CN104561075A - Bacillus licheniformis for recombinant expression of glutamate-specific endopeptidase and construction method of bacillus licheniformis - Google Patents

Abstract

The invention discloses bacillus licheniformis for recombinant expression of glutamate-specific endopeptidase (GSE) and a construction method of bacillus licheniformis. The construction method comprises the following steps of firstly and respectively linking a p43 promoter and a terminator on glutamate-specific endopeptidase endopeptidase gene from 5' terminal and 3' terminal, inserting the sequence into EcoRI and HindIII enzyme digestion sites of a cloning vector pHY300PLK and then transforming into bacillus licheniformis to obtain bacillus licheniformis for recombinant expression of glutamate-specific endopeptidase. The construction method is applicable to the cloning vector pHY300PLK of bacillus licheniformis, the p43 promoter and the terminator are introduced into the cloning vector pHY300PLK so that the expression of glutamate-specific endopeptidase from bacillus licheniformis (GSE-BL) is facilitated, the soluble expression of GSE-BL is achieved and the construction method provides a novel strategy for preparation of GSE-BL and the research on the structure and enzymatic property of GSE-BL and thus the wide application of GSE-BL in protein sequence and conformational analysis, polypeptide synthesis and recovery of biologically active peptides is promoted.

Description

A kind of Bacillus licheniformis of recombinant expressed glutamate specific endopeptidase and construction process thereof

Technical field:

The invention belongs to biological chemistry and biology field, be specifically related to a kind of Bacillus licheniformis and construction process thereof of recombinant expressed glutamate specific endopeptidase.

Background technology:

Bacillus licheniformis glutamate specific endopeptidase (GSE-BL) is a kind of class Quimotrase that can identify the α-carboxyl of L-glutamic acid or asparagicacid residue specifically, it for glutaminic acid residue form peptide bond cutting efficiency be asparagicacid residue form the 100-1000 of peptide bond cutting efficiency doubly.Because its specific recognition ability for L-glutamic acid and aspartic acid has a wide range of applications in the recovery etc. of protein sequence and conformational analysis, Peptide systhesis and biologically active peptides.(the Ib Svendsen such as Svendsen, Klaus Breddam.Isolation and amino acid sequence of a glutamic acid specific endopeptidase from Bacillus licheniformis.European Journal of Biochemistry, 1992, 204 (1): 165-171) from a kind of commercial alkaline protease A lcalase (extracting from Bacillus licheniformis ATCC14580 fermented liquid), weak cation exchange chromatography is passed through, the method of affinity chromatography obtains purer Bacillus licheniformis glutamate specific proteolytic enzyme (GSE-BL), its output is 8.24mg/L.But this method steps is more loaded down with trivial details, and technique is more complicated, productive rate is also lower.Also Many researchers is had to attempt GSE-BL to carry out heterogenous expression in subtilis and intestinal bacteria.GSE-BL expresses with the form of inclusion body in intestinal bacteria, through urea-denatured, and affinitive layer purification and gradient urea renaturation, obtain activated GSE-BL, but this processing step is comparatively loaded down with trivial details, also need to add the relatively costly thioisopropyl galactoside of price, be unfavorable for that industry is amplified.

Summary of the invention:

The object of this invention is to provide a kind of Bacillus licheniformis and the construction process thereof that can realize the recombinant expressed glutamate specific endopeptidase of Bacillus licheniformis glutamate specific endopeptidase solubility expression.

The Bacillus licheniformis of recombinant expressed glutamate specific endopeptidase of the present invention, build by the following method: first connect p43 promotor at 5 ' end of glutamate specific endopeptidase gene, terminator is connected at 3 ' end, again by among EcoRI and the HindIII restriction enzyme site of this sequence insertion pHY300pLK cloning vector, then be transformed in Bacillus licheniformis, obtain the Bacillus licheniformis of recombinant expressed glutamate specific endopeptidase;

The nucleotide sequence of described glutamate specific endopeptidase gene is as shown in SEQ ID NO.2;

The nucleotide sequence of described p43 promotor is as shown in SEQ ID NO.3;

The nucleotide sequence of described terminator is as shown in SEQ ID NO.4.

