CN104561078A - Chlamydomonas reinhardtii Se1K expression vector as well as construction method and expression method thereof - Google Patents
Chlamydomonas reinhardtii Se1K expression vector as well as construction method and expression method thereof Download PDFInfo
- Publication number
- CN104561078A CN104561078A CN201410675873.2A CN201410675873A CN104561078A CN 104561078 A CN104561078 A CN 104561078A CN 201410675873 A CN201410675873 A CN 201410675873A CN 104561078 A CN104561078 A CN 104561078A
- Authority
- CN
- China
- Prior art keywords
- chlamydomonas reinhardtii
- selk
- plasmid
- expression vector
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a construction method of a chlamydomonas reinhardtii Se1K expression vector. The construction method comprises the following steps: amplifying an ORF gene segment of human Se1K to obtain an ORF gene amplification product; amplifying an SECIS gene segment of chlamydomonas reinhardtii Se1W1 to obtain an SECIS gene amplification product; recombining the ORF gene amplification product with the SECIS gene amplification product to obtain a recombinant Se1K gene; and introducing the recombinant Se1K gene into a plasmid vector which can be expressed in the chlamydomonas reinhardtii to form a recombinant plasmid product. According to the chlamydomonas reinhardtii Se1K expression vector constructed by the method, a novel plasmid vector capable of expressing an exogenous target selenoprotein K in the chlamydomonas reinhardtii is constructed; compared with the existing in-vitro expression vectors such as a prokaryotic expression system, and a method, the product is generated by a similar expression mechanism, so that the product has good monotonicity and directionality; the efficiency is greatly improved; the chlamydomonas reinhardtii can be adopted as a reactor for producing selenoprotein during expression; and the construction method is portable and efficient, and can completely meet the bases of research on structure functions of the selenoprotein and development of selenoprotein anti-cancer drugs.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to a kind of Chlamydomonas reinhardtii SelK expression vector and construction process thereof and expression method.
Background technology
Selenium is micro-as the one that humans and animals is required, plays an important role to many physiological functions, and closely related with various diseases, as cancer, nerve degenerative diseases and cardiovascular diseases etc.Selenium plays biological function mainly through various seleno-protein, such as, in the seleno-protein found at present, SelK seleno-protein for participating in reply oxidative stress in myocardial cell, participates in regulating er stress, in receptor-mediated activated immune cell process, promote calcium current in human liver cancer cell; And participate in endoplasmic reticulum associated protein degradation, participate in regulating Macrophage Surface CD36 palmitoylation, affect the critical function embodiments such as the formation of foam cell and atheroma, there is important using value.
In existing seleno-protein product, mostly adopt chemical synthesis process to carry out, product is high except there is cost, outside productive rate is low, prior owing to departing from body shortage directional property; Therefore existing tend to adopt by means of prokaryotic expression system, eucaryon yeast expression system and mammalian cell expression system to realize the vivoexpression of gene, synthesize in a large number.
But owing to comparing with the expression of other albumen, the expression of seleno-protein has must singularity, terminator codon UGA is encoded to Sec and not as the special cis-acting elements SECIS that termination signal depends on gene; And eukaryote seleno-protein gene structure is different from prokaryotic organism seleno-protein, and expression mechanism there is very large difference can not be compatible.Therefore, with prokaryotic expression system such as intestinal bacteria, directly to express eucaryon seleno-protein difficulty very large.And there is not seleno-protein expression mechanism in yeast and higher plant, the expression of seleno-protein cannot be carried out.Utilize mammalian cell expression system to express eucaryon seleno-protein, there is not the problem whether expression mechanism is compatible.But the production efficiency of seleno-protein is very low there is no the great expression that method realizes seleno-protein, also albumen cannot be purified to.Therefore, the vivoexpression of seleno-protein and the method for synthesis, can not meet single, efficient, a large amount of application demands.
Summary of the invention
The object of the embodiment of the present invention is the above-mentioned deficiency overcoming prior art, there is provided a kind of can using with Chlamydomonas reinhardtii as producing the reactor of seleno-protein, carry out the Chlamydomonas reinhardtii SelK expression vector of animal seleno-protein great expression and construction process thereof and expression method.
In order to realize foregoing invention object, the technical scheme of the embodiment of the present invention is as follows:
A construction process for Chlamydomonas reinhardtii SelK expression vector, is characterized in that, comprise the steps:
The ORF gene fragment of amplification people SelK, obtains ORF gene amplification product;
The SECIS gene fragment of amplification Chlamydomonas reinhardtii SelW1, obtains SECIS gene amplification product;
Described ORF gene amplification product and SECIS gene amplification product are recombinated, obtains recombinant type SelK gene;
By the plasmid vector that described recombinant type SelK channel genes can be expressed in Chlamydomonas reinhardtii, form recombinant plasmid product.
Chlamydomonas reinhardtii SelK expression vector constructed by the inventive method, constructs the novel plasmid carrier can expressing external source object seleno-protein K in Chlamydomonas reinhardtii; Compare carrier and the method for the vivoexpressions such as existing chemosynthesis, prokaryotic expression system, product produces for similar expression mechanism, has very good unicity and directional property, efficiency improve greatly.
