1: nucleotide sequence of dicX3 gene.

SEQ ID NO. 2: the amino acid sequence of DicX 3.

Description of the drawings:

FIG. 1 is a HPLC detection chart of standard dicamba and 3, 6-dichlorosalicylic acid; wherein

A, dicamba, the detection wavelength lambda is 275nm, and the peak-off time is 6 min;

b, DCSA, with the detection wavelength of lambda being 319nm and the peak-off time being 5.1 min;

FIG. 2 the effect of engineered strain JM-dicX3 on dicamba degradation;

in FIG. 2A, dicamba (peak 1) was not detected in the medium of recombinant engineered bacterium JM-dicX3 (solid line) expressing the dicX3 gene after 60h incubation;

in FIG. 2B, the major product of the recombinant engineered bacterium JM-dicX3 (solid line) after incubation for 60h is DCSA (peak 2). Whereas the control strain JM-D1 (dashed line) did not detect the degradation capability of the peak substance No.2 dicamba.

Detailed Description

The plasmids, strains and objects of the catalytic degradation by microorganisms mentioned in the following examples are only used for further detailed description of the present invention and do not limit the essence of the present invention. Where specific experimental conditions are not indicated, they are in accordance with conventional conditions well known to those skilled in the art or as recommended by the manufacturer. The plasmids and strains mentioned in the examples were derived from:

cloning vector pJET: commercially available from ThermoFisher corporation;

expression plasmid pRAD 1: the laboratory is preserved;

escherichia coli JM 109: is a product sold in Beijing Quanjin company.

Standard dicamba with 3, 6-dichlorosalicylic acid: commercially available from sigma-aldrich.

Example 1 expression of the DicX3 Gene sequence in the soil metagenome in E.coli

First, experimental material

Escherichia coli JM 109: is a product sold in Beijing Quanjin company.

PCR template DNA: soil metagenome DNA

Second, Experimental methods

1. Designing 1 pair of PCR specific primers according to the metagenome gene sequence obtained by sequencing:

dicX3-F：5′ACCACTAGTATGCCTTTCGTTTACAATGC 3′

dicX3：5′ACCCATATGTTACCCTCTCAATCCGGTGC 3′

2. and amplifying a target gene sequence from the metagenome DNA by a PCR method.

Reaction conditions are as follows: 10min at 95 deg.C, [ 30sec at 95 deg.C, 30sec at 60 deg.C, 1.0min at 72 deg.C ]35 cycles, 10min at 72 deg.C.

3, after the PCR product is recovered by glue, cloning the PCR product on a vector pJET, and naming the PCR product as pJET-dicX3, and sequencing and verifying the PCR product; then obtaining a dicX3 gene containing a sticky end and a pRAD1 vector containing a groEL promoter by SpeI/NdeI double digestion, constructing an Escherichia coli expression vector pRAD-dicX3, transforming the expression vector into Escherichia coli JM109, verifying the correct insertion sequence by PCR, enzyme digestion and sequencing, and naming the strain as JM-dicX 3. E.coli JM109 containing pRAD1 control empty plasmid was designated JM-D1. .

Third, experimental results

The gene dicX3 in the soil metagenome is successfully cloned by utilizing a PCR technology, and the recombinant escherichia coli engineering strain for expressing the gene dicX3 is successfully constructed. The inserted sequence is verified to be correct by PCR, enzyme digestion and sequencing, and the strain is named as JM-dicX 3. Coli JM109 containing pRAD1 control empty plasmid, designated JM-D1.

Fourth, conclusion of experiment

And completing the construction of the recombinant engineering strain of the Escherichia coli for expressing the dicX 3.

EXAMPLE 2 experiment on catalytic Activity of recombinant engineered Escherichia coli Strain expressing dicX3

First, experimental material

Recombinant engineering strains: JM-dicX3 Strain expressing dicX3 Gene obtained in example 1

Control strain: JM-D1 strain containing the empty plasmid as described in example 1.

Second, Experimental methods

1. Marking and activating a control strain and a recombinant engineering strain on an LB solid culture medium plate;

2. selecting a single colony, inoculating the single colony in a liquid LB culture medium added with corresponding antibiotics, and culturing at 37 ℃ to the middle and later exponential stages;

3.4000rpm for 4min, centrifugally collecting the thalli, and carrying out heavy suspension and washing twice by using an MSM culture medium;

4. resuspend the strain in 50mL MSM medium containing 500mg/L dicamba;

5. collecting bacteria at different time points of 0h, 24h, 48h, 60h and 76h, respectively, and determining OD₆₀₀And sampling for HPLC to determine the content of dicamba in the culture solution.