Described Bacillus licheniformis is preferably Bacillus licheniformis ATCC14580.

Preferably, after the initiator codon of glutamate specific endopeptidase gene and/or add histidine-tagged before terminator codon, be histidine-taggedly convenient to purifying.

At present, the research report about Bacillus licheniformis expression system is fewer, and Bacillus licheniformis is a kind of gram-positive microorganism of generally acknowledged safety non-toxic, and the nutritional requirement of Bacillus licheniformis is simple, and growth rapidly.Therefore the recombinant expression system setting up Bacillus licheniformis has more important realistic meaning.Therefore the present invention selects the cloning vector PHY300PLK being applicable to Bacillus licheniformis, and introduce P43 promotor and terminator wherein so that the expression of GSE-BL, realize Bacillus licheniformis glutamate specific endopeptidase solubility expression, for Bacillus licheniformis glutamate specific endopeptidase preparation, study its structure and zymologic property provides new strategy, thus promote the widespread use of GSE-BL in the recovery of protein sequence and conformational analysis, Peptide systhesis and biologically active peptides.In addition, GSE-BL is secreted by Bacillus licheniformis, by the recombinant expressed optimization that can realize protease structure in Bacillus licheniformis, is conducive to obtaining activated proteolytic enzyme.

Accompanying drawing illustrates:

Fig. 1 is the double digestion qualification figure of PHY300PLK-GSE-BL; Wherein M is DL5000Marker; 1.pHY300PLK carrier, the double digestion product of 2.PHY300PLK-GSE-BL, wherein 1200bp position is that P43 promotor adds GSE-BL;

Fig. 2 is the sequencing result of PHY300PLK-GSE-BL positive colony;

Fig. 3 is that SDS-PAGE and the Western blot after PHY300PLK-GSE-BL expression product (GSE-BL albumen) purifying identifies figure: Fig. 3 A is SDS-PAGE qualification figure; Fig. 3 B is Western blot qualification figure, and wherein wild mushroom represents Bacillus licheniformis ATCC14580, and recombinant bacterium represents the Bacillus licheniformis ATCC14580 containing recombinant plasmid PHY300PLK-GSE-BL.

embodiment:

Following examples further illustrate of the present invention, instead of limitation of the present invention.

The structure of the recombinant plasmid of embodiment 1:PHY300PLK-GSE-BL:

One, the acquisition of recombinant plasmid pBEP43-vgb.

1. design primer:

Upstream primer: ACGCGTCGACATGTTAGACCAGCAAACCAT

Downstream primer: CGCGGATCCTTCAACCGCTTGAGCGTAC

2. with Vitreoscilla genome for template, obtain by the amplification of as above primer PCR the vgb gene (its nucleotide sequence is as shown in SEQ ID NO.1) being with restriction enzyme site, with SalI and BamHI in 37 DEG C of process 2h.By pBEP43 carrier SalI and BamHI in 37 DEG C of process 2h, reclaim digestion products.Two digestion products are connected 5h in 22 DEG C, transforms DH5 α competent cell, picked clones enlarged culturing, with penbritin and kantlex screening, bacterium liquid PCR screening positive clone, order-checking qualification.Namely gained positive colony is that vgb gene is inserted pBEP43 carrier, and then conversion enters in DH5 α cell, the recombinant vectors called after of gained: recombinant plasmid pBEP43-vgb (being inserted in pBEP43 carrier by vgb gene).