The present invention also proposes a kind of Chlamydomonas reinhardtii SelK expression vector obtained constructed by aforesaid method further.
Adopt carrier of the present invention, Chlamydomonas reinhardtii can be adopted during expression as the reactor producing seleno-protein, convenient and efficient; The complete basis that can meet structure function and the exploitation seleno-protein cancer therapy drug studying seleno-protein.
The present invention also proposes a kind of expression method of above-mentioned Chlamydomonas reinhardtii SelK expression vector further, comprises the steps:
The mode mediate Chlamydomonas reinhardtii SelK expression vector granulated glass sphere and chlamydonomas reinhardtii cells transform, and are formed and transform state Chlamydomonas reinhardtii;
Conversion state Chlamydomonas reinhardtii is carried out fermentation culture, and expresses with Se compound induction SelK during the fermentation.
Expression method of the present invention, compares carrier and the method for the vivoexpressions such as existing chemosynthesis, prokaryotic expression system, and product produces for similar expression mechanism, has very good unicity and directional property, efficiency improve greatly; And Chlamydomonas reinhardtii can be adopted when expressing as the reactor producing seleno-protein, convenient and efficient; The complete basis that can meet structure function and the exploitation seleno-protein cancer therapy drug studying seleno-protein.
Accompanying drawing explanation
Below in conjunction with drawings and Examples, the invention will be further described, in accompanying drawing:
Fig. 1 is the plasmid vector PH124 plasmid map can expressed in Chlamydomonas reinhardtii that the embodiment of the present invention adopts;
Fig. 2 is the construction process schematic diagram of embodiment of the present invention Chlamydomonas reinhardtii SelK expression vector;
Fig. 3 is the PCR primer electrophoresis result of the ORF fragment of embodiment of the present invention people SelK;
Fig. 4 is the total serum IgE detected through gel electrophoresis result figure of the chlamydomonas that the embodiment of the present invention is extracted;
Fig. 5 is the PCR primer electrophoresis result of the SECIS fragment of embodiment of the present invention chlamydomonas SelW1;
Fig. 6 is the electrophoresis result that the embodiment of the present invention carries out ORF fragment and SECIS fragment overlapping PCR products;
Fig. 7 is the electrophoresis result of the amplified production of the plasmid DNA extracted in embodiment of the present invention positive-selecting;
Fig. 8 is the electrophoresis result of the amplified production double digestion fragment of plasmid DNA in embodiment of the present invention positive-selecting;
Fig. 9 is the result figure of the online comparison of NCBI Blast of the ORF of positive plasmid DNA sequencing result and the people SelK extracted in embodiment of the present invention positive-selecting;
Figure 10 is the result figure of the online comparison of NCBI Blast of the SEICS of positive plasmid DNA sequencing result and the chlamydomonas SelW1 extracted in embodiment of the present invention positive-selecting;
Figure 11 is the expression of results figure of SelK in embodiment of the present invention immune-blotting method transgenosis chlamydomonas.
Embodiment
In order to make object of the present invention, technical scheme and advantage clearly understand, below in conjunction with drawings and Examples, the present invention is further elaborated.Should be appreciated that specific embodiment described herein only in order to explain the present invention, be not intended to limit the present invention.
The embodiment of the present invention provides a kind of construction process of Chlamydomonas reinhardtii SelK expression vector, and it comprises the steps:
S10, the ORF gene fragment of amplification people SelK, obtains ORF gene amplification product;
S20, the SECIS gene fragment of amplification Chlamydomonas reinhardtii SelW1, obtains SECIS gene amplification product;
S30, recombinates ORF gene amplification product and SECIS gene amplification product, obtains recombinant type SelK gene;
S40, by the plasmid vector that recombinant type SelK channel genes can be expressed in Chlamydomonas reinhardtii, forms recombinant products;
The recombinant products that step S40 obtains is Chlamydomonas reinhardtii SelK expression vector.
The present invention is based on the feature that Chlamydomonas reinhardtii and mammalian cell have similar seleno-protein expression mechanism, therefore the gene of expressing higher seleno-protein W (SelW) in Chlamydomonas reinhardtii is adopted to transform as goal gene, with the seleno-protein K gene of people open reading frame ORF be connected, and with the plasmid vector restructuring can expressed in Chlamydomonas reinhardtii, construct the novel plasmid carrier can expressing external source object seleno-protein K in Chlamydomonas reinhardtii.
Wherein, in above-mentioned steps S10-S30 of the present invention, in order to make the process of gene recombination more accurately with quick, carry out in the following way:
In amplification procedure in step slo to the ORF gene fragment of people SelK, upstream primer F1 and downstream primer R1 is adopted to carry out; Wherein, upstream primer F1 has the base sequence of sequence table SEQ .ID.No.1, and downstream primer R1 has the base sequence of sequence table SEQ .ID.No.2.
