CN104498558B - A kind of method that utilization microorganism prepares Sophoridine - Google Patents
A kind of method that utilization microorganism prepares Sophoridine Download PDFInfo
- Publication number
- CN104498558B CN104498558B CN201510019812.5A CN201510019812A CN104498558B CN 104498558 B CN104498558 B CN 104498558B CN 201510019812 A CN201510019812 A CN 201510019812A CN 104498558 B CN104498558 B CN 104498558B
- Authority
- CN
- China
- Prior art keywords
- sophoridine
- microorganism
- method described
- microorganism fungus
- fungus kind
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
A kind of method that utilization microorganism prepares Sophoridine, the microorganism fungus kind title：Escherichia coli, depositary institution：China typical culture collection center, address：In Wuhan University, preservation day：On December 24th, 2014, deposit number：CCTCC NO：2014659；The method for preparing Sophoridine by sophoridine oxide using the microorganism fungus kind.Raw material and catalyst that this method is used are cheap, be easy to get, and reaction condition is gentle, easily-controllable, environment-friendly, pollution-free, and the development of Green Chemistry and sustainable development chemistry can be met well, and its modern environment is protected and low-carbon economy demand.
Description
Technical field
It the present invention relates to the use of the method that microorganism prepares cancer therapy drug Sophoridine.
Background technology
Sophoridine (Sophoridine) and its preparation hydrochloric acid Sophoridine parenteral solution (Sophoridine Hydroehloride
Injection) in the State Food and Drug Administrations of in 8Yue22Huo, 2005 (SFDA) New Drug Certificate (traditional Chinese medicines for issuing
Demonstrate,prove word H20O51131,30) and the approval number of the drug (Chinese medicines quasi-word H20051682,81), it is that China develops, possesses independent intellectual
One class PTS of property right country.
The traditional preparation methods of Sophoridine are extracted from plant Sophora alopecuroide, and Sophora alopecuroide is cassia leguminous plant, main point
Desert, the Semi-desert Area of north of China are distributed in, is important resources of medicinal plant and the natural vegetation composition portion in Ningxia and Xinjiang
Point.Due to its higher medical value and ecological functions, the Reasonable Protection of Sophora alopecuroide resource increasingly causes people with developing
Attention, Sophora alopecuroide is included in one of six big authentic medicinal herbses of focused protection, reasonable development and profit by Ningxia Hui Autonomous Region
More it is particularly important with its wild resource.Therefore, it is necessary to develop the novel processing step of Sophoridine.
Microorganism conversion reaction because mild condition, regioselectivity and the advantages of stereoselectivity is strong, accessory substance is few and
Focus as current research.In addition, microorganism fast growth, the cycle is short, can avoid because condition acutely produce need not
The side reaction wanted and accessory substance, meet the development need of present Green Chemistry and sustainable development chemistry.And microorganism catalysis is anti-
Should in it is most important be exactly microbial strains as catalyst.Soil is the best place of microorganism life.Soil has
Various conditions required for microorganism growth.First, there is abundant organic matter in soil, carbon source, nitrogen source can be provided for microorganism
And energy；Also there is abundant inorganic mineral simultaneously, mineral nutriment is provided for the growth of microorganism.The good retentiveness of soil,
It ensure that the moisture required for microbial growth.The porous of soil has stored many air, can meet aerobic micro- life
The demand of thing.In addition, the acid-base value of soil is close to neutrality, osmotic pressure is between 3~6 atmospheric pressure, with microbial growth institute
It is required that it is similar.In soil, temperature is stablized relatively.These, can meet the requirement of microbial growth.Thus soil is true
On be " the natural culture medium of microorganism ".Most species of microorganism herein, quantity is also maximum.
The content of the invention
The present invention is to provide for a kind of method that utilization microorganism prepares cancer therapy drug Sophoridine, microbial strains name
Claim：Escherichia coli, depositary institution：China typical culture collection center, address：In Wuhan University, preservation day：
On December 24th, 2014, deposit number：CCTCC NO：M 2014659.