Two, recombinant plasmid pET22b-GSE-BL

The upstream and downstream primer of design GSE-BL:

Upstream primer GGAATTC cATATGcACCCGGCCCAAGCC

Downstream primer GCC cTCGAGtTGTGCGCTGTTTTTCCAGTTGG

With Bacillus licheniformis genome for template, carry out with as above primer the GSE-BL gene (its nucleotide sequence is as shown in SEQ ID NO.2) that pcr amplification obtains containing NdeI and XhoI restriction enzyme site, gained PCR primer NdeI and XhoI enzyme are cut.PET22b vector plasmid NdeI and XhoI enzyme are cut, in 37 DEG C of process 2h, reclaims digestion products.Two digestion products are connected 5h in 22 DEG C, transforms DH5 α competent cell, picked clones enlarged culturing, with penbritin screening, bacterium liquid PCR screening positive clone, order-checking qualification.Namely gained positive colony is that GSE-BL gene is inserted pET22b carrier, and then conversion enters in DH5 α cell, the recombinant vectors called after of gained: recombinant plasmid pET22b-GSE-BL (being inserted in pET22b carrier by GSE-BL gene).

Three, the structure of the recombinant plasmid of PHY300PLK-GSE-BL

(1) bacillus coli DH 5 alpha of inoculation containing pBEP43-vgb recombinant plasmid, extracts plasmid pBEP43-vgb, cuts 2h with SalI and BamHI in 37 DEG C of enzymes, cuts the fragment (pBEP43-vgb fragment) that glue reclaims about 7.9kb;

(2) with recombinant plasmid pET22b-GSE-BL for template, with GSE-BL upstream and downstream primer (F:5 '-acgcgtcgacatgcacccggcccaagccgcgcc-3 '; R:5 '-acgcggatccttagtggtggtggtggtggtgttgtgcgctgtttttccag-3 ') increase, hold introducing histidine-tagged at its C.

Its reaction system is as follows:

Pcr amplification program is as follows:

Cut the fragment that glue reclaims about 900bp, adopt SalI and BamHI to cut 5h in 37 DEG C of enzymes, adopt the DNA product of sky root to reclaim test kit and reclaim product (GSE-BL fragment).

PBEP43-vgb with the GSE-BL fragment of gained after SalI with BamHI double digestion is connected 5h in 22 DEG C, connect product conversion to DH5 α competent cell, picked clones, with primer (F:5 '-acgcgtcgacatgcacccggcccaagccgcgcc-3 '; R:5 '-a cgcggatccttagtggtggtggtggtggtgttgtgcgctgtttttccag-3 ') screening positive clone, extract plasmid pBEP43-GSE-BL (being inserted in carrier pBEP43 by GSE-BL gene), EcoRI and HindIII is adopted to carry out double digestion to it, reclaim small segment (the GSE-BL fragment of about 1100bp, it comprises the histidine-tagged of C end, GSE-BL gene, p43 promotor (its nucleotide sequence is as shown in SEQ ID NO.3), and terminator (its nucleotide sequence is as shown in SEQ ID NO.4).Adopt EcoRI and HindIII to carry out double digestion to plasmid PHY300PLK, DNA product reclaims test kit and reclaims product.PHY300PLK fragment through double digestion is connected 5h with GSE-BL fragment in 22 DEG C, product conversion will be connected in bacillus coli DH 5 alpha, screening positive clone.Picked clones, extracts plasmid pHY300PLK-GSE-BL (GSE-BL fragment is inserted in carrier PHY300PLK) and carries out the qualification of EcoRI and HindIII double digestion, as shown in Figure 1, can obtain two fragments of about 5kb and 1.2kb after double digestion.Gained positive colony is delivered to order-checking company and carry out order-checking confirmation.

Embodiment 2:PHY300PLK-GSE-BL electricity is converted into Bacillus licheniformis ATCC14580, comprises following steps:

(1) the competent preparation of Bacillus licheniformis ATCC14580:

By 30ml Bacillus licheniformis ATCC14580, (this bacterial strain is preserved in American Type Culture Collecti (ATCC), its deposit number is: ATCC14580, anyone can buy this bacterial strain from this preservation center) to be cultured to OD600nm be about 0.8 to bacterium liquid, 4 DEG C, 6000rpm frozen centrifugation, ice-cold EP buffer solution cell 2 times, 4 DEG C, 6000rpm frozen centrifugation, with 1ml EP damping fluid suspension cell ,-80 DEG C of preservations.