Increase in step S20 Chlamydomonas reinhardtii SelW1 SECIS gene process in adopt upstream primer FW and downstream primer RW to carry out; Wherein, upstream primer FW has the base sequence of sequence table SEQ .ID.No.3, and downstream primer RW has the base sequence of sequence table SEQ .ID.No.4.
| Title | Sequence (5 '-3 ') | Length | Sequence number |
| Upstream primer F1 | CGGCTAGCATGGTTTACATCTCGAACGGA | 29bp | SEQ.ID.No.1 |
| Downstream primer R1 | CATCGATGTTACCTTCCTCATCCACCAGC | 29bp | SEQ.ID.No.2 |
| Upstream primer FW | CATCGATGACTGAGCACTGCCGC | 23bp | SEQ.ID.No.3 |
| Downstream primer RW | TTCACGTGGGCACAGCCTCATGACCT | 26bp | SEQ.ID.No.4 |
Above-mentioned primer is adopted to carry out respectively entering as restricted endonuclease recognized site in the ORF gene of people SelK and the SECIS gene amplification product of Chlamydomonas reinhardtii SelW1 in the present invention, respectively corresponding above-mentioned base NHe1 enzyme (GCTAGC), Cla1 enzyme (CATCGATG) and Pmac1 enzyme (CACGTG).
Simultaneously, because when increasing the ORF of people SelK, 3 ' end introduces Cla1 restriction enzyme site, during the SECIS of amplification chlamydomonas SelW1,5 ' end introduces Cla1 restriction enzyme site, therefore such two fragments have just had one section of Cla1 restriction enzyme site to repeat base sequence, so common enzyme can not be adopted in step s 30 to cut and DNA ligase, and the mode of over-lap PCR is directly adopted to carry out the connection restructuring of ORF gene and SECIS gene; Concrete:
In step S30 using upstream primers F 1 and downstream primer RW as primer pair, the ORF gene amplification product and SECIS gene amplification product that obtain to increase in step S10 and step S20 be for template, increased by over-lap PCR, by the extension of overlapping chain in amplified reaction, just the ORF gene amplification product of different sources and SECIS gene amplification product lap splice can be got up; Realize the restructuring of ORF gene amplification product and SECIS gene amplification product, obtain recombinant type SelK gene.
After step S30 obtains recombinant type SelK gene product, further recombinant type SelK gene is connected with the plasmid vector can expressed in Chlamydomonas reinhardtii, transforms in step S40; Over-lap PCR is carried out owing to adopting above-mentioned primer, the recombinant type SelK gene finally obtained has the restriction enzyme site of Nhe1 and Pmac1 respectively, therefore just can adopt after recombinant type SelK gene and the plasmid vector can expressed in Chlamydomonas reinhardtii are all carried out Nhe1 and Pmac1 double digestion in this step S40, carry out connecting restructuring with T4DNA ligase enzyme again, namely obtain the recombinant products of object plasmid.Therefore, the recombination form that the enzyme that in enforcement, the above-mentioned plasmid vector can expressed in Chlamydomonas reinhardtii itself is directed to Nhe1 and Pmac1 is cut, the plasmid vector type that technician directly can choose the double enzyme site inherently with Nhe1 and Pmac1 carries out the present invention.
Based on above-mentioned, the plasmid vector can expressed in Chlamydomonas reinhardtii in the present invention, preferred employing chlamydomonas expression vector PH124, granted by Shenzhen University professor Hu Zhangli, it includes two expression cassettes: one is the expression cassette of foreign gene, starts exogenous gene expression with the tandem type promotor of HSP70A-RBCS2, HSP70A is the strong promoter of hot activation albumen, RBCS2 is Light-inducible strong promoter, and being connected by strong promoter strengthens starting efficiency, using the terminator of RBCS2 as terminator sequence.Also have the expression cassette of a Ble albumen in addition, the expression of Ble can produce Zeocin resistance, and wild-type Chlamydomonas reinhardtii is very responsive to Zeocin microbiotic, can be used for assisting sifting chlamydomonas positive transformant; And itself also has the double enzyme site of Nhe1 and Pmac1, be convenient to restructuring.And if those skilled in the art are when obtaining, also can describe according to the transformation of Fig. 1 and above-mentioned expression structure, self reliant rebuilding obtains, or uses other plasmids can expressed in chlamydomonas instead, does not limit at this.
Meanwhile, due to the specific designs of above-mentioned primer in step S40, form the digestion products that one end is Nhe1 sticky end, one end is flat end in the process of restructuring after double digestion, be beneficial to the accurate connection of restructuring.
Adopt the Chlamydomonas reinhardtii SelK expression vector constructed by the inventive method, the feature of similar seleno-protein expression mechanism is had based on Chlamydomonas reinhardtii and mammalian cell, the gene of expressing higher seleno-protein W (SelW) in Chlamydomonas reinhardtii is transformed as goal gene, with the seleno-protein K gene of people open reading frame ORF be connected, and carry out expression with the Chlamydomonas reinhardtii PH124 plasmid vector of strong promoter series connection to promote, construct the novel plasmid carrier can expressing external source object seleno-protein K in Chlamydomonas reinhardtii.Compare the vivoexpression of seleno-protein and the methods of synthesis such as existing chemical synthesis process and prokaryotic expression system, first the efficiency expressed improves greatly, and its product of expressing produces for similar expression mechanism, there is very good unicity and directional property, and Chlamydomonas reinhardtii can be adopted when expressing as the reactor producing seleno-protein, convenient and efficient, can also meet the basis as the structure and function and exploitation seleno-protein cancer therapy drug studying seleno-protein further.