For reach above-mentioned purpose use technical scheme be：
The strain concentration and separation culture medium that the present invention is used is：Peptone（peptone）：5-15g, yeast extract（yeast
extract）：2-10g, sodium chloride（NaCl）：5-20g, 1000mL, pH are supplied with ordinary tap water：Natural ph.From Guizhou Province
Soil is source separation edaphon before the dormitory of Zunyi Medical College three and after school at mountain two, and obtaining one plant has catalysis oxygen
Change the bacterial strain that Sophoridine generates Sophoridine ability, strain name：Escherichia coli, depositary institution：Chinese Typical Representative culture
Thing collection, address：In Wuhan University, preservation day：On December 24th, 2014, deposit number：CCTCC NO：M 2014659.
The method for preparing cancer therapy drug Sophoridine by sophoridine oxide using the microorganism, compared with prior art, this hair
Bright preparation method advantage is：（1）It is raw material from natural products sophoridine oxide, a step catalytic reaction can synthesize Chinese scholartree and determine
Alkali；（2）Selection microbial enzyme is catalyst, and its essence is protein, with strong regioselectivity and stereoselectivity, is had
The selectivity of height, and enzyme is body constituents in itself, so the condition of catalytic reaction is gentleer, by being not required to
The conditions such as high temperature, high pressure and the special reagent to be chemically reacted；（3）It is environment-friendly because course of reaction without toxic reagent,
Toxic pharmaceuticals, so meeting the production requirement of current Green Chemistry.Summary is described, and the raw material and catalyst that this method is used are just
Preferably, it is easy to get, reaction condition is gentle, easily-controllable, it is environment-friendly, pollution-free, Green Chemistry and sustainable development can be met well
Development, and its to modern environment protection and the demand of low-carbon economy.
Brief description of the drawings
Fig. 1 is the electron micrograph of strain of the present invention；
Fig. 2 is the situation that strain of the present invention is catalyzed generation Sophoridine；
Fig. 3 is the Phylogenetic Analysis of bacterial strain of the present invention；
Fig. 4 is target compound in the present invention13C-NMR；
Fig. 5 is target compound in the present invention1H-NMR。
Embodiment
The present invention is expanded on further with reference to embodiment, but the present invention is not limited to the specific embodiment, this area skill
Art personnel are it should be appreciated that present invention encompasses all possible alternative in right, improvement project and wait
Efficacious prescriptions case.Test material used, is to be bought from routine biochemistry Reagent Company unless otherwise specified in following embodiments
Arrive.
1st, Sophoridine catalyzes and synthesizes the acquisition of bacterial strain.
Cultivate matrix manufacturing：Peptone 10g, yeast extract 5g, sodium chloride 10g, 1000ml pH are supplied with running water：It is natural
PH value, 15 × 150 cuvette cartridge culture medium 6-7 bottled culture medium 40ml of ml, 100ml triangle, 121 DEG C of high-temp steam sterilizings
25min, every liter of culture medium of solid medium adds 20g agar.
The soil before the dormitory of zunyi, guizhou province medical college three and after school at mountain two is chosen, apart from ground 10-20cm, is loaded
Sterilized triangular flask, is placed in 4 DEG C of refrigerators stand-by.
5g pedotheques are weighed in 250ml triangular flasks（Built-in 50ml sterilized waters and bead）In, concussion is mixed
30min.1ml supernatants are measured after static as in 100ml triangular flasks, at 37 DEG C, concussion and cultivate 12 hours under 140rpm is dark,
Substrate oxidation Sophoridine is added, continues to co-culture 2 days under the same conditions, with volume of ethylacetate extraction once, pressurization concentration
By thin-layer chromatography（TLC）Detect conversion results.
TLC conditions：Solvent：Chloroform-methanol=5：1, developer：Iodine and improvement bismuth potassium iodide.