High performance liquid chromatography was performed using a Hewlett packard 1050 series HPLC system. The chromatographic column is. The sample loading was 100. mu.L, dicamba and its degradation products

Dilution analysis was performed by using gradient changes in the mobile phase. The gradient of the moving phase solution B is changed from 30 percent to 95 percent in 30 min. (A: ultrapure water: acetonitrile: methanol: acetic acid: 58.4:31.7:7.5: 2.4; B: 100% acetonitrile), and the flow rate was 0.8 mL/min. Detection wavelength: dicamba λ 275 nm; DCSA λ 319 nm.

Third, experimental results

As shown in fig. 1, the uv detection wavelength of the herbicide dicamba in a is 275nm, and the peak-off time is about 6 min; in B, the peak of the degradation product DCSA is that the ultraviolet detection wavelength is lambda of 319nm, and the peak-off time is about 5.1 min.

The recombinant engineering bacterium JM-dicX3 for expressing the dicX3 gene has a significantly different product peak pattern from a control strain JM-D1 containing an empty plasmid. In FIG. 2A, the major compound peak in the medium of control strain JM-D1 (dashed line) after 60h incubation was still peak number 1 with a retention time of 6min, which is the dicamba compound as a result of the control standard. In FIG. 2A, the peak pattern of the compound in the medium of recombinant engineered bacterium JM-dicX3 (solid line) expressing dicX3 gene was significantly changed, and peak No.1 was not detected. In FIG. 2B, the major product of the recombinant engineered bacterium JM-dicX3 (solid line) after incubation for 60h is peak 2 with retention time at 5.1min, which is shown as DCSA compound in the result of the control standard. Whereas no peak substance production was detected for the control strain JM-D1 (dashed line).

Fourth, conclusion of experiment

The RecX 3 protein has catalytic function of degrading herbicide dicamba, and the degradation product is mainly 3, 6-dichlorosalicylic acid (DCSA) without herbicide activity. The gene is shown to have application potential in the aspects of cultivation of herbicide-resistant transgenic crops and bioremediation of polluted soil.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> degrading gene dicX3 of herbicide dicamba and application thereof

<160> 2

<170> PatentIn version 3.1

<210> 1

<211> 1086

<212> DNA

<213> metagenomic DNA (metagenomic DNA)

<400> 1

atgcctttcg tttacaatgc ctggtacgta atcgcgctgc ccgatgaggt gatcgatcgg 60

ccgctggcgc ggaccgtgtt gggtatgccg ttggtgtcgt ttcgccagac cgacggtgcc 120

gcggcggtac tactggacct ctgcccacat cgatttgccg cgttgagcga cggttctgtc 180

gcaggcggca ggttgcaatg tccctatcac gggcttcaat tcgatggcgg ggggcggtgt 240

gttcacaacc cgcacggtaa tggcgcgcgc ccgtccacgc ttgacgtgcg atccttcccg 300

gtcgtcgaac gcgacgatct gatctggata tgggcgggtg acgcaggcga tgcggatccc 360

gccgatattc ccgacttcag atgccgcgtc gatcccgacc tgggccatgt cggcggctat 420

ttccatcttg gctgcaacga caggctgttg ctcgataacc tgatggatct cgggcatgcg 480

caatatgttc acagcagtaa agcgcagtcc gatggctttg cgcggcaccg tcgtgatgtg 540

gtccgagagc gccgcgatat tcatgcgttc atcacctatc cgtccgccgc gccgaatgca 600

ttgacgcggc gtttcctgcc cgacgcgccg gaactggtcg acggatggag tgatgtgcgc 660

tggtttccgg tcagcgccac gttgaattat gtcgcctatg cccccgccgg atcggcgaag 720

gagagcagcc gaggagcatc tgggacgcac attctgaccc cggaaagcga gggggcgacg 780

cactatttct tcgggtcgtc gcgcaacttc gccatagacg accctgccat cgatcaggtg 840

ctgcgcgaat ggcagattca ggcgctgacg cgcgaggata agcgcgtggt agagcaggtc 900

gaggcgcgct cggcctatgc gcgggcccac gagttcacgc ctgccatgct gagctgcgac 960

gaggcagccg ttcgtgtgtc gcgcgaaatc gatcggctgg agcgggtgga gcgagagcga 1020

gcatcgacct cgcacgtcgc gccgatttca acgaccgccg atcgcagcac cggattgaga 1080

gggtaa 1086

<210> 2

<211> 361

<212> PRT

<213> metagenomic DNA (metagenomic DNA)