After aforesaid method, after above-mentioned steps S40, in order to ensure the accuracy of the positive plasmid that restructuring obtains, can also step S50 be comprised, obtained recombinant plasmid be carried out to the step of positive-selecting, following details step specifically can be adopted to carry out:
S51, imports to the recombinant products of step S40 in competence intestinal bacteria (E.coli DH5 α), and cultivates with the LB solid medium containing AMP resistance, and the E. coli clones that can grow is the correct recombination bacillus coli imported;
S52, selects the correct recombination bacillus coli mono-clonal bacterium colony imported, cultivates in the liquid nutrient medium of penbritin, and collects thalline and extract the plasmid DNA of thalline;
S53, with the plasmid DNA extracted for template, increases with upstream primers F 1 and downstream primer Rw, obtains checking amplified production;
S54, carries out double digestion (Nhe1 nucleic acid restriction endonuclease and pmac1 nucleic acid restriction endonuclease), and carries out electrophoresis observation to double digestion product by checking amplified production;
Simultaneously, in order to ensure the accuracy of electrophoresis detection further, step S55 can also be carried out: the band of electrophoresis is verified as positive recon plasmid and checks order, by the online comparison of sequencing result NCBI Blast, whether the sequence of the gene fragment inserted in checking recombinant plasmid is correct, the plasmid that screening sequence is correct.
Certainly, the wherein amplification procedure of step S54, whether checking has the insertion of object seleno-protein gene, and S55 can also determine that whether the position of the gene fragment inserted, sequence be correct further further.
The present invention also proposes a kind of method of the Chlamydomonas reinhardtii SelK expression vector obtained constructed by aforesaid method being carried out express in Chlamydomonas reinhardtii further, comprises the steps:
S100, the successful recombinant products Not1 of the restructuring obtained by step S40 limits endonuclease digestion, obtains linearization plasmid;
S200, transforms linearization plasmid and chlamydonomas reinhardtii cells by the mode of granulated glass sphere mediation, is formed and transform state Chlamydomonas reinhardtii;
S300, carries out fermentation culture by conversion state Chlamydomonas reinhardtii, and expresses with Se compound induction SelK during the fermentation;
After this step S300, can also step S400 be comprised:
Identify expressing seleno-protein product in step S300, and compare with the expression amount of seleno-protein K in normal people HEK293 cell, the carrier in checking the present invention has the effect of high expression level object seleno-protein K.
For making clearly complete, the enforcement reference that is easy to those skilled in the art of the implementation detail of aforesaid method process of the present invention, and make outstanding progressive effect of the present invention more remarkable, by the following examples concrete example explanation is carried out to the enforcement of said process.
Embodiment 1
S10, with Human fetal spleen library (laboratory storage) for template, carries out pcr amplification by upstream primer F1 and downstream primer R1, the ORF fragment (301bp) of amplification people SelK;
PCR reaction conditions is 94 DEG C of denaturation 5min; 94 DEG C, 30s; 55 DEG C, 30s; 72 DEG C, 40sec; After 30 circulations, 72 DEG C extend 7min.Then get whole pcr amplification product and carry out agarose gel electrophoresis.PCR primer is cut glue and is reclaimed;
As shown in Figure 3, wherein M is DL2000 standard molecular weight to the PCR primer electrophoresis result of the ORF fragment of people SelK, and swimming lane 1,2 is all the amplified production of the ORF fragment RT-PCR of people SelK.
S20, the SECIS gene fragment of amplification Chlamydomonas reinhardtii SelW1, specifically carry out in accordance with the following steps:
S21, extract Chlamydomonas reinhardtii total serum IgE, inoculating cell wall defective type Chlamydomonas reinhardtii CC-849 (Shenzhen University Life Science College professor Hu Zhangli grants), in the TAP nutrient solution of sterilizing, is placed in illumination box and cultivates.Culture condition: intensity of illumination is 6000lx, temperature is 25 Light To Dark Ratios is 16h/8h; Every day shakes 2-3 time.To take the logarithm (about 1 × 10 of Later growth
7cells/mL) the centrifugal 5min of 5ml Chlamydomonas reinhardtii algae liquid 5000 turns 4 DEG C collects frond, and utilize TRIZOL reagent to extract chlamydomonas total serum IgE after washing twice with the aqua sterilisa of 0.1%DEPC process, extracting method carries out with reference to the description of product.
The RNA quality that the total serum IgE detected through gel electrophoresis of chlamydomonas extracted is extracted as shown in Figure 4, can be observed 28s, 18s, 5s tri-RNA bands of chlamydomonas clearly, illustrate that RNA quality can be used for follow-up test.
S22, carries out RT-PCR to the Chlamydomonas reinhardtii total serum IgE extracted;
First carry out RT reaction, obtain Chlamydomonas reinhardtii cDNA; Method is carried out according to following system:
Reaction conditions: 42 DEG C, 20min; 99 DEG C, 5min; 4 DEG C, after 5min, 12000rpm centrifugal 1min.-20 DEG C saves backup;
Then carry out PCR reaction, respectively with Chlamydomonas reinhardtii cDNA for template, carry out SECIS (SECISchselW1) fragment (214bp) of PCR reaction amplification chlamydomonas SelW1 with upstream primers F w and downstream primer Rw, process is as follows:
PCR reaction conditions is 94 DEG C of denaturation 5min; 94 DEG C, 30s; 55 DEG C, 30s; 72 DEG C, 40sec; After 30 circulations, 72 DEG C extend 7min.Then get whole pcr amplification product and carry out agarose gel electrophoresis, PCR primer is cut glue and is reclaimed.This agarose gel electrophoresis and glue reclaims this fragment as shown in Figure 5, M is DL2000 standard molecular weight, and band 1,2 is the amplified production of the RT-PCR of the SECIS of Chlamydomonas reinhardtii SelW1.
S30, over-lap PCR builds recombinant type SelK:
When increasing the ORF of people SelK, 3 ' end introduces Cla1 restriction enzyme site, during the SECIS of amplification chlamydomonas SelW1,5 ' end introduces Cla1 restriction enzyme site, therefore such two fragments have just had one section of Cla1 restriction enzyme site to repeat base sequence, adopt the method for over-lap PCR to obtain splicing recombinant fragment.Be template with the SECISchselw1 of ORF and chlamydomonas SelW1, the forward primer of ORF and the reverse primer (F1, Rw) of SECIS carry out a kind of recombinant type SelK gene (ORFhselk-SECISchselw1) (507bp) of PCR reaction amplification; Reaction system is as follows:
PCR reaction conditions is 94 DEG C of denaturation 5min; 94 DEG C, 30sec; 42 DEG C, 30sec; 72 DEG C, 40sec; The each 0.5 μ L of upstream and downstream primer is added respectively after 5 circulations.Continuing 20 circulating reaction conditions is 94 DEG C, 30sec; 55 DEG C, 30sec; 72 DEG C, 40sec; 72 DEG C extend 7min, and pcr amplification product carries out agarose gel electrophoresis, cut glue and reclaim after electrophoresis; Wherein electrophoresis result as shown in Figure 6, and in Fig. 6, band M is DL2000 standard molecular weight; Band 1,2 is the pcr amplification product of SelK recombinant fragment.
S40, recombinant type SelK gene is connected with PH124 plasmid vector, transforms:
The double digestion of S41, chlamydomonas expression vector PH124 plasmid, carry out double digestion with Nhe1 and Pmac1 a pair restriction enzyme to PH124 expression vector and obtain the digestion products that one end is Nhe1 sticky end, one end is flat end, reaction system is as follows:
37 DEG C be incubated overnight after, digestion products direct purification reclaim.
The double digestion of S42, recombinant type SelK gene, carries out double digestion with Nhe1 and Pmac1 a pair restriction enzyme to recombinant type SelK gene fragment, and obtain the digestion products that one end is Nhe1 sticky end, one end is flat end, reaction system is as follows:
37 DEG C be incubated overnight after, digestion products carries out purifying after agarose gel electrophoresis and reclaims.
S43, the PH124 plasmid vector after being cut by enzyme is connected with recombinant type SelK gene fragment T4DNA ligase enzyme, and reaction system is as follows:
Mix rear 16 DEG C of connections to spend the night.
S50, in order to verify and screen the successful recombinant type SelK gene of restructuring and Chlamydomonas reinhardtii PH124 plasmid vector product, adopts following steps to carry out checking screening:
S51, preparation intestinal bacteria (E.coli DH5 α) competent cell, respectively gets 10 μ L connection products and is added in 50 μ L competent escherichia coli cell E.coli DH5 α, mix gently; Mixed solution being placed in PCR instrument conditional is 4 DEG C, 10min; 42 DEG C, heat shock 90sec; 4 DEG C, 5min.Add 50 μ LLB liquid nutrient medium mixings, shaking table 37 DEG C, 220rpm cultivates 40min; Then bacterium liquid full coat is distributed on the LB solid medium containing AMP+ resistance, is inverted overnight incubation for 37 DEG C;
S52, above-mentioned LB screens the mono-clonal bacterium colony of picking in flat board, after in 10mL is containing the liquid nutrient medium of 100 μ g/mL penbritins, shaking culture is spent the night, get the bacterium liquid collected by centrifugation thalline of 3ml, the E.Z.N.A.TMPlasmid Mini Kit I test kit then pressing OMEGA illustrates and extracts plasmid DNA.
S53, with the plasmid extracted for template, sets up PCR reaction system with the upstream and downstream primer (F1, Rw) of object fragment (recombinant type SelK), amplification object fragment, and carry out screening positive clone, reaction system is as follows:
PCR reaction conditions is 94 DEG C of denaturation 5min; 94 DEG C, 30sec; 42 DEG C, 30sec; 72 DEG C, 40sec; 20cycle, 72 DEG C extend 7min, get 5 μ LPCR amplified productions and carry out agarose gel electrophoresis, check object band; Wherein the result of this electrophoretic band as shown in Figure 7, and in Fig. 7, band M is DL2000 standard molecular weight, and band 1 and band 2 are the amplified production contrast repeated.