Identify that the pedotheque for there are positive transformants to react carries out concentration gradient dilution through TLC（10-1, 10-2, 10-3, 10-4,
10-5, 10-6, 10-7）And line culture, picking but bacterium colony, line purifying 3 times is carried out, pure culture is obtained.Each pure culture
Thing repeats conversion process with test tube again, screens active bacterial strain.
2nd, the Species estimation analysis of active bacterial strain.
One aspect of the present invention carries out Species estimation analysis by microstructure to active bacterial strain, is contaminated under Electronic Speculum through gram
The color observation cell size of active bacterial strain, shape, cell is into G-, it is shaft-like.
It is the Gram's staining result (10*100) of positive strain such as Fig. 1.
One aspect of the present invention carries out kind by using Protocols in Molecular Biology by 16S rDNA sequence pairs active bacterial strain
Identification and analysis.Technology path is：Genome DNA extraction → 16S rDNA fragment amplifications → sequencing → blast comparative analysis.
Obtained active bacterial strain will be screened and extract genome DNA using phenol/chloroform method for template.Utilize bacterial 16 S
RRNA universal primers 27F/1492R enters performing PCR and expanded, universal primer sequence 27F (5 ＇-
AGAGTTTGATCCTGGCTCAG -3 ＇) and 1492R (＇ of 5 ＇-TACGGCTACCTTGTTACGACTT -3),
PCR reaction conditions are:50 94 DEG C of μ L reaction systems, pre-degeneration 5min;PCR thermocycling programs are 94 DEG C of changes
Property 30 s, 56 DEG C annealing 30 s, 72 DEG C extension 90 s, expand 30 circulation, 72 DEG C of min of overall elongation 5.PCR
Amplified production is detected with 1% agarose gel electrophoresis.16S rRNA PCR amplified productions sequencing is vertical luxuriant and rich with fragrance biological public by Shanghai
Department completes.Sequencing result is compared online with Blast softwares in NCBI databases.Obtain similar from GenBank databases
Property higher typical strain 16S rRNA sequences as reference subject, using the softwares of MEGA 5.0 carry out clustering and
Build NJ phylogenetic trees.
It is the Phylogenetic Analysis of bacterial strain of the present invention such as Fig. 3.
3rd, active bacterial strain catalyzes and synthesizes the application of cancer therapy drug Sophoridine
Substrate oxidation Sophoridine Nanjing ingot peak Pharmaceutical Technology Co., Ltd.Microbial catalystEscherichia coli
CCTCC NO：M 2014659, is isolated from Zunyi Medical College's soil, is now stored in China typical culture collection center.
The amplification fermented and cultured of sophoridine oxide uses two-step fermentation, first by seed culture fluid（250mL culture mediums/
500mL triangular flasks）In 37 DEG C, 140rpm constant-temperature shaking cultures 1~2 day, with 2% inoculum concentration access amplification culture medium 550mL/
In 1000mL and 1350ml/2000mL, culture 1~2 everyday, adds substrate 940mg under similarity condition（Ethanol dissolves）, 3 days
After nutrient solution is extracted with ethyl acetate, evaporated under reduced pressure obtains crude extract 4.04g.