<400> 2

MET Pro Phe Val Tyr Asn Ala Trp Tyr Val Ile Ala Leu Pro Asp Glu

1 5 10 15

Val Ile Asp Arg Pro Leu Ala Arg Thr Val Leu Gly MET Pro Leu Val

20 25 30

Ser Phe Arg Gln Thr Asp Gly Ala Ala Ala Val Leu Leu Asp Leu Cys

35 40 45

Pro His Arg Phe Ala Ala Leu Ser Asp Gly Ser Val Ala Gly Gly Arg

50 55 60

Leu Gln Cys Pro Tyr His Gly Leu Gln Phe Asp Gly Gly Gly Arg Cys

65 70 75 80

Val His Asn Pro His Gly Asn Gly Ala Arg Pro Ser Thr Leu Asp Val

85 90 95

Arg Ser Phe Pro Val Val Glu Arg Asp Asp Leu Ile Trp Ile Trp Ala

100 105 110

Gly Asp Ala Gly Asp Ala Asp Pro Ala Asp Ile Pro Asp Phe Arg Cys

115 120 125

Arg Val Asp Pro Asp Leu Gly His Val Gly Gly Tyr Phe His Leu Gly

130 135 140

Cys Asn Asp Arg Leu Leu Leu Asp Asn Leu MET Asp Leu Gly His Ala

145 150 155 160

Gln Tyr Val His Ser Ser Lys Ala Gln Ser Asp Gly Phe Ala Arg His

165 170 175

Arg Arg Asp Val Val Arg Glu Arg Arg Asp Ile His Ala Phe Ile Thr

180 185 190

Tyr Pro Ser Ala Ala Pro Asn Ala Leu Thr Arg Arg Phe Leu Pro Asp

195 200 205

Ala Pro Glu Leu Val Asp Gly Trp Ser Asp Val Arg Trp Phe Pro Val

210 215 220

Ser Ala Thr Leu Asn Tyr Val Ala Tyr Ala Pro Ala Gly Ser Ala Lys

225 230 235 240

Glu Ser Ser Arg Gly Ala Ser Gly Thr His Ile Leu Thr Pro Glu Ser

245 250 255

Glu Gly Ala Thr His Tyr Phe Phe Gly Ser Ser Arg Asn Phe Ala Ile

260 265 270

Asp Asp Pro Ala Ile Asp Gln Val Leu Arg Glu Trp Gln Ile Gln Ala

275 280 285

Leu Thr Arg Glu Asp Lys Arg Val Val Glu Gln Val Glu Ala Arg Ser

290 295 300

Ala Tyr Ala Arg Ala His Glu Phe Thr Pro Ala MET Leu Ser Cys Asp

305 310 315 320

Glu Ala Ala Val Arg Val Ser Arg Glu Ile Asp Arg Leu Glu Arg Val

325 330 335

Glu Arg Glu Arg Ala Ser Thr Ser His Val Ala Pro Ile Ser Thr Thr

340 345 350

Ala Asp Arg Ser Thr Gly Leu Arg Gly

355 360

Claims

1, a gene of a sequence shown as SEQ ID NO. 1.

2. A plasmid containing a sequence gene shown as SEQ ID NO. 1.

3. The use of the gene of claim 1 in herbicide dicamba resistant transgenic crop cultivation and environmental bioremediation to degrade herbicide dicamba.

4. Use according to claim 3, wherein the degradation is a catalytic reaction of the toxic herbicide dicamba compound to a non-toxic compound.

5. Use of the plasmid of claim 2 in herbicide dicamba resistant transgenic crop cultivation and herbicide dicamba degradation.

6. The encoded product of the gene of claim 1, which has the amino acid sequence shown in SEQ ID NO. 2.