S54, carries out double digestion reaction with the restriction enzyme site that object fragment upstream and downstream is introduced to plasmid amplified production:
The digestion products of each group is got respectively 10 μ L and carry out agarose gel electrophoresis, imaging, whether have object band.Enzyme cuts qualification positive colony electrophorogram as shown in Figure 8, and band M is DL2000 standard molecular weight, and band 1 and band 2 are the digestion products repeated.
S55, gene sequencing: be that positive recon plasmid is served Hai Shenggong and checked order by cutting through enzyme with PCR the result; By the online comparison of sequencing result NCBI Blast, differentiate that whether the sequence of the gene fragment inserted in recombinant plasmid is correct, the plasmid that screening sequence is correct.
Order-checking the base sequence obtained the results are shown in following table:
Simultaneously by the result of the online comparison of base sequence result NCBI Blast of order-checking, the ORF comparison result of people SelK as shown in Figure 9, the SEICS sequence alignment result of chlamydomonas SelW1 as shown in Figure 10; The result of comparison is consistent, and it shows that the result of the correct recombinant products obtained according to the step of above-mentioned checking of the present invention and screening is accurate.
Successful recombinant products: the PH124-ORFhselk-SECISchselw1 that above-mentioned checking recombinated is directed in Chlamydomonas reinhardtii and carries out genetic transformation:
S100, utilizing Not1 to limit endonuclease digestion object plasmid PH124-ORFhselk-SECISchselw1 to improve transformation efficiency, obtaining linearization plasmid before conversion, and it is as follows that enzyme cuts treating processes;
After 37 DEG C of water-bath 6h, purifying recovery is carried out to digestion products.
S200, the Chlamydomonas reinhardtii genetic transformation of granulated glass sphere mediation: picking Chlamydomonas reinhardtii is inoculated in the TAP liquid nutrient medium of sterilizing from culture plate, control condition is Light To Dark Ratio 16h/8h, intensity of illumination 6000lx, is cultured to mid log phase (about 1-2 × 10 at 25 DEG C
6cells/mL) carry out genetic transformation, the genetic transformation of Chlamydomonas reinhardtii CC-849 adopts pearl mill method, and concrete steps are as follows:
S210, Chlamydomonas reinhardtii CC-849 is cultured to logarithmic phase in TAP nutrient solution, room temperature collected by centrifugation, resuspended, adjustment cell concn to 2 × 108cells/mL.
S220, draws 300 μ L suspension and (includes sterilized diameter 0.5mm granulated glass sphere) in the EP pipe of 1.5mL, gets 2 μ g-5 μ g linearizing object plasmids and adds test tube, CC-849/ granulated glass sphere/foreign DNA mixture quick oscillation 15 seconds.
S230, (include in the TAP solution 20mL of sterilizing, the full temperature vibration incubator overnight being 6000lx in 60rpm light intensity cultivates (about 20-25h) mixed solution to be transferred to the centrifuge tube of the band screw cap of 50mL.
S240, room temperature centrifugal collecting cell, remove supernatant, resuspended with 0.5mL TAP, add the TAP substratum of 3.5mL containing 0.5% agar, be poured on rapidly after mixing (Zeocin containing 10 μ g/mL) on TAP flat board, in illumination box, in 25 DEG C of illumination cultivation 3-4 weeks, flat board grows green mono-clonal algae and falls.
S300, picking mono-clonal transgenic alga and wild-type chlamydomonas are inoculated in the TAP nutrient solution of 200mL sterilizing, are placed in illumination box and cultivate; Na is added when being in mid log phase
2seO
3final concentration is 10 μm of ol/L, is put in incubator and continues overnight incubation after mixing; Under illumination, 100rpm 42 DEG C of heat shock 20min, put back to incubator and continue to cultivate about 5h, centrifugal collecting cell.
S400, the expression identification of SelK in transgene Chlamydomonas reinhardtii;
S410, the extraction of Chlamydomonas reinhardtii total protein: the cell collected is added cold acetone 20mL re-suspended cell respectively, is placed in the pigment of-20 DEG C of refrigerator overnight extraction cells; 4 DEG C, the centrifugal 10min of 8000rpm, abandons supernatant to remove pigment, then washes twice to remove pigment remnants with cold acetone, and standing for some time makes fully to vapor away acetone remnants on ice; Add 1mL cell pyrolysis liquid suspension cell respectively, after ultrasonication 5min, 4 DEG C of centrifugal 15min of 12000rpm collect supernatant and are total protein extracting solution;
S420, immunoblotting analysis: get appropriate protein sample after the SDS-PAGE electrophoresis of 12% polyacrylamide, 100V constant voltage wets transferring film 1h, 5% skim-milk room temperature closes 2h, SelK (1:600) primary antibodie 4 DEG C of overnight incubation, anti-incubated at room 1h, the ECL colour developing of goat-anti rabbit/mouse (1:3000) two.As shown in figure 11,1-4 road is for turning ORF-SECISchselw1 gene chlamydomonas successful expression people SelK, and compare the people HEK293 cell that 5-7 road is positive control, in transgenosis chlamydomonas, SelK obtains high expression for the result of immune-blotting method.
The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any amendments done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.
Claims (10)
1. a construction process for Chlamydomonas reinhardtii SelK expression vector, is characterized in that, comprises the steps:
The ORF gene fragment of amplification people SelK, obtains ORF gene amplification product;
The SECIS gene fragment of amplification Chlamydomonas reinhardtii SelW1, obtains SECIS gene amplification product;
Described ORF gene amplification product and SECIS gene amplification product are recombinated, obtains recombinant type SelK gene;
By the plasmid vector that described recombinant type SelK channel genes can be expressed in Chlamydomonas reinhardtii, form recombinant plasmid product.
2. the construction process of Chlamydomonas reinhardtii SelK expression vector as claimed in claim 1, it is characterized in that, in the ORF gene fragment step of described amplification people SelK, the primer of employing is have the upstream primer F1 of sequence table SEQ .ID.No.1 base sequence and have the downstream primer R1 of sequence table SEQ .ID.No.2 base sequence;
In the SECIS gene fragment step of described amplification Chlamydomonas reinhardtii SelW1, the primer of employing is have the upstream primer FW of sequence table SEQ .ID.No.3 base sequence and have the downstream primer RW of sequence table SEQ .ID.No.4 base sequence;
Described ORF gene amplification product and SECIS gene amplification product are carried out reconstitution steps is, is template with described ORF gene amplification product and SECIS gene amplification product, carries out over-lap PCR using described upstream primer F1 and downstream primer RW as primer pair.
3. the construction process of Chlamydomonas reinhardtii SelK expression vector as claimed in claim 2, it is characterized in that, by the plasmid vector step that described recombinant type SelK channel genes can be expressed in Chlamydomonas reinhardtii be, after adopting Nhe1 enzyme and Pmac1 enzyme to carry out double digestion described recombinant type SelK gene and the plasmid vector can expressed in Chlamydomonas reinhardtii respectively, then carry out splicing restructuring with DNA ligase;
Wherein, the described plasmid vector can expressed in Chlamydomonas reinhardtii has the double enzyme site of Nhe1 enzyme and Pmac1 enzyme.
4. the construction process of the Chlamydomonas reinhardtii SelK expression vector as described in any one of claims 1 to 3, is characterized in that, the described plasmid vector can expressed in Chlamydomonas reinhardtii is Chlamydomonas reinhardtii PH124 plasmid.
5. the construction process of the Chlamydomonas reinhardtii SelK expression vector as described in any one of claims 1 to 3, it is characterized in that, by the plasmid vector that described recombinant type SelK channel genes can be expressed in Chlamydomonas reinhardtii, after forming recombinant plasmid product step, also comprise and positive selection step carried out to restructuring plasmid product:
Described recombinant plasmid product is imported in intestinal bacteria, and imports successful intestinal bacteria with the LB Screening of Media containing AMP resistance;
After the described intestinal bacteria filtered out are cultivated in the liquid nutrient medium of penbritin, collect thalline and extract the plasmid DNA of thalline;
With the described plasmid DNA extracted for template, increase with upstream primers F 1 and downstream primer Rw, electrophoresis checking amplified production.
6. the construction process of Chlamydomonas reinhardtii SelK expression vector as claimed in claim 5, is characterized in that, also comprises after described electrophoresis checking amplified production step:
After the amplified production Nhe1 enzyme of described plasmid DNA and Pmac1 enzyme are carried out double digestion, electrophoresis checking double digestion product.
7. the construction process of the Chlamydomonas reinhardtii SelK expression vector as described in any one of claims 1 to 3, it is characterized in that, by the plasmid vector that described recombinant type SelK channel genes can be expressed in Chlamydomonas reinhardtii, after forming recombinant plasmid product step, also comprise and positive selection step carried out to restructuring plasmid product:
Described recombinant plasmid product is checked order, and by sequencing result and the standard sequence comparison of correctly recombinating.
8. the Chlamydomonas reinhardtii SelK expression vector for preparing of the construction process of the Chlamydomonas reinhardtii SelK expression vector according to any one of claim 1 to 7.
9. an expression method for Chlamydomonas reinhardtii SelK expression vector according to claim 8, is characterized in that, comprise the steps:
The mode mediate Chlamydomonas reinhardtii SelK expression vector granulated glass sphere and chlamydonomas reinhardtii cells transform, and are formed and transform state Chlamydomonas reinhardtii;
Conversion state Chlamydomonas reinhardtii is carried out fermentation culture, and expresses with Se compound induction SelK during the fermentation.