Take column chromatography silica gel（200-300 mesh）, soaked 3 hours with chloroform, post can be filled out by adjusting pH ＞ 7 with diethylamine.Fill post
After the completion of, cylinder is balanced with about 8ml/min flow velocity with selected eluent, it is then that coarse extraction 4.04g is molten with methanol
Solution, by 1：The 2 mass ratio silica gel mixed sample of 200 ~ 300 mesh, uses chloroform：Methanol=（40:1 35:1 30:1 …… 0:1 ）
Stepwise elution, according to TLC detections and sulfuric acid chromogenic reaction and bismuth potassium iodide reaction solution, carries out merging between each cut and dense
Contracting, obtains component C and other components H, I, L, M, E containing targeted transformation product.Through Sephadex LH-20 glucose gels
Column chromatography is purified to targeted transformation product, uses chloroform:Methanol=1:1 elution, flow velocity is about 0.4ml/min, and small test tube is collected
Flow liquid, often pipe about 5ml, an edge point plate analysis are while elution.Detection and the sour chromogenic reaction of stream are analyzed according to TLC and bismuth potassium iodide is anti-
Should be developed the color progress identical point merging and concentration.Tetra- components of J, A, D, K are obtained, wherein component A contains targeted transformation product, right
Targeted transformation product A is further using silica gel column chromatography and Sephadex LH-20 glucose gels column chromatographies repeatedly and again
The method of crystallization isolate and purify obtaining targeted transformation product（96.8mg）, section is learned to do by physicochemical property and Modern spectroscopy
（1H-NMR、13C-NMR）Identify the structure of converted product.It is that TCL methods detection bacterial strain catalyzes and synthesizes Sophoridine such as Fig. 2（ H：
Sophoridine, YH：Sophoridine oxide）.
White needles（Methanol）.1H-NMR（CDCl3, TMS）δppm：3.21~3.45（3H, m, 11-H, 17-2H）, 2.78
（2H, m, 10,2-He）, 2.32（3H, m, 14-2H, 6-H）, 2.12（2H, m, 10,2-He）, 2.07（2H, m, 3-Ha, 5-H）,
1.92（2H, m, 12,4-He）, 1.85~1.01（10H, m）.13C-NMR (CDCl3, TMS) δ ppm：170.1（C-15）, 63.4
（C-6）, 56.0（C-2）, 55.8（C-11）, 50.4（C-10）, 47.7（C-17）, 41.0（C-7）, 32.6（C-14）, 30.9（C-
5）, 30.3（C-12）, 28.2（C-4）, 23.8（C-3）, 21.9（C-8）, 21.6（C-9）, 19.0（C-13）.
It is Sophoridine such as Fig. 413C-NMR is composed.
It is Sophoridine such as Fig. 51H-NMR is composed.
Claims (6)
1. a kind of method that utilization microorganism prepares Sophoridine, it is characterized in that：The microorganism fungus kind title：Escherichia coli, depositary institution：China typical culture collection center, address：In Wuhan University, preservation day：On December 24th, 2014, protect
Hide numbering：CCTCC NO：M 2014659；Sophoridine is prepared using the microorganism fungus kind catalysis oxidation Sophoridine.
2. according to the method described in claim 1, it is characterized in that：The concentration of the substrate oxidation Sophoridine is 0.01-3mg/mL.
3. according to the method described in claim 1, it is characterized in that：The solvent of the substrate oxidation Sophoridine is：Absolute ethyl alcohol, third
Ketone, methanol, DMSO or their mixed solvent.
4. according to the method described in claim 1, it is characterized in that：The preparation reaction time is 1-5 days.
5. according to the method described in claim 1, it is characterized in that：The preparation reaction temperature is 25-37 DEG C.