(2) electricity of recombinant plasmid transforms:

By recombinant plasmid PHY300PLK-GSE-BL with Bacillus licheniformis ATCC 14580 competent cell in mixing 5min on ice, be transferred to ice precooling 2mm electricity revolving cup in, with the conversion condition of 1800V, 5.0ms carry out electricity conversion.Electricity adds 1ml recovery medium after turning end immediately, renewal cultivation 4h at 30 DEG C, be applied on the LB flat board containing 100 μ g/mL penbritins, picked clones enlarged culturing, bacterium liquid PCR and order-checking qualification, determine positive colony, the comparison in ncbi database of its sequencing result is learnt, this fragment is GSE-BL gene (GenBank accession:D10060) (Fig. 2).

SDS-PAGE and the Western blot of embodiment 3:GSE-BL identifies, comprises following steps:

(1) be seeded in LB substratum by the restructuring Bacillus licheniformis ATCC14580 containing plasmid PHY300PLK-GSE-BL, cultivate 48h in 30 DEG C, collect thalline, carry out ultrasonication under the condition of 100W, centrifugal 10 minutes of 8000rpm, retains its supernatant.

(2) gained supernatant loading is to Ni affinity column, adopts the Tris-HCl damping fluid containing different concns imidazoles to carry out wash-out.As shown in Figure 3A, the molecular weight of the restructuring GSE-BL (glutamate specific endopeptidase) expressed in Bacillus licheniformis ATCC14580 is about 36kD, consistent with the molecular weight of prediction, GSE-BL is the highest at 55mM imidazole elution moderate purity, reach 93.8%, its output is 26.25mg/L.

(3) break the supernatant after bacterium for contrast with the wild ATCC14580 not importing recombinant plasmid, carry out Western blot qualification in the lump with the restructuring ATCC14580 importing PHY300PLK-GSE-BL.After SDS-PAGE, transferring film is to NC film, transferring film 40min under 100V constant-pressure conditions, the closed 2.5h of 5% skim-milk 37 DEG C, the Anti-His monoclonal antibody (Abcam brand) of mouse source coupling HRP is adopted to be incubated overnight with 1:1500 extent of dilution 4 DEG C, TBST washs 3 times, each 15min, adds substrate and luminescent solution exposes in darkroom.Result as shown in Figure 3 B, only has the restructuring Bacillus licheniformis ATCC14580 containing plasmid PHY300PLK-GSE-BL can produce GSE-BL albumen.

(4) not contain the 55mM imidazole elution of GSE-BL as blank, take Z-Phe-Leu-Glu-pNA as substrate, measure the enzyme activity of the 55mM imidazole elution containing GSE-BL, final calculating learns that its enzyme activity is 458.6.2U/mg.

Claims (4)

1. the construction process of the Bacillus licheniformis of a recombinant expressed glutamate specific endopeptidase, it is characterized in that, first p43 promotor is connected at 5 ' end of glutamate specific endopeptidase gene, terminator is connected at 3 ' end, again by among EcoRI and the HindIII restriction enzyme site of this sequence insertion pHY300pLK cloning vector, then be transformed in Bacillus licheniformis, obtain the Bacillus licheniformis of recombinant expressed glutamate specific endopeptidase;

The nucleotide sequence of described glutamate specific endopeptidase gene is as shown in SEQ ID NO.2;

The nucleotide sequence of described p43 promotor is as shown in SEQ ID NO.3;

The nucleotide sequence of described terminator is as shown in SEQ ID NO.4.

2. construction process according to claim 1, is characterized in that, described Bacillus licheniformis is Bacillus licheniformis ATCC14580.

3. construction process according to claim 1, is characterized in that, after the initiator codon of glutamate specific endopeptidase gene and/or add histidine-tagged before terminator codon.

4. one kind builds the Bacillus licheniformis of the recombinant expressed glutamate specific endopeptidase obtained according to the construction process described in claim 1,2 or 3.