10. the expression method of Chlamydomonas reinhardtii SelK expression vector as claimed in claim 9, it is characterized in that, before the mode of described Chlamydomonas reinhardtii SelK expression vector granulated glass sphere mediation and chlamydonomas reinhardtii cells are carried out the step transformed, also comprise the step of with Not1 restriction restriction endonuclease, described Chlamydomonas reinhardtii SelK expression vector being carried out to linearization process;
And/or described Se compound is Na
2seO
3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410675873.2A CN104561078A (en) | 2014-11-21 | 2014-11-21 | Chlamydomonas reinhardtii Se1K expression vector as well as construction method and expression method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410675873.2A CN104561078A (en) | 2014-11-21 | 2014-11-21 | Chlamydomonas reinhardtii Se1K expression vector as well as construction method and expression method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104561078A true CN104561078A (en) | 2015-04-29 |
Family
ID=53078156
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410675873.2A Pending CN104561078A (en) | 2014-11-21 | 2014-11-21 | Chlamydomonas reinhardtii Se1K expression vector as well as construction method and expression method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104561078A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086033A (en) * | 2016-06-15 | 2016-11-09 | 山东大学 | Semen Maydis class selenium protein 15kD gene ZmSep15 like application in improving the anti-salt of plant and drought resisting |
| CN112029799A (en) * | 2020-09-11 | 2020-12-04 | 江南大学 | GPI (general purpose protein) anchoring protein expression system containing selenocysteine and cell for highly expressing recombinant protein |
| CN113214370A (en) * | 2021-02-07 | 2021-08-06 | 武汉大学 | Preparation method of single selenoprotein of saccharomyces cerevisiae |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007002163A2 (en) * | 2005-06-21 | 2007-01-04 | Ohio State University | Production of recombinant selenoprotein mutants with enhanced catalytic activity |
| CN103233033A (en) * | 2013-04-16 | 2013-08-07 | 浙江师范大学 | Cell line GpSEGFP4 for effective selenium biological detection, and construction method thereof |
-
2014
- 2014-11-21 CN CN201410675873.2A patent/CN104561078A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007002163A2 (en) * | 2005-06-21 | 2007-01-04 | Ohio State University | Production of recombinant selenoprotein mutants with enhanced catalytic activity |
| CN103233033A (en) * | 2013-04-16 | 2013-08-07 | 浙江师范大学 | Cell line GpSEGFP4 for effective selenium biological detection, and construction method thereof |
Non-Patent Citations (2)
| Title |
|---|
| HOU QINTANG等: "Selenoprotein-Transgenic Chlamydomonas reinhardtii", 《NUTRIENT》 * |
| 朱延明 主编: "《植物生物技术》", 31 August 2009 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086033A (en) * | 2016-06-15 | 2016-11-09 | 山东大学 | Semen Maydis class selenium protein 15kD gene ZmSep15 like application in improving the anti-salt of plant and drought resisting |
| CN106086033B (en) * | 2016-06-15 | 2019-05-14 | 山东大学 | Corn class selenoprotein 15kD gene ZmSep15-like is improving the application in plant salt resistance and drought resisting |
| CN112029799A (en) * | 2020-09-11 | 2020-12-04 | 江南大学 | GPI (general purpose protein) anchoring protein expression system containing selenocysteine and cell for highly expressing recombinant protein |
| CN113214370A (en) * | 2021-02-07 | 2021-08-06 | 武汉大学 | Preparation method of single selenoprotein of saccharomyces cerevisiae |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106566838B (en) | A kind of miR-126 full-length gene knockout kit and its application based on CRISPR-Cas9 technology | |
| CN108342480A (en) | A kind of genetic mutation detection Quality Control object and preparation method thereof | |
| CN107828738A (en) | A kind of dnmt rna deficiency Chinese hamster ovary celI system and preparation method and application | |
| CN108624622A (en) | A kind of genetically engineered cell strain that can secrete mouse interleukin -6 based on CRISPR-Cas9 systems structure | |
| CN107532177A (en) | Adeno-associated virus variant and its application method | |
| CN105821116A (en) | Directional knockout on sheep MSTN gene and detection method for influence thereof on myogenic differentiation | |
| CN109266656B (en) | Construction method and application of PD1 humanized BALB/c mouse model | |
| CN107523588B (en) | Tetracycline lentivirus induced expression vector and establishment method and application thereof | |
| CN110305908B (en) | Efficient and accurate targeted gene integration system and application thereof | |
| CN103834686B (en) | High-efficient cloning screening expression vector, Preparation Method And The Use | |
| CN104561078A (en) | Chlamydomonas reinhardtii Se1K expression vector as well as construction method and expression method thereof | |
| CN107893073A (en) | A kind of method for screening glutamine synthelase deficiency HEK293 cell lines | |
| CN109486814A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN103173447A (en) | Novel beta-actin and rps21 promoters and uses thereof | |
| CN110438128A (en) | Utilize the method for CRISPR/Cas9 system knock-out pig CCAR1 gene | |
| CN110358735A (en) | A kind of preparation method and application of CTL cell | |
| CN113913425B (en) | sgRNA combination of targeted AHRR gene and application thereof | |
| CN109837301A (en) | Humanization helicobacter pylori cagA construction of eukaryotic expression vector method | |
| CN112899238A (en) | Based on RNA-m6A modification level compound screening cell model and construction and application thereof | |
| CN108559727A (en) | A method of promoting goat follicular cell proliferation | |
| CN111621854A (en) | Trc promoter mutation library and application thereof | |
| CN112251463A (en) | Construction method of CD73 humanized mouse model | |
| US9540653B2 (en) | Light-inducible promoter and gene expression system containing same | |
| CN109536494A (en) | A kind of gRNA for repairing HBB1 point mutation, gene editing system, expression vector and gene editing kit | |
| CN113881678A (en) | C/EBPZ gene promoter and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150429 |