6. according to the method described in claim 1, it is characterized in that：The preparation reaction temperature is 37 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510019812.5A CN104498558B (en) | 2015-01-15 | 2015-01-15 | A kind of method that utilization microorganism prepares Sophoridine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510019812.5A CN104498558B (en) | 2015-01-15 | 2015-01-15 | A kind of method that utilization microorganism prepares Sophoridine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104498558A CN104498558A (en) | 2015-04-08 |
| CN104498558B true CN104498558B (en) | 2017-10-10 |
Family
ID=52940008
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510019812.5A Expired - Fee Related CN104498558B (en) | 2015-01-15 | 2015-01-15 | A kind of method that utilization microorganism prepares Sophoridine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104498558B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106810555B (en) * | 2017-01-19 | 2019-01-22 | 北方民族大学 | A method of matrine being prepared by oxymatrine using metallic reducing agent |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1453276A (en) * | 2003-05-22 | 2003-11-05 | 王答祺 | Prepn of matrine, oxymatrine and sophoxidine from flavescent sophora root |
| CN102952773A (en) * | 2012-08-15 | 2013-03-06 | 华东理工大学 | Recombinant escherichia coli and method for preparing aloe-emodin |
-
2015
- 2015-01-15 CN CN201510019812.5A patent/CN104498558B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1453276A (en) * | 2003-05-22 | 2003-11-05 | 王答祺 | Prepn of matrine, oxymatrine and sophoxidine from flavescent sophora root |
| CN102952773A (en) * | 2012-08-15 | 2013-03-06 | 华东理工大学 | Recombinant escherichia coli and method for preparing aloe-emodin |
Non-Patent Citations (2)
| Title |
|---|
| A bacterial platform for fermentative production of plant alkaloids;Akira Nakagawa et al;《Nat Commun.》;20110524 * |
| 槐定碱、氧化槐定碱的药理学研究进展;余建强等;《宁夏医学院学报》;20050228;第27卷(第1期);78-80 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104498558A (en) | 2015-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108753627A (en) | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antitumor agent | |
| CN108660082A (en) | A kind of marine aspergillus source oxa- anthraquinone analog compound and preparation method thereof and the application in preparing antiseptic | |
| US9689017B2 (en) | Method of semi-solid state fermentation for producing surfactin from a mutant strain of Bacillus subtilis subsp | |
| CN104726369B (en) | One plant of solution ornithine Raoul bacterium and its application | |
| CN102061278B (en) | Methylovorus sp. MP688 and application thereof | |
| CN106635872B (en) | One plant of Mo Haiwei bacillus and its application | |
| CN107868757A (en) | A kind of plant endogenesis epiphyte and its application | |
| CN103898013A (en) | Thalassospira sp. strain and preparation of kappa-carrageenanase | |
| CN107629980B (en) | The Ludwig enterobacteria SXZ-N5 bacterial strain and purposes of one plant of production huperzine and Huperzine B | |
| CN109504634A (en) | Bacillus WZZ006 and its application | |
| CN104498558B (en) | A kind of method that utilization microorganism prepares Sophoridine | |
| CN104232508B (en) | Bacillus cercus ZJB-11071 and application thereof | |
| CN105861363A (en) | Eggerthella sp., engineering bacteria generated by S-equol and construction method and application of engineering bacteria | |
| CN113337432B (en) | Methylophilus for producing pyrroloquinoline quinone and application thereof | |
| Dutta et al. | Enhanced rapamycin production through kinetic and purification studies by mutant strain of Streptomyces hygroscopicus NTG-30-27 | |
| CN105779363B (en) | A kind of method of liquefied Serratia and its Synthesis heliotropin | |
| CN105002106A (en) | Engineering strains for high yield of platensimycin and platencin and fermentation and separation and purification technologies thereof | |
| CN104531591B (en) | One plant has the bacterial strain catalyzing and synthesizing sophoridine | |
| CN107686817A (en) | One plant of fetid marsh fleabane endogenetic fungus CYSK 4 and its Ascomylactam class compounds of production application | |
| CN103923853A (en) | Paenibacillus sp. and method for preparing k-carrageenanase by using same | |
| CN103865851B (en) | One strain Pseudomonas aeruginosa is used for the preparation of kappa-carrageenan enzyme | |
| CN102584615A (en) | Alkaloid compound as well as preparation method and application thereof | |
| CN106047751A (en) | Nocardiopsis, separation method of active metabolites of Nocardiopsis and application of Nocardiopsis | |
| CN106754408B (en) | One plant of porous trichoderma strain and its method for preparing terpenoid | |
| CN105176873B (en) | Produce the streptomycete bacterial strain of environment protecting blue pigment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20171010 Termination date: 20220115